c:\work\Jor\vol901_1
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1-9
Role of Gray Scale and Color Doppler Ultrasound in Diagnosis of
Parotid and Submandibular Gland Diseases
Marwa Samy1, Mostafa Thabet1, Galal M. Galal1, Mahmmed Hasan Osman2, Reham Sameeh1
1 Diagnostic Radiology Department, Faculty of Medicine, Assiut University Hospital, Egypt
2 Oral and Maxillofacial Surgery department, Faculty of Medicine, Assiut University, Egypt
*Corresponding author: Marwa Samy, Mobile: (+20) 01025260404, Email: Marwasamy@aun.edu.eg
ABSTRACT
Background: Ultrasonography is considered as the primary imaging technique used for identification, diagnosis,
treatment, and follow-up of lesions affecting the major salivary gland. Both grey scale and color Doppler ultrasound
maneuvers are frequently used for assessment of various salivary gland infirmities. As well, it is used for classification
of the major salivary gland pathologies. This study aimed to assess the validity of ultrasound in the diagnosis and
prediction of the parotid and submandibular gland lesions.
Patients and Methods: Sixty-nine cases with salivary gland masses were investigated via using grey scale, color
Doppler and spectral Doppler. Grey scale was used for the morphological features of each tumor; color Doppler for the
blood vessel distribution and frequency; and spectral Doppler for determination of the peak systolic velocity, resistive
index and pulsatility index. Postoperative through histopathological examination was carried out for all cases after
excision of mass.
Results: According to the histopathological examination, 28 of 69 (40.6%) lesions were identified as benign, 13 of 69
(18.8%) as malignant, and 28 of 69 (40.6%) as inflammatory. Color Doppler revealed that malignant lesions had
significantly higher grade of vascularity and a mixed "scattered" pattern of distribution. Using spectral Doppler,
malignant masses had significantly higher Doppler ultrasound wave forms. Grey scale sonar showed that the rate of ill-
defined borders, heterogeneous structure, and irregular shape was significantly higher in Malignant than benign tumors.
Conclusions: Adding Doppler ultrasound (color and pulse wave) may grant better diagnosis for malignant salivary
gland tumors.
Keywords: Salivary gland, Malignant, Doppler, Grey scale, Color, Spectral.
INTRODUCTION
index (PI)) are important for identification of malignant
Salivary glands (SGs) are susceptible for affliction
lesions [6].
by group of diseases either systemic, inflammatory,
Moreover, it was approved that the method of
obstructive or malignancy [1]. Most of SG tumors are
choice for obtaining biopsy for histopathological
benign with variable degree of liability for recurrence
examination is the USG guided Fine Needle Aspiration
and/or malignant transformation [2]. Hence, prompt and
Cytology (FNAC). This adds extra-advantage for the
proper diagnosis is crucial for disease management.
use of USG in discrimination between benign and
Clinical examination alone won't give the proper
malignant lesions [3]. Plain X-ray, sialography, CT, MRI
salivary gland disease diagnosis. Therefore, imaging
and PET-CT are other imaging modalities used for
techniques are fundamental for accurate diagnosis and
diagnosis and characterization of salivary gland
classification [3].
diseases [7].
The role of ultrasonography (USG) in the
Although USG is a good tool for diagnosis,
diagnosis and treatment of SG lesions is crucial and
sometimes full visualization of lesion might be
central. The final diagnosis may be suggested by the
impossible and this is because of the lesion position, its
USG examination alone, or significant differential
extension into the deep gland tissue or behind the bone
diagnostic information may be provided [4]. It can
of the mandible. Thus, further imaging with CT or MRI
differentiate between intraglandular from extra-
is necessary [4].
glandular lesions in 98% of cases i.e., it can
The current study aimed to assess the validity of
discriminate salivary gland lesions as focal or diffuse.
USG (grey-scale and Doppler) in the diagnosis and
Lesion edge outline may differentiate focal lesions into
prediction of SG lesions.
malignant and benign. High resolution transducers USG
is better than Computerized Tomography (CT) or
PATIENTS AND METHODS
Magnetic Resonant Imaging (MRI) in detection of
The present study adopted an observational
lesions with irregular borders [5].
design and was conducted at the Radiology Department,
The findings of the Color Doppler are frequently
Assiut University, Egypt in the period from the 1st of
used for classification and characterization of lesions
January 2019 to the 1st of February 2021. Institutional
i.e., diagnosis of pleomorphic adenoma. Doppler
Ethical Committee permission was taken before starting
findings of intralesional vascularity, type and grade of
the study (IRB: 17100612) Trial registration was
vascularity, and Doppler ultrasound wave forms (pulse
prospectively undertaken in clinical trial.gov
wave velocity (PSV), resistive index (RI) and pulsatile
(NCT03746730) .The study was carried out in
accordance with the Helsinki Declaration guidelines.
1
Received: 20/5/2022
Accepted: 25/7/2022
c:\work\Jor\vol901_2
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 10-13
The Results of Meningitis/Encephalitis Panel in Children with
Suspected Central Nervous System Infections
Maha Zakariya Mohammed1*, Marwa Ramadan Mohamed Abdelhalim2,
Hoda Ezz Elarab Abdel Wahab Garrad2
Departments of Pediatrics1 and Clinical pathology2, Faculty of Medicine, Ain Shams University
Corresponding author: Maha Z. Mohammed, ORCID 0000-0002-6098-561X
, Email: mahazakariya@med.asu.edu.eg, Mobile:002 01124215285
ABSTRACT
Background: Central nervous system (CNS) infection in pediatrics is a considerable cause of morbidity and fatality.
Objective: The aim of the current study was to evaluate the AllplexTM Meningitis Panel Assays (ME) as a rapid
diagnostic method for CNS infections.
Methods: The study included 329 cerebrospinal fluid (CSF) samples from pediatric patients with suspected CNS
infections. The samples were analyzed using the AllplexTM ME panel in the period between January 2020 and January
2022.
Result: Out of the 329 CSF samples, 21 (6.4%) cases were positive. The commonest viral pathogen detected was parvo
B19 (n=11), followed by human herpes virus 7 (n=3) and human herpes virus 6 (n=2). Streptococcus pneumoniae (n=1)
was the only bacterial pathogen detected in our cohort. One patient with parvo B19 encephalitis improved markedly after
receiving methylprednisolone. Another patient with parvo B19 was diagnosed consequently as anti-N-methyl-d-aspartate
(NMDA) receptor encephalitis.
Conclusion: The AllplexTM ME Panel test can rapidly detect 18 pathogens from CSF. In view of antibiotics misuse, ME
Panel aids in diagnosis of CNS infection helping the clinicians in early management and shortening the length of hospital
stay. Case by case clinical evaluation is mandatory to avoid unnecessary request of the ME panel test. Further testing -
specially for CSF autoantibodies- is warranted in case of worsening or unsatisfactory improvement of the condition.
Keywords: Encephalitis, Meningitis, PCR panel, Pediatric.
INTRODUCTION
Nevertheless, it is anticipated that the yield of CSF
Pediatric meningitis and acute encephalitis are a
culture will be low in developing countries, where
large contributor to lengthy hospital stay, high
pretreatment with antibiotics is widespread (9).
mortality, significant morbidity and subsequent long-
In resource-limited setting, early diagnosis of CNS
lasting neurological sequelae (1).
infection is crucial to reduce mortality rate and avoid
The incidence of acute bacterial meningitis is
expenses needed for empiric antimicrobials and
estimated to be 57/100,000 in western countries (2,3),
isolation procedures in healthcare facilities. The aim of
while pediatric acute encephalitis syndrome in children
the current study was to evaluate the new multiplex
was reported to be around 10.513.8/100,000 (4).
PCR panel in determining the microbiologic etiologies
Regardless the causative organism, CNS infections
causing CNS infections in children.
can present with nonspecific symptoms including,
fever, neck stiffness, disturbed conscious level, nausea
PATIENTS AND METHODS
and vomiting, headache, photophobia, cranial nerve
Study design
palsies, rash, behavioral changes, focal weakness, and
This retrospective observational study was
seizure (2,3).
conducted at Ain Shams University (ASU) Children
Therefore, the causative organism cannot be
hospital. The study included 329 pediatric patients who
determined based on clinical presentation only (5).
were admitted between January 2020 and January 2022
In case of clinical suspicion of CNS infection, a
with suspected CNS infection, where lumbar puncture
lumbar puncture (LP) is needed at the earliest
was performed as a part of the routine investigations.
opportunity -unless contraindicated- to reach a
Demographic data, clinical picture and CSF results
diagnosis. Results of cerebrospinal fluid (CSF)
were collected from patients' records.
microbiology are crucial for identifying the pathogenic
organisms, making an appropriate antimicrobial
Methodology:
treatment decision, determining the length of therapy,
CSF samples were collected and sent to ASU
and avoiding the use of empirical antibiotic therapy (6-
laboratory to analyze CSF protein, and glucose levels,
8).
cytology and microbiological assessment.
CSF culture is typically positive in cases of
Bacteriological cultures were done on blood agar
bacterial meningitis that have not received treatment.
(BD) and chocolate agar (BD) for 72 hours.
10
Received: 13/3/2022
Accepted: 10/5/2022
c:\work\Jor\vol901_3
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 14- 18
Combined Intrauterine Lignocaine Injection and Paracervical Block Gives More Pain
Relief Than Either Method Alone in Dilatation and Curettage Procedure
Mohammed Ismail Sabry1, Alaa Masoud1, Israa Khedr2, Elsayed Elshamy*1, 3
1Department of Obstetrics and Gynecology, Menoufia University Hospital, Menoufia, Egypt.
2Department of Obstetrics and Gynecology, Quesna Central Hospital, Menoufia, Egypt
3Department of Obstetrics and Gynecology, King Abdul-Aziz airbase Hospital, Dhuhran, Saudi Arabia
*Corresponding author: Elsayed Elshamy, Mobile: (+2)01003071124, E-mail: s_shamy77@yahoo.com
ABSTRACT
Background: Endometrial samples are typically obtained by the gynecological procedure known as dilatation and
curettage (D & C). Anesthesia is required for the surgery. Although paracervical blocks are frequently employed, the
pain they cause is mild to moderate.
Objective: The aim of this study was to compare the efficacy of intrauterine instillation of lidocaine, paracervical block,
and a combination of the two procedures for their ability to control intra- and post-operative pain during and after
endometrial curettage.
Patients and Methods: This research was conducted in Ob/Gyn Departments of Menoufia University Hospital and
Quesna Central Hospital. 90 women were scheduled for endometrial curettage were divided into three equal groups by
random selection: Group 1 (n=30): Lidocaine 2% was administered intra-uterine. Group 2 (n=30): Received
paracervical blockage. Group 3 (n=30): Received combined intrauterine lidocaine and paracervical block.
Results: The current study showed that mean VAS value of D and C time was statistically higher among lidocaine (4.9
± 0.76) than in combined intrauterine lidocaine and paracervical block (3.93 ± 0.83). Mean VAS value of D and C time
was statistically higher among paracervical block (4.6 ± 1.13) than in combined intrauterine lidocaine and paracervical
block (3.93 ± 0.83). Five minutes after the procedure, pain was least after the combined technique (group 3) then after
intrauterine lidocaine group (group 1) then after paracervical block (group 2), (VAS:2.6 ± 0.93, 2.9 ± 0.9 and 3.67 ± 0.96
respectively). Conclusion: Greater analgesia was provided by using intrauterine lidocaine in combination with
paracervical block than by using either lidocaine or paracervical block alone.
Keywords: Paracervical block, Intrauterine lignocaine injection, Pain relief; Endometrial curettage, Cervical dilatation.
INTRODUCTION:
Society of Anesthesiologists (ASA) (5) class I and II
The endometrium is sampled via dilatation and
were counselled and invited to participate in the study.
curettage (D & C). With adequate analgesia, can be
done in outpatient setting. Regional anesthesia is used
Exclusion criteria: Pregnant women, women with
when the procedure is used in the clinic saving time, and
systemic illness, Active pelvic infection, sever uterine
in addition, reducing hospital occupation, cost and
bleeding and women with known allergy to lidocaine
avoiding complications of general anesthesia (1, 2). The
were excluded from the study.
majority of patients can bear minor discomfort during
A computer-generated randomization software
and after surgery as long as it is not life-threatening (3).
randomly assigned 90 women scheduled for
Pain scoring using visual analogue scale during the
endometrial curettage into three groups: group 1, group
procedure is comparable to other popular outpatient
2, and group 3, based on the type of anesthetic used;
procedures such as cervical punch biopsy, intrauterine
Group 1 (n=30) received a 2% uterine injection of
device (IUD) insertion and hysteroscopy and the
lidocaine. Group 2 (n=30) received a paracervical block
optimal method for pain control during such procedures
and Group 3 (n=30) got combined paracervical block as
is still unclear (4).
well as intrauterine lidocaine. Only one anesthesiologist
The aim of this study was to compare the efficacy
prepared the experimental drugs. Endometrial curettage
of intrauterine instillation of lidocaine, paracervical
was performed by one gynecologist. The visual
block, and a combination of the two procedures for their
analogue scale (VAS) was used to record pain during at
ability to control intra and postoperative pain during and
five and 30 minutes after the treatment. In lithotomy
after endometrial curettage.
position, bimanual examination was carried out. The
cervix was then exposed using a bivalve speculum. A
PATIENTS AND METHODS
single toothed vulsellum forceps were used to hold the
This prospective observational study was
cervical anterior lip. An endometrial cavity suction
conducted at Department of Obstetrics and Gynecology,
catheter (size 6 Fr) was used in group 1 and inserted 2
Menoufia University Hospital and Quesna Central
3 cm distal to the cervix into the endometrial cavity. 5
Hospital between March 2021 and February 2022.
ml of 2 percent lidocaine solution was injected into the
catheter and then clamped for 5 minutes to reduce
Inclusion criteria: All women planned for endometrial
backflow and allow the anaesthetic to take effect before
curettage for diagnostic and/or therapeutic purposes
the catheter was withdrawn. With a 22 G spinal needle,
during the study period and fit according to American
5 ml of 1 percent lidocaine was administered at 1
centimeter depth at the 3 and 9 o'clock positions of the
14
Received: 12/7/2022
Accepted: 27/9/2022
c:\work\Jor\vol901_4
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 19- 23
Effect of Educational Intervention About Osteoporosis
Knowledge among Egyptian Women
Hanaa S. Said 1, Hanaa A. Nofal 2
1 Department of Family Medicine, 2 Department of Community,
Environmental and Occupational Medicine, Faculty of Medicine, Zagazig University, Egypt
Corresponding author: Name: Hanaa Salah Said Elsayed, Telephone number: (+2) 01066175817,
Email address: drhanasalah@yahoo.com
ABSTRACT
Background: Osteoporosis is generally known as a silent disease. Osteoporotic fractures lead to decrease the patient
quality of life and major burden on the individual and community. Educational intervention is suitable for osteoporosis as
many of its risk factors are modifiable.
Methods: An intervention study was carried out on 130 Egyptian women attending Belbeis Family Health Center using a
sociodemographic questionnaire and LOKS-19 scale to assess osteoporosis knowledge. This work passed through three
phases (preintervention- intervention- postintervention).
Results: 130 participants; mean of age was 50.4 + 5.6. About 55.4% were from low social class and 60% of the sample
were menopausal. 58.5 % had positive family history, 86.2% of the sample were drinking caffeinated beverages. There
was a statistically significant improvement in the total knowledge after intervention (from 1.3% to 82.3%). There was
direct correlation between total adequate knowledge and education and social class. On the other hand, there was indirect
correlation between total adequate knowledge and age.
Conclusion: Simple educational programs are successful in raising osteoporosis awareness among Egyptian patients.
Keywords: Egyptian, Educational intervention, Knowledge, Osteoporosis.
INTRODUCTION
In Egypt, there were 21.9 percent of men and 28.4
Osteoporosis affects both sexes, however it affects
percent of women who had osteoporosis, as well as 53.9
women more than men (1). It is a skeletal disease causes
percent of women and 26 percent of men who had
porous bones result in bone mass reduction and bone
structure deterioration. The bone becomes more fragile,
osteopenia. The frequency of osteoporosis in women after
and the risk of fracture increases (2).
menopause was greater and reached 47.8% in Upper
Osteoporosis accounts for 1.5 million fractures every
Egypt's rural districts. Such a high incidence highlights
day, cause pain, increases cost of rehabilitation, disability,
the severity of the issue and the significance of having
quality of life becomes poor, and premature death due to
current recommendations for osteoporosis care in Egypt
decrease level of estradiol, decrease in osteoblastic
(6).
activity and a rise in osteoclastic resorption activity (3).
Although risk of osteoporotic fracture of women over
The study aimed to improve the knowledge regarding
the age of 50 is 50%, equivalent to the combined risk of
osteoporosis among Egyptian women.
developing breast, uterine, and ovarian cancers; less
developed nations are still ill-prepared to face the burden
Research Question
of the disease. Poor outcomes are caused by illiteracy, and
Does the educational intervention improve knowledge
a lack of knowledge about the risk factors and symptoms
regarding osteoporosis?
(4).
There are several known osteoporosis risk factors.
METHODS
Sex, advanced age, a low body mass index, menopause
An intervention study was carried out on 130
before age 45, and a family history of osteoporosis or
Egyptian women assuming that the mean level of
fragility fractures, nulliparity, lactation for long time,
knowledge about preventive measures of osteoporosis is
prolonged amenorrhea unrelated to menopause,
(1.74±0.74 - 1.97±0.49) pre- and post-intervention
inadequate intake of calcium and vitamin D, decreased
respectively (7) using open epi online program at 95%
intestinal absorption of calcium, lactose intolerance,
confidence interval and adding 10% non-response rate.
excessive intake of caffeine or alcohol; smoking,
The study applied on Egyptian women attending
sedentary life style, and prolonged treatment with thyroid
the family medicine clinic at Belbeis Family Health
hormones, anticonvulsants, glucocorticoids, use of
Center asking for any medical service. Belbeis is the
anticoagulants and aluminum antacids (5).
second largest district in Sharkia Governorate, Egypt
regarding population density. Sample unites were
19
Received: 15/7/2022
Accepted: 20/10/2022
c:\work\Jor\vol901_5
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 24-30
UGT1A9 Gene Polymorphism in Egyptian Systemic Lupus Patients
Receiving Mycophenolate Mofetil
Amr Mohamed. Fathy1, Ahmed Shawky Hassan1, Farha Abdel Aziz El Chennawi1,
Dina Abd El-Halim Shahin2, Youssef Mohamed Mosaad1
1Clinical Immunology Unit, Clinical Pathology Department, 2 Department of Internal Medicine,
Rheumatology and Immunology Mansoura Faculty of Medicine,
Mansoura University, Dakahlia, Egypt.
Corresponding author:Amr M. Fathy, ORCID ID: https://orcid.org/0000-0003-0570-3015,Phone number:
+201006094696,Email: Amrfathy@mans.edu.eg
ABSTRACT
Background: Mycophenolic acid (MPA), an efficient immunosuppressive medication used in SLE, is glucuronidated by
UGTs into an inert 7-O-glucuronide. Studies have shown that the -275T>A and-2152C>T SNPs in the UGT1A9 promoter
region are associated with greater hepatic production of UGT1A9 and higher MPA in vitro glucuronidation activity.
Subjects and Methods: patients were selected from outpatient Clinics of Rheumatology and immunology department,
UGT1A9 -275T>A and-2152C>T (SNPs) were genotyped in 50 SLE Egyptian patients and 100 healthy controls using PCR-
RFLP. In addition, MPA serum concentrations were measured in patients by homogeneous particle enhanced turbidimetric
inhibition immunoassay (PETINIA) technique.
Results: UGT1A9-2152C>T and -275T>A distribution of genotypic analysis in SLE patients and controls revealed that the
-2152C>T mutation is present in 14% patients and 21% of the control group (P = 0.3), whereas the -275T>A mutation is
present in 50% of patients and only in 11% of the control group (P = 0.001). In comparison to the (TT) genotype, the
combined (TA+AA) genotype exhibited significant correlation with greater GIT symptoms (68% versus 5%, respectively,
P = 0.001). In SLE patients taking MPA with CT+TT genotype against CC genotype, -2152C>T mutations revealed a higher
incidence of anemia (85.7% versus%, 30.2 respectively P =0.009). Both SNP genotype carriers had statistically lower C0
MPA values compared to non-carriers (1.25 umol/L (0.62-7.8) versus 4.68 umol/L (0.62-25.9), P = 0.028.
Conclusion: Carrier of both UGT1A9-2152C>T and -275T>A SNPS is associated with lower C0 MPA in comparison to
non-carrier in Egyptian SLE patients.
Keyw ords: UGT1A9, polymorphism, SLE, MPA.
Abbreviations: MPA (Mycophenolic acid), SNPs (Single nucleotide polymorphisms), UGT (uridine diphosphate-
glucuronosyltransferases).
INTRODUCTION
molecules(3), Numerous cells, including those in the liver,
SLE is a multiorgan autoimmune illness that
kidney, and gastrointestinal system, express this enzyme.
typically affects girls between the ages of 20 and 30. Its
A single nucleotide polymorphism (SNP) in the UGT1A9
etiology is unclear. SLE has remission and exacerbations
promoter (-2152C>T and -275T>A) affects the
and affects several organs, including the skin, CNS,
expression and activity of this enzyme, and it is believed
kidneys, lungs, heart, and blood cells. Positive antinuclear
that these SNPs have pharmacologic importance in terms
antibodies with a titer of 1/80 or above utilizing indirect
of MPA activity and concentration(4).
immunofluorescence on HEP-2 cells or any similar
This study sought to examine the distribution of
approach serve as the diagnostic characteristic(1).
the
T-275A
and
C-2152T
single
nucleotide
An immunosuppressive medication known as
polymorphisms (SNPs) in the UGT1A9 promoter region
mycophenolic acid (MPA) is frequently used to avoid
in Egyptian patients with SLE as well as how these SNPs
acute rejection in kidney transplants. It is also utilized in
affected the pharmacokinetics of mycophenolic acid
several SLE patients, most notably Lupus nephritis, to
(MPA).
induce
and
maintain
remission.
Inosine-5'-
monophosphate dehydrogenase (IMPDH), a crucial
PATIENTS AND METHODS
enzyme involved in the de novo synthesis of guanosine
The patients were selected from outpatient Clinics
nucleotides, is reversibly inhibited by MPA. This
of Rheumatology and immunology department,
prevents DNA replication and stops the proliferation of T
Mansoura university hospitals between January and
and B cells, which suppresses humoral and cell-mediated
august 2021. The present study included 150 patients
immunity and induces tolerance(2).
divided into two groups; the control group included 100
Uridine5'-diphospho-glucuronosyltransferase
seemingly healthy subjects: 10 males & 90 females,
(UDP-glucuronosyl transferase) is an enzyme that
whose ages ranged from 18-50 years with a median age
transfers glucuronic acid to small hydrophobic
of 34 years. The patient group included 50 systemic lupus
24
Received: 9/5/2022
Received: 8/7/2022
c:\work\Jor\vol901_6
The Egyptian Journal of Hospital Medicine (October 2022) Vol. 89, Page 31- 36
The Effect of Surgical Salpingectomy versus Single-Dose Methotrexate on Ovarian
Reserve in Ectopic Pregnancy at Alzahraa University Hospital
Rania Mahfouz Abd El-Wahed*1, Alshaymaa Abdelbadie Abdelalim Nasr2
Departments of 1Obstetrics and Gynecology and
2Clinical Pathology, Faculty of Medicine for Girls, Al-Azhar University, Cairo, Egypt
*Corresponding author: Rania Mahfouz Abd El-Wahed, Mobile: (+20) 01001131785, E-Mail: rania.mahfouz2@gmail.com
ABSTRACT
Background: Ectopic pregnancy (EP) is a major reason of maternal mortality and morbidity, affecting 1% to 2% of
pregnancies. Whether medically with methotrexate (MTX) or surgically with salpingectomy, managing EP could
seriously affect female sexuality and reproductive health. The impact of medication and surgical treatment for EP on
future fertility is currently unknown and has not been well explored. Objective: This study examines the future
reproductive effects of medication and surgical management for EP. Patients and methods: In this prospective study,
50 EP subjects were involved and randomly subdivided into two groups: (MTX) (Group A, n: 25) and salpingectomy
(Group B, n: 25). Anti-Mullerian hormone (AMH), beta-human chorionic gonadotropin (-HCG), liver enzyme levels,
and platelet count were evaluated before and after the treatment protocol. Hysterosalpingography (HSG) has also been
conducted three months after therapy for Group A to examine tubal patency. Results: Three months following therapy,
the AMH levels significantly decreased in Group A compared with Group B (p=0.04). Also, in Group A, AMH levels
after 3 months showed a statistically significant decline contrasted with those at the time of therapy. Conclusion: AMH
levels prior to and after medication with a single dose of systemic MTX and unilateral salpingectomy for EP were
positive signs. Present medical and surgical therapy methods have no detectable detrimental impact on ovarian reserve.
Keywords: Salpingectomy, Methotrexate, Ectopic, Pregnancy, Al-Azhar University.
INTRODUCTION
still the best option for EP. Salpingectomy may
Ectopic pregnancy (EP) is a major reason of death
compromise OR due to the close physical closeness of
and illness in mothers and affects between 1% and 2%
the fallopian tube and ovary, as well as their shared
of all pregnant women [1]. Even though it can grow in
blood supply [3].
different places outside of the uterus, the fallopian tubes
Anti-Müllerian hormone (AMH) is synthesized by
are the most frequent where it happens. Diagnostic and
granulosa cells of antral follicles in the ovary of females.
imaging approaches have improved, making early
The hormone is then secreted into the follicular fluid
detection and management possible, leading to a large
and blood circulation. In health care settings, its
drop in maternal deaths [2].
concentration in peripheral circulation is monitored.
Currently
available
treatments
include
The level of AMH level is commonly associated with
pharmacological Methotrexate (MTX) and surgical
the number of primordial follicles, which could make it
(salpingectomy, salpingostomy, as well as milking)
the most precise hormonal monitor of the OR [5].
methods. MTX is a potent chemotherapeutic drug that
AMH levels correlated along with the count of
is frequently prescribed for various EPs [3].
recovered oocytes, the quality of embryos, fertility
However, MTX is considered a highly efficient
rates, as well as live birth percentages in patients
and non-invasive medication for EP, showing a
experiencing in vitro fertilization (IVF) [6]. AMH level
significant risk of infertility by targeting aggressively
is recognized as a more accurate and dependable
dividing
cells
in
the
ovaries.
prognostic of OR, particularly in comparison to
Furthermore, MTX therapy is associated with a lengthy
conventional
markers,
including
follicle-
period between both the cure of EP and the necessity to
stimulating hormone (FSH) and antral follicle count
wait several weeks before attempting again. There
(AFC) [7].
could also be a negative influence on ovarian reserve
Developing the capability of releasing AMH from
(OR) [4]. Surgical treatment, such as salpingectomy, is
a primordial follicle is considered to require at least
31
Received: 02/06/2022
Accepted: 09/08/2022
c:\work\Jor\vol901_7
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 37- 46
The Pattern of Cardiovascular Manifestations in Egyptian Patients With
Ankylosing Spondylitis and Its Relation to Disease Activity
Nashwa Aly Morshedy, Amina Badr Eldein, Mostafa Kamel Hassan, Mohammed Abd El Monem Teama*
Department of Internal Medicine, Rheumatology and Immunology,
Faculty of Medicine, Ain Shams University, Egypt
*Corresponding author: Mohammed Abd El Monem Teama, Mobile: (+20)01277580006, Email: mohteama2009@yahoo.com
ABSTRACT
Background: Cardiovascular manifestations are one of the most common extraarticular features of ankylosing
spondylitis (AS) patients. Objective: To characterize the cardiovascular symptoms of AS in a sample of Egyptian
patients and to establish a connection between these symptoms and disease activity.
Patients and Methods: Forty adults with Spondyloarthritis (SpA) were chosen at random from Ain Shams University
Hospital and diagnosed using Assessment of Spondyloarthritis International Society (ASAS) criteria for current cross-
sectional study. All patients underwent detailed history taking, full clinical examination, laboratory investigations
including (CBC, ESR, CRP, lipid profile) resting electrocardiogram, cardiac echo and carotid duplex to measure Carotid
Intima-Media Thickness (CIMT), and evaluate disease activity using the Ankylosing Spondylitis Disease Activity Score
(ASDAS)-C-reactive protein.
Results: The majority of patients (about 66%) experienced cardiac symptoms have had a valvular lesion, with tricuspid
regurgitation being the most common symptom (42.5%) then diastolic dysfunction (25%) followed by systolic
dysfunction (20%), intra cardiac mass (5%) and pericardial effusion (2.5%). Most of our patients had abnormal lipid
profile (hypertriglycerdemia 87.5%, hyperchlostremia in 80%, high LDL in 90%), 21 patients (52.5%) had abnormal
CIMT. The ASDAS-CRP score of the patients was ranged from 0.4-4.6. It was statistically significant correlated with
age, multiple cardiovascular lesions as systolic dysfunction, diastolic dysfunction (p<0.05), different forms arrhythmias,
and CIMT (p<0.05) although there is no statistically significant link to lipid profile (p>0.05).
Conclusion: Cardiovascular affection in AS patients is frequent, whether being clinical or subclinical and it is related
in a way to high disease activity.
Keywords: Cardiovascular manifestations, Ankylosing spondylitis, Lipid profile, Disease activity.
INTRODUCTION
are all examples of cardiovascular involvement in AS.
Inflammatory illnesses of the sacroiliac (SI)
The most common problems are aortic insufficiency
joints and the rest of the axial skeleton are known as
and conduction abnormalities. Although uncommon,
axial spondyloarthropathies (axSpA). Patients have a
mitral insufficiency in AS can lead to life-threatening
wide range of negative symptoms, including pain,
heart failure (7).
exhaustion, restricted spinal motion, functional
The researchers in this study set out to do just
incapacity, and diminished mental health (1).
that by identifying and analysing the cardiovascular
Chronic inflammatory back pain is a hallmark
symptoms of AS in a sample of Egyptian patients and
of axSpA, which can be subdivided into two categories
determining how they relate to disease activity.
based on clinical and radiological characteristics: A).
PATIENTS AND METHODS
Radiographic axSpA, which is characterised by
Patients:
radiographic and structural alterations in the SI joints.
Forty adult patients were enrolled in the current
B) Sacroiliac inflammation revealed by MRI or the
cross-sectional study diagnosed with AS using the
presence of HLA-B27 in combination with classic
ASAS criteria (8). From May 2021 through January
spondylarthritis characteristics are the gold standards
2022, patients from the Ain Shams University hospitals'
for diagnosing non-radiographic axSpA(2).
outpatient clinic and the Internal Medicine and
In the United States, axSpA has an incidence of
Rheumatology Departments were enrolled. Patients
0.91.4% among adults, which is comparable to that of
with psoriasis, inflammatory bowel diseases (Ulcerative
rheumatoid arthritis (3).
colitis, Crohn's disease), other autoimmune diseases
AxSpA is often diagnosed and treated by
(SLE, RA, Scleroderma), diabetic, hypertensive, obese
rheumatologists.
However,
non-rheumatologists
patients (metabolic syndrome), and hypothyroidism
frequently miss the diagnosis because to a lengthy delay
were excluded from the study.
in making the determination (4).
One of the most prevalent extra articular
Methods:
symptoms of AS is cardiovascular system involvement,
Clinical evaluation:
which is especially common in patients with long-term
A complete history was taken from all subjects
AS and peripheral joint involvement (5).
with focus on sex, age, duration of the disease, drug
Different studies showed that those with AS
history as well as full clinical, and rheumatological
have a higher chance of developing cardiovascular
examination with special emphasis on: axial spine
disease (6). Atrioventricular (AV) block, aortitis of the
(cervical, thoracic and lumbosacral regions) and
ascending aorta, aortic insufficiency and branch block
examination of sacroiliac joints.
37
Received: 16/7/2022
Accepted: 17/9/2022
c:\work\Jor\vol901_8
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 47-54
Calvarial Lesions: En-bloc Resection Is a Safe Surgical Procedure
Mohammed Mourad*, Mahmoud Wahdan, Ahmed R. Rizk
Department of Neurosurgery, Faculty of Medicine, Benha University, Egypt
*Corresponding author: Mohammed Mourad, Mobile: (+20)01558445071. Email: morademan@yahoo.de.
ABSTRACT
Background: Calvarium could be a target site for either primary or secondary tumors. Calvarial tumors present usually
as painless palpable masses, which are asymptomatic neurologically. Objective: To perform a retrospective analysis of
the calvarial lesions operated in our departments of neurosurgery. Patients and Methods: We retrospectively reviewed
41 consecutive patients operated for calvarial masses between 2014 and 2020 at Benha University Hospital and Merciful
Brothers Hospital Trier. Clinical data were retrospectively analyzed. The diagnosis was confirmed by the
histopathological examination. Results: Calvarial lesions included in this series were divided into 3 categories: tumor-
like lesions, primary, and secondary tumors. The group of tumor-like lesions involved eosinophilic granuloma (3
patients), epidermoid cyst (3 patients), and fibrous dysplasia (5 patients). The primary tumors included hemangiomas
(5 patients), osteomas (5 patients), and meningiomas (11 patients). Nine patients had metastasis. Calvarial lesions mostly
presented with local swelling, sometimes local pain and rarely neurologic deficit. En-bloc resection was performed
followed by cranioplasty. Pain was improved postoperatively in cases presented with painful swelling. The only
postoperative complication was one case of wound infection. Conclusion: Although a thorough preoperative
radiological evaluation in cases of calvarial lesions could be helpful in narrowing the diagnosis spectrum of differential
diagnosis, en-bloc resection followed by cranioplasty could be considered as a valuable treatment option. The next step
in treatment of such patients vary widely according to the histopathological findings.
Keywords: Skull metastasis, calvarial tumors, cranioplasty, PMMA.
INTRODUCTION
Calvarial lesions are usually asymptomatic and may
which was diagnosed through histopathology. No cases
be discovered incidentally(1). That's why such lesions
were excluded from the study.
carry less clinical importance than intracranial lesions(2).
The medical records of 41 patients were reviewed for
When becoming symptomatic they present themselves as
demographic data, the records of each patient were
a visible or palpable painless mass, which is sometimes
analyzed documenting pre- and postoperative clinical
painful(3). It is worthy to note that a wide variety of serious
symptoms and radiological as well as intraoperative
diseases can stand behind such a simple lesion and early
findings, surgery-related complications, and short-term
diagnosis is crucial for starting the optimum treatment(2).
outcome.
Although CT scan is commonly considered a good tool
Ethical consent:
for the diagnosis of any boney lesion, MRI enables the
An approval of the study was obtained from Benha
screening for metastases in both skull and brain(4).
University Academic and Ethical Committee. Every
Differentiation of the imaging features of both benign and
patient signed an informed written consent for
malignant lesions is vital for establishing the radiological
acceptance of participation in the study. This work has
diagnosis(5).
been carried out in accordance with The Code of
Histopathological examination is crucial in
Ethics of the World Medical Association (Declaration
reaching
the
definite
diagnosis.
Additionally,
of Helsinki) for studies involving humans.
postoperative staging is important not only for metastatic
Statistical analysis:
lesions but also for some other lesions like eosinophilic
The collected data were coded, processed and
granuloma and fibrous dysplasia. Our strategy in dealing
analyzed using the SPSS (Statistical Package for Social
with such lesions is to perform en-bloc resection with
Sciences) version 22 for Windows® (IBM SPSS Inc,
immediate reconstruction using polymethyl methacrylate
Chicago, IL, USA). P value < 0.05 was considered
(PMMA). Two-staged surgery is used very rarely in cases
significant.
with large skull lesions, where reconstruction is
performed in the second stage using a 3D-printed
RESULTS
cranioplasty.
This study included 41 patients (18 males, 23
The aim of our study is to perform a retrospective
females). The characteristics and presentations of the
analysis of the calvarial lesions operated in our
patients are shown in table 1. Accidental diagnosis was
departments of neurosurgery.
common in metastasis (56% accidentally diagnosed),
where the diagnosis was performed during routine
PATIENTS AND METHODS
staging. An example of the accidental finding was a
A retrospective analysis was performed for all the
patient diagnosed for a frontal osteoma in whom a CT-
calvarial lesions operated upon between January 2014 and
brain was performed due to left-sided weakness, and
May 2020 at Benha University Hospital Egypt and
showed chronic subdural hematoma and the osteoma (Fig.
Merciful Brothers Hospital Trier- Germany. Preoperative
6). The patient characteristics, pathology and presenting
CT and MRI confirmed presence of a calvarial lesion,
symptoms are presented in Table 1. Table 2 shows the
number and location of the lesions in the presented series.
47
Received: 14/7/2022
Accepted: 12/9/2022
INTRODUCTION
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 55- 62
Early Outcomes of Glenn Shunt in Patients Aged 3 to 6 Months vs. above 6 Months
Ihab Mohamed Salah El Din Elsharkawy*, Ahmed Mohamed Abd Elmegeed El-Feky, Hossam Mahmoud
Hassanein, Tamer Farouk Siam, Mahmoud Saber Elsayed Singer
Lecturer of Cardiothoracic Surgery, Faculty of Medicine, Cairo University, Egypt
*Corresponding author: Ihab Mohamed Salah El Din Elsharkawy, Mobile: (+20) 01222222213,
E-Mail: bebosharkawy@gmail.com
ABSTRACT
Background: Bi-directional Glenn shunt is a well-established procedure performed as a part of the single ventricle
palliation pathway. The Bi-directional connection may also provide definitive palliation in certain patients. A major
advantage of the cavopulmonary connection is that it diminishes the extent of the inevitable pulmonary recirculation,
thereby resulting in a decrease in the workload of the functionally single ventricle.
Objective: To compare the short-term outcome of Glenn operation in patients aged between 3 to 6 months and
patients aged 6 months above. Patients and methods: Our study was a retrospective randomized trial, carried out in
Cairo University Hospitals, in the period between October 2018 and May 2020. Study Population had been
randomized into two groups. Group I: 20 patients who underwent Bi-directional Glenn aged 3 to 6 months & Group
II: 20 patients who underwent Bi-directional Glenn aged more than 6 months.
Results: There were significant differences between both groups regarding preoperative evaluation including age,
weight, sizes of RPA & LPA and McGoon index. Unbalanced AV canal and DILV are most common diagnoses after
tricuspid atresia as explained by their natural incidence in single ventricle diseases. There was significant increase in
the O2 saturation in each group. There was insignificant difference between both groups regarding post-operative
mortality and morbidity that met with many other similar studies.
Conclusion: This approach had a number of advantages where it eliminates the need for the traditional first-stage
procedures, such as systemic arterial shunting and PA banding, which minimizes PA manipulation and subsequent
distortion. The reduction in the number of procedures will also have a favorable impact on cost.
Keywords: Bi-directional Glenn shunt, Outcomes, patients aged 3 to 6 months vs. above 6 months.
INTRODUCTION
Bi-directional Glenn (BDG) shunt is a well-
established procedure performed as a part of the single
improve long-term diastolic function, decreasing the
ventricle palliation pathway. The Bi-directional
effective cardiac output required from the single
connection may also provide definitive palliation in
ventricle, avoiding potential pulmonary tree distortions
certain patients. A major advantage of the
seen with systemic to pulmonary shunts, and perhaps
cavopulmonary connection is that it diminishes the
preventing the development of pulmonary vascular
extent of the inevitable pulmonary recirculation,
obstructive disease (3). Despite increased reports in the
thereby resulting in a decrease in the workload of the
literature documenting the early BDG procedure, there
functionally single ventricle. Other advantages include
is continued controversy regarding the timing, with
the avoidance of pulmonary vascular disease, and also
some arguing little benefit in waiting beyond 6 months
major pulmonary arterial distortion (1). Univentricular
(4, 5). On the other hand, others are cautioning against
atrioventricular connection affects approximately 3 %
performing the procedure in those younger than 6
of infants born with congenital heart disease. Early
months. These cautions stem from concern with possibly
palliative procedure for such infants is mandatory with
increased mortality and morbidity with an early Glenn
the goal to relief cyanosis, prevent damage to
procedure; the possibility that the pulmonary arteries will
ventricular functions and pulmonary vasculature, and
not be as well developed with passive flow, and the
facilitate future definitive repair by preserving
potential adverse effects on cerebral circulation or long-
physiologic parameters. The cavopulmonary shunt
term candidacy for Fontan completion. The ideal age and
(superior vena cava to the right pulmonary artery)
age limits to perform the Glenn procedure remain
provides partial physiological correction for those
uncertain (6). The aim of the study was to compare the
infants. Its main advantage is to provide obligatory
short-term outcome of Glenn operation in patients
pulmonary blood flow, and avoid left ventricular
aged between 3 to 6 months and patients aged 6
volume
overload
accompanying
systemic-to-
months and above, to show whether it is safe to
pulmonary artery shunt (2).
perform Glenn operation before 6 months of age or
There have been numerous studies looking at
not.
the timing of the BDG procedure, with many
highlighting the potential benefits of performing an
PATIENTS AND METHODS
``early'' BDG procedure. These include removing a
This was analytical observational retrospective
volume load from the single ventricle that can benefit
study, 40 patients indicated for Glenn shunt were
atrioventricular (AV) valve insufficiency and perhaps
included after institutional and local ethical committee
approval. The study was done at Cairo University
55
Received: 16/06/2022
Accepted: 24/08/2022
c:\work\Jor\vol901_10
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 63- 70
Open Surgical Excision of Intracranial Arachnoid Cysts after
Initial Procedure Failure in Children
Mohamed M. Elmaghrabi*, Tamer M. Elsanadidy, Ahmed A. Arab
Department of Neurosurgery, Faculty of Medicine, Benha University, Egypt
*Corresponding author: Mohamed M. Elmaghrabi, Mobile: (+20)1222751406, Email: dr_elmaghrabi@yahoo.com
ABSTRACT
Background: Intracranial arachnoid cysts (IAC) are pathological conditions that occur in 2.6% of children. Different
surgical procedures had significant failure rate. The objective of the current study is to evaluate the effectiveness of
open surgical excision in failed first-other surgery.
Patients and methods: A total of 23 patients with symptomatic arachnoid cysts, with radiological evidence who had
had one previous failed surgical intervention, shunting or endoscopic fenestration, underwent open surgical excision of
the arachnoid cyst at the Neurosurgery Department of Benha University and Benha Children Hospitals through the
period from January 2018 to January 2022.
Results: Children with IAC underwent open surgical excision, totalling 9 (39.1%) cases and partial in 14 (60.9%) cases.
In 13 cases, associated microscopic fenestration to basal arachnoid cisterns was done. The mean follow-up period is
28.36 (SD 3.97) months with 77.3% success and 22.7% failure with subsequent treatment by cystoperitoneal shunting.
Total excision success is 100%, but partial excision is 64.3%, with 88.9% of them being associated with microscopic
fenestration. Mild early transient complications were reported in only 3 cases and were conservatively treated, but late
complications occurred in 2 cases.
Conclusion: Open surgical excision of IAC has a very good success rate in the treatment of intracranial arachnoid cysts
after initial procedure failure; complete excision should be the main aim whenever possible for optimum results that
force us to ask: "Could it be the first line of surgical treatment in symptomatic untreated cases?"
Keywords: Open surgical excision, Intracranial arachnoid cyst, Cystoperitoneal shunting, Children.
INTRODUCTION
radiological evidence who had a previous failed surgical
Intracranial arachnoid cysts (IAC) are pathological
intervention, either shunting or endoscopic fenestration
conditions that occur in 2.6% of children (either
were included in this study, and they underwent open
symptomatic or asymptomatic), with 90% of these
surgical excision of the arachnoid cyst at the
occur in the supratentorial area, with 60% in the middle
Neurosurgery Department of Benha University and
cranial fossa (1). The aetiology of although it is unclear,
Benha Children's Hospitals throughout the period from
a splitting or duplication of arachnoid membranes with
January 2018 to January 2022.
an accumulation of cerebrospinal fluid via a slit valve
A total of 23 patients were recruited; 13 boys, and
mechanism is mostly accepted (2-4).
10 girls, ranging in age from 1 year to 9 years (mean age
Most authors suggested surgical intervention as the
3.39; SD 2.25). It included one death case in the early
symptomatic arachnoid cyst had symptoms and signs
postoperative period due to electrolyte imbalance
related to cyst size and expansion with increased intra-
without radiological complications from surgery. The
cystic pressure (5, 6).
IAC was classified as Sylvian (12/23), Middle Cranial
Different surgical procedures were approached,
Fossa (5/23), Posterior Cranial Fossa (4/23), and Frontal
including aspiration, open surgical excision, endoscopic
(2/23).
fenestration, marsupilization, and cystoperitoneal
shunting (3,4, 7-8).
Preoperative Work-up:
Cystoperitoneal
shunting
and
endoscopic
All patients underwent routine physical
fenestration are good surgical options with good results.
examinations and received a thorough neurological
However, some cases with cystoperitoneal shunting
evaluation. Neuroimaging studies consisted of
complications and dependency and with ineffective
computerized tomography (CT) and magnetic
endoscopic fenestration may need open microscopic
resonance imaging (MRI).
surgery, aiming for effective fenestration to the basal
Clinically, these patients either presented with the
cistern, marsupilization, or more extensively to partial
same symptoms as before the previous intervention, or
or complete excision of the arachnoid cyst.
showed deterioration after an initial period of clinical
In our study, we evaluated the effectiveness of open
improvement. Symptoms included signs of increased
surgical excision of an arachnoid cyst in cases with
intracranial pressure (headache, drowsiness, vomiting,
ineffective
previous
shunting
or
endoscopic
bulging of fontanels, and an enlarged head), seizures,
fenestration.
hemiparesis, and visual obscuration. All patients had a
CT scan; those with no improvement or newly
PATIENTS AND METHODS
developed problems, such as a large compressing
Study design: this is a prospective clinical cohort study
subdural hygroma were included in this study. For those
of 23 patients with symptomatic arachnoid cysts with
who participated in the study, magnetic resonance
63
Received: 17/06/2022
Accepted: 25/08/2022
c:\work\Jor\vol901_11
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 71- 78
Late onset Systemic Lupus Erythematosus: Different Clinical, Serological
Presentations and Damage Compared to Adult Lupus in Egypt
Samah A. El Bakry, Mariem Abd-Elrahman,
Marwa Mohamed Elsayed, Fatma Mohammed Badr*
Internal Medicine, Rheumatology and Immunology, Faculty of Medicine, Ain Shams University, Cairo, Egypt
*Corresponding author: Fatma Mohammed Badr, Mobile: (+20)01274307978, Email: dr_fatma2020@yahoo.com
ABSTRACT
Background: Comparing cases of adult onset and late onset systemic lupus erythematous (SLE) reveals significant
differences in clinical, serological, disease activity, and damage score.
Objective: This study aimed to analyze clinical manifestations, laboratory data, serological markers, and prognosis of
late-onset SLE (L-SLE) and for comparing with adult- onset SLE.
Patients and Methods: One hundred fifty individuals with SLE were included in a cross-sectional study conducted at
Ain Shams University Hospital. They were divide into: Group 1 included 100 cases with adult-onset (age of onset 19
years and below 50 years). Group 2 included 50 Patients with L-SLE (age of onset 50 years). All patients were
subjected to medical history, physical examination, disease activity measured by the SLE disease activity index
(SLEDAI-2K) and a damage score. Laboratory investigations as complete blood count (CBC), blood urea nitrogen
(BUN), serum creatinine, anticardiolipin antibodies, lupus anticoagulant, protein creatinine ratio, serum complement
(C3, C4), anti-dsDNA antibody, and antinuclear antibodies (ANA).
Results: Mucocutaneous manifestations, frequency of hematuria, proteinuria, urinary cast, consumed C3, positive anti-
dsDNA antibodies, anti-cardiolipin antibody and lupus anticoagulant titers had considerably greater rates in-group 1
compared to group 2 (P-value <0.05) while group 2 had significantly more musculoskeletal symptoms (P-value <0.05).
The SLEDAI scores of the two groups were equivalent, however the damage index was greater in group 2 (P-value
0.00). Neuropsychiatric, cutaneous, renal, and skin damage were more frequent in group 1, while musculoskeletal,
endocrinal, pulmonary, cardiovascular and ocular damage were more frequent in- group 2.
Conclusion: late-onset SLE is different from adult onset SLE with more frequent damage.
Keywords: Adult SLE, L-SLE, SLEADI, Damage score.
INTRODUCTION
established
by
Systemic
Lupus
International
Clinical and laboratory symptoms of the
Collaborating Clinics (SLICC) (6) who attended Ain
autoimmune illness as SLE can vary widely. Despite
Shams University Hospitals. They were divided into
lacking of understanding of its origin, we know that
two groups: Group 1 included 100 cases with adult-
genetic, hormonal, and environmental variables all play
onset SLE. Adult onset SLE was defined as age of onset
a part in the progression of this disease (1).
19 years and below 50 years. Group 2 included 50
Systemic signs of SLE include fever and
patients with L-SLE. L-SLE was defined as age of onset
arthritis, but it can also harm the kidneys and the central
50 years. Patients with other autoimmune diseases and
nervous system. The prognosis and quality of life of a
those with drug-induced lupus were excluded from the
patient can be improved by taking measures to prevent
study.
permanent harm to vital organs (2). Both the intensity and
clinical manifestations of the disease are influenced by
II) Methods:
the age at which it first appeared. The onset and
Complete clinical evaluations were performed for
progression of L-SLE (50 years) are less obvious and
all patients, including a thorough history taking session
less severe. (3) that characterized by a reduced incidence
where age, sex, disease duration, and presenting
of nephritis and central nervous system involvement
symptoms were emphasized. A thorough physical
compared to the adult-onset type (4).
examination and a thorough musculoskeletal
Nonetheless, L- SLE has a worse prognosis
examination. Laboratory assessment including CBC,
because of age and prolonged exposure to vascular risk
urine analysis besides assessing active urinary
factors, which results in an increased prevalence of
sediments (white blood cells, red blood cells, as well as
concomitant disorders and increased organ damage (5).
casts or proteins), kidney function tests (serum
Our study aimed to analyze clinical
creatinine and BUN), protein creatinine ratio,
manifestations, laboratory data, serological markers,
erythrocyte sedimentation rate (ESR) by Westergren
and prognosis of L-SLE and for comparing with adult-
method, ANA and direct immunofluorescence with
onset SLE.
anti-double-stranded
DNA
antibodies.
Serum
complements levels C3 and C4 by Cobas C6000
PATIENTS AND METHODS
autoanalyzer, anticardiolipin (IgG & IgM) antibodies by
I) Patients:
enzyme-linked immunosorbent test (ELISA) and lupus
The current cross-sectional study recruited 150
anticoagulant by diluted Russell viper venom time
SLE patients diagnosed upon SLE classification criteria
(Roche Diagnostics GmbH, Mannheim, Germany). The
71
Received: 24/7/2022
Accepted: 25/9/2022
c:\work\Jor\vol901_12
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 79- 83
High Tumor Levels of Ki-67, VEGF and Endostatin are Associated with
Progression of Breast Cancer in Iraqi Women
Rana H. K. Al-Rubaye1& Rakad M. Kh AL-Jumaily2*
1Department of Biology, College of Education for Pure Sciences/ Ibn Al-Haitham, University of Baghdad, Iraq.
2Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq
*Corresponding author: Rana H. K. Al-Rubaye, E-mail: rana.h.k@ihcoedu.uobaghdad.edu.iq
ABSTRACT
Background: Breast cancer (BC) is the most widespread cancer among women worldwide. Its incidence and mortality rates
have risen in the previous three decades as a result of changes in risk factor profiles, improved cancer registry, and cancer
detection. Objective: The study's goals were to establish if Ki-67 could be used as a potential marker in serum of cancer
disease patients as well as their interaction with vascular endothelial growth factor (VEGF) and ES in various stages of
breast cancer to assess their function in the progression of BC.
Materials and Methods: The levels of Ki-67, VEGF and endostatin (ES) in serum were assessed by commercial enzyme
linked immunosorbent assay (ELISA) kits in 60 women diagnosed with breast cancer (age range 3380 yrs.) and 30 age-
matched healthy controls. Two groups of breast cancer patients: groups 1 consisted of stage II (Low level) and groups 2
consisted of patients in stage III and IV (High level).
Results: The results showed a significant increase of Ki-67 and VEGF in BC patients as related to healthy control with
increases in patients in advanced stage. The data revealed that the level of ES was much lower in patients with low-stage
(stage II) compared to the group of control, but it was significantly higher in women with advanced-stage of BC.
Conclusions: The Ki-67, VEGF, and ES levels in the serum of studied groups may be a good marker in the progression of
BC.
Keywords: Ki-67, VEGF, Endostatin, Breast cancer.
INTRODUCTION
placental growth factor (PlGF) are the most common
Breast cancer (B.C.) is a global problem, ranking top
members of the VEGF family (8). Angiogenesis is a key
among malignant neoplasms and affecting around 13% of
component of carcinogenesis, development, and metastasis
women in their lifetime (1). Breast cancer accounts for one-
in many human cancers. VEGF is regarded to be a key
third of all registered women's cancers in Iraq (2).
regulator of angiogenesis, promoting tumor cell
Ki-67 is a DNA binding protein that is found in most
proliferation as well as invasion and metastasis. Tumor
of vertebrates. It's commonly used as a proliferation mark
vascular density, particularly BC, has been shown to be
for tumor grading. It's expressed in every kinetic stage of
closely related to prognosis (9). However, pathologic
the cell cycle except G0. It is regarded as one of the most
angiogenesis can be caused by disturbances in the balance
dependable indices for determining the degree of
of pro- and anti-angiogenic factors (10).
malignant tumor cell proliferation (3). Ki-67 has recently
Endostatin is created by proteolytic cleavage of
received much attention as a promising prognostic,
collagen XVIII by a set of proteinases such as elastase,
predictive, and therapeutic target in malignant neoplasms
matrix metalloproteinases (MMPs) and procathepsin L (11).
such as bladder, lung, cervical, and breast carcinomas (4).
Endostatin suppresses angiogenesis by binding to VEGFR-
In some tumors' tissue, the expression of Ki-67 was used
1 and VEGF- 2 and preventing VEGF interaction with Flt-
as a clinical setting to study the state of tumor (5). However,
1 and Flk-1 and all downstream signaling proceedings (12).
it has suggested that Ki-67 have the ability to secrete or
This study aimed to identify the relationship between
leaked out of cancer cells and thus, it can easily be
VEGF-A, ES and Ki-67 to evaluate their potential roles in
measured in the serum of patients (6).
the progression of BC disease.
Angiogenesis is the formation of new vasculature
from pre-existing ones. Aangiogenesis process is tightly
MATERIALS & METHODS
maintaining by the interaction between pro- and anti-
Study design
angiogenic factors. Many potent promoter angiogenic
A total of 90 Iraqi women participated in this
factors are described since the identification of the master
study; 60 women were diagnosed with BC during their
role of growth factor in maintaining the balance of
attendance at Oncology Teaching Hospital /Medical
angiogenesis forming (7). VEGF-A is a key regulator of
City/Baghdad. The study extended from November 2020
vascular growth among pro-angiogenic factors, and the
till April 2021. Age of breast cancer women range from
VEGF family is regarded a key activator of vascular
(3380) years. In addition, 30 apparently healthy women
development and angiogenesis. VEGF-A (commonly
also participated in this study whose ages ranged between
known as VEGF), VEGF-B, VEGF-C, VEGF-D, and
32-75 years. Patients with BC involved in this paper were
79
Received: 5/8/2022
Accepted: 6/10/2022
c:\work\Jor\vol901_13
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 84- 87
Mitral Valve Repair in Children with Mitral Insufficiency
Using Single Simple Technique
Ihab Mohamed Salah Eldin Elsharkawy*1, Hosam Fathy Ali Sayed1,
Mahmoud M. Elwakeel2, Ahmed H. Lamloom1
Departments of 1Cardiothoracic Surgery and 2Anasthesia Faculty of Medicine, Cairo University, Egypt
*Corresponding author: Ihab Elsharkawy, Mobile: (+20) 01222222213, E-Mail: bebosharkawy@gmail.com
ABSTRACT
Background: The multifactorial nature of pathologies causing mitral valve insufficiency in children along with the
anticipated child's growth make mitral valve repair in such age group a complex procedure. The main cardiac surgeon's
consideration in repairing insufficient mitral valve is to rgestore the valve's geometry and motility using the simplest
possible technique.
Objective: This study assessed mid-term feasibility and durability of mitral posterior annuloplasty using pericardial
patch in patients aged less than 18 years as a simple technique of mitral valve repair.
Patients and Methods: Data from Cairo University Hospitals on total number of 100 children who underwent
successful mitral valve repair (without need for valve replacement) were gathered from their records, including
postoperative and follow-up echocardiographic studies.
Results: there were no in-hospital mortalities nor early postoperative significant mitral regurgitation (MR). Follow-up
echocardiographic studies revealed moderate mitral regurgitation in 8 patients (8%) and only one patient (1%) required
re-operation for severe mitral regurgitation where mitral valve replacement (MVR) was done.
Conclusion: MV repair (MVr) in children using pericardial patch for posterior annuloplasty showed excellent survival,
acceptable re-operation rate and satisfactory valve function at short and mid-term follow-up.
Keywords: Mitral valve repair, Posterior annuloplasty, Pericardial Patch and para-valvular leakage.
INTRODUCTION
Inclusion criteria: Patients between the ages of 1 and
Mitral valve replacement (MVR) in children
18 years who have a significantly regurgitant mitral
has several drawbacks and is linked to a high mortality
valve as shown by a preoperative echocardiographic
ranging between 10 to 36% (1). Additionally, the need
scan and clinical signs of pulmonary congestion despite
for prolonged anticoagulant medications and the
maximal drug therapy.
likelihood of repeat MVR as the kid gets older are
associated with greater morbidity (2). Thus, whenever
Exclusion criteria: Patients with complex congenital
possible, mitral valve repair is preferred over
heart anomalies, atrioventricular septal defects, atrio-
replacement especially in pediatric populations(3).
ventricular discordance, and those with bad
Over the past two decades, many mid- and
preoperative condition including high inotropic support
long-term publications have reported that pediatric
and mechanical ventilation due to suspected high
patients can infer the same benefits from mitral valve
morbidity and mortality postoperatively were barred
repair as grown-ups with respect to preserving valvular
from participating.
tissue, sub valvular apparatus, and ventricular
One hundred consecutive patients meeting the
geometry, driving to ideal valve and ventricular
above criteria were entered into the study. Intra
dynamics (3-6). For best results of repair in children,
operative Trans-esophageal echocardiography (TEE)
cardiac surgeon has to minimize tissue handling and
and
postoperative
transthoracic
follow-up
avoid usage of any synthetic materials including mitral
echocardiography data were analyzed.
rings as mismatches between the native annulus and the
All patients underwent routine preoperative
mitral prosthesis have been linked to both early and late
investigations including electrocardiogram, chest X-
mortality (7, 8).
ray, hemoglobin, urea, electrolyte, serum creatinine and
echocardiography. MVr was performed trans-septally
AIM OF THE STUDY
in 78 patients, while the left atriotomy approach was
We aims to assess whether the use of a strip of
used in the remaining patients with a sizable left atrium.
the patient's own pericardium for mitral posterior
annuloplasty is feasible and durable as a simple MVr
Ethical approval:
technique in children with leaky mitral valves.
An approval of the study was obtained from
Cairo University Academic and Ethical Committee.
PATIENTS AND METODS
Every patient's parent signed an informed written
This descriptive, retrospective, and record
consent for acceptance of the operation. This work
analysis study included 100 patients who underwent
has been carried out in accordance with The Code of
isolated surgical MVr carried out in the Department of
Ethics of the World Medical Association
Cardiothoracic Surgery, Faculty of Medicine, Cairo
(Declaration of Helsinki) for studies involving
University in the period from January 2015 to
humans.
December 2021 aimed to assess the effectiveness of
posterior mitral annuloplasty using pericardial strip.
Surgical Technique:
84
Received: 22/6/2022
Accepted: 30/8/2022
c:\work\Jor\vol901_14
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 88- 92
Evaluation of Interleukin-18 Serum Concentration and Gene Polymorphism
(Rs1946518) in A Sample of Type-2 Diabetes Mellitus Patients from Iraq
Zainab Abdul Hadi Hussein1, Dunya Fareed Salloom1
Department of Biology, Collage of Science, University of Baghdad,Iraq
*Corresponding author: Zainab Abdul Hadi Hussein, zainab.abd2102m@gmail.com, mobile: (+964)07729807897
ABSTRACT
Background: Type two diabetes (T2DM) is characterized by insufficient insulin production and secretion. Additionally,
the body develops insulin resistance which affects 9095% of diabetics. Complex cytokines, receptors, genetic pathways,
and the immune system are involved in T2DM. Interleukin-18 (IL-18) is one of the inflammatory cytokines associated with
Type 2 diabetes. Environmental and genetic variables, including genetic polymorphisms, can increase T2DM risk and its
consequences. Single nucleotide gene polymorphisms (SNPs) are important risk factors for diabetes that can be used to find
the disease early and treat it better.
Objective: This study aimed to determine the levels of IL-18 in the serum of Iraqi patients with Type 2 diabetes mellitus,
as well as the effect of IL-18 SNP rs1946518 (-607 G/T) in the etiology of T2DM.
Materials and Methods: This study involved 100 T2DM patients (52 males and 48 females) who visited Al-Karamah
Teaching Hospital and Baghdad Teaching Hospital. 52 Iraqi control subjects (26 males and 26 females) were included. A
sandwich enzyme-linked immunosorbent assay was used to quantify the IL-18 serum levels of 48 patients and 40 healthy
controls. The genotype of IL-18 was determined using Real-time (RT) Taqman PCR.
Results: According to age, the current study revealed a non-significant correlation (p-value > 0.05) among the studied
groups. IL-18 levels in the T2DM group were substantially greater than in the healthy control. In addition, the genotyping
frequencies revealed that the frequency of TT genotyping was higher in T2DM group than in healthy control (80% versus
66.7%, OR: 2.0), whereas the frequency of GT genotyping was lower in T2DM than in healthy persons (20% versus 33.3%,
OR: 0.5).
Conclusion: This Iraqi's novel study indicated that IL-18 and it's SNP(rs1946518) contributes to the pathophysiology of
Type 2 diabetes mellitus.
Keywords: T2DM, Interleukin-18, SNP, RT-PCR.
INTRODUCTION
beta cells, resulting in insufficient insulin production and
According to the World Health Organization
hyperglycemia (T2D) (5).
(WHO), diabetes mellitus is a chronic metabolic
Patients with T2DM have elevated cytokine
condition characterized by high blood glucose levels,
expressions and immune cell infiltration of pro-
which overtime causes damage to the heart, blood vessels,
inflammatory macrophages in their pancreatic islets (6).
eyes, kidneys, and nerves. T2DM, which accounts for
The IL-1 cytokine family, a prominent class of
90% of diabetes mellitus cases, is characterized by
immunoregulatory agents, has key roles in endocrine
insufficient insulin secretion by pancreatic islet cells,
processes and the regulation of inflammatory stress
tissue insulin resistance (IR), and an inadequate insulin
responses, particularly in T2DM (7). IL-18, a member of
secretory compensatory response (1). Since T2D is known
the IL-1 family of cytokines, is a proinflammatory
as non-insulin-dependent diabetes, T2DM patients do not
cytokine with pleiotropic effects and a molecular weight
require insulin therapy to survive (2).
of 18 kDa and 157 amino acids (8).
The etiology of type 2 diabetes is complicated and
Interleukin-18 (IL-18) was found as an interferon-
involves numerous risk factors included age, genetic
gamma (IFN)-inducing factor in the late 20th century. IL-
inheritance, environmental variables, lifestyle, and
18 also contributes to the pathophysiology of atopic,
infections (3). The risk of developing T2DM is
autoimmune, and chronic inflammatory illnesses, in
significantly influenced by genetic predisposition, which
addition to its role in immunological protection against
includes genetic faults of IR and genetic defects in insulin
infectious pathogens (9). Causing inflammation and
secretion (4).
immune cell infiltration, IL-18 can cause pancreatic islet
An inflammatory reaction arises due to the immune
cell injury/death and dysfunction by inducing
response to elevated blood glucose levels and the
inflammation. Then the resulting insulin resistance or
presence of inflammatory mediators generated by
insulin sensitivity suppression leads to type 2 diabetes (10).
adipocytes and macrophages in adipose tissue. This
Numerous clinical studies have demonstrated that plasma
chronic and low-grade inflammation damages pancreatic
levels of interleukin-18 (IL-18) are positively linked with
the onset and progression of type 2 diabetes (11).
88
Received: 22/6/2022
Accepted: 30/8/2022
c:\work\Jor\vol901_15
The Egyptian Journal of Hospital Medicine (October 2022) Vol. 90, Page 93- 98
Evaluation of Interleukin-9 Serum Level and Gene Polymorphism in A
Sample of Systemic Lupus Erythematosus in Iraqi Female's Patients
Marwah Mohammed Jasim 1, Dunya Fareed Salloom1
Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq
*Corresponding author: marwamohammed90n@gmail.com, mobile: +9647707373618
ABSTRACT
Background: Immunological gene and serum level for interleukin- 9 rs 17317275 have been established to have linked
to predisposition systemic lupus erythematosus (SLE) and its severity. SLE is a severe, systemic autoimmune disease
characterized by autoantibody generation, complement activation, and immune complex deposition. In the
pathophysiology of SLE, cytokines have a pleiotropic function. Recently, IL-9 was discovered to mediate strong anti-
inflammatory effects in numerous cells or experimental autoimmune models.
Objective: This study aimed to determine the role of age, IL-9 serum level and genetic polymorphism, C-reactive
protein (CRP), Anti-nuclear antibody (ANA) and Anti- double-stranded DNA (anti-dsDNA) to recognize SLE
pathogenesis.
Materials and Methods: This case-control study was carried out in Baghdad Teaching Hospital and Typical
Rheumatology Unit through the period from October 2021 to January 2022.103 Iraqi patients with SLE illness and 50
healthy Iraqis were included. Blood samples were taken. Serum IL-9 levels measured using the sandwich enzyme-linked
immune-sorbent assay technology (ELISA) and cytokine genotyping by using allele-specific PCR technique
Results: SLE groups had greater levels of IL-9 than did healthy volunteer. Furthermore, both autoantibodies (ANA,
Ant-dsDNA) were positive in SLE patients. The findings indicated that CRP was much higher in SLE subjects than
those of healthy controls. On the other hand, the results showed that there was non-significance (p-value > 0.05) in age
of studied groups. Concerning genotyping frequencies, the GG and AG genotyping were greater in the SLE group
compared to the healthy subjects, while the AA genotyping frequency was significantly lower in the SLE group
compared to the healthy people.
Conclusion: This study indicated the major roles of the serum level and genetic polymorphism of IL-9, CRP, ANA and
anti-ds DNA in pathogenesis and severity of SLE.
Keywords: SLE, IL-9, Polymerase chain reaction, ANA.
INTRODUCTION
tissues of target organs such as the skin, kidneys, and
SLE is a complex and heterogeneous autoimmune
synovia. Most of the cytokines promote inflammation,
condition that usually affects women throughout their
although some also have immunoregulatory or anti-
reproductive years. It is caused by a breakdown in
inflammatory activities (6).
immunological tolerance and the interaction of SLE
In SLE patients, the chronic inflammatory
susceptibility genes with diverse environmental
condition can cause mortality and morbidity. Many
variables, which results in the creation of pathogenic
immunological lineages' development, maturation, and
autoantibodies (1). SLE has an etiology that is unknown.
activation depend greatly on cytokines. These cytokines
Several potential factors have been identified and
accelerate the inflammatory process in several organs,
demonstrated to increase disease susceptibility or to
affect the immune cells' gene expression, and the
stimulate the immune system resulting in an
pathophysiology of SLE is influenced by many
inflammatory response that eventually causes the illness
cytokines (7).
to develop. Predisposition to SLE is influenced by
In this study, we aimed to understand the role of
genetic
factors
(2).
Autoantibody
generation,
interleukin-9 (IL-9) in the pathogenicity of SLE. It is a
inflammation, and endorgan damage emerge from a
144-amino acid protein with an 18-amino acid secretory
complex combination of genetics, environment, and
signal sequence that belongs to the gamma-chain
hormones that cause immunological dysregulation and
cytokine family. It was first identified as one of a
the lss of self-antigen tolerance (3).
growing number of cytokines that play critical roles in
Besides, immune dysfunction, inflammation, and
the growth, survival, proliferation, and differentiation of
organ damage are all caused by cytokine abnormalities.
various types of cells (8).
Cytokine production is increased when both the innate
Mast cells, NKT cells, Th2, Th17, Treg, and
and adaptive immune systems are disordered (4). They
ILC2 cells were among the cells that generated it,
are small, soluble proteins made by immune system
although Th9 cells are the main ones (9).
cells and mediate the activation or functional direction
The human IL-9 gene can be identified on
of neighboring cells by attaching to their surface
chromosome 5 long arm (10). A wide spectrum of
receptors. Communication between immune cells is
immunological functions has been attributed to IL-9 in
mediated by cytokines, which is essential for organizing
promoting cellular and humoral immune responses (11).
defenses against infections (5). Secreted cytokines can be
IL-9 has been linked to a variety of disease pathogenic
seen in the bloodstream, saliva, urine, as well as in the
processes, most notably allergic disorders such as
93
Received: 26/6/2022
Accepted: 2/9/2022
c:\work\Jor\vol901_16
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 89 (2), Page 99- 106
Downstaging of Rectal Cancer Following Neoadjuvant Chemoradiotherapy;
How Far Could Functional MRI Support Organ Preservation Approach
Roaa M Farahat1, Mohamed R Habba2, Ahmed F Elserafy2, Ahmed MM Gomaa3, Radwa A Noureldin2
1 Department of Radiodiagnosis, Ismailia Medical Complex
2 Department of Radiodiagnosis and 3 Department of Surgery, Faculty of Medicine, Suez Canal University
Address for Correspondence: Ahmed Mohamed Gomaa, Tel: 01002416360, E-mail: gomaaahmed@hotmail.com
ABSTRACT
Background: Rectal cancer constitutes a distinct subset of colorectal carcinoma necessitating a dedicated multidisciplinary
approach through the journey of diagnosis and treatment. Neoadjuvant chemoradiotherapy (CRT) has the advantage of tumor
down staging, with a chance of pathologic complete response (pCR) with reflection on locoregional recurrence rates, and
increased overall survival. In this study we aim to assess the response to neoadjuvant chemoradiotherapy offered to patients
with locally advanced rectal cancer using functional MRI then to be validated through final pathological result following
standard surgical management.
Patients and Methods: This study included 29 patients with rectal cancer eligible for neoadjuvant therapy. Patients had
their MRI before and after neoadjuvant CRT, then they underwent surgical intervention in the form of anterior resection
with total mesorectal excision (TME) or abdominoperineal resection (APR). Final pathological results were compared to
post CRT functional MRI results. Results: We found that neoadjuvant CRT downstaged our patients to the extent that
rendered around 15 percent of patients with complete pathological response could have made benefit from organ
preservation approach with either `watch-and-wait' or local excision, a chance could be offered in regards to good
standardized functional multiparametric MRI assessment.
Conclusion: Response to neoadjuvant treatment in locally advanced rectal cancer could be assessed with multiparametric
functional MRI giving the patient good chances regarding the best tailored surgical options that influence disease control
and overall survival.
Keywords: Organ preservation, Watch and wait strategy, Functional MRI, Cancer rectum, Neoadjuvant chemoradiotherapy
INTRODUCTION
complete
response
can
only
be
considered
Rectal cancer constitutes a special subset of
via examination of the primary tumor area histologically.
colorectal carcinoma and it comes second between all
Histological tumor response is estimated by applicating
female malignancies and third in male cancers worldwide.
what is recognized as "tumor regression grades". Most of
This raises the need to a dedicated multidisciplinary
these schemes identify proportions of residual malignant
approach through treatment journey (1).
cells as well as the surrounding fibrosis and inflammation,
Conventional MRI gained broad acceptance in
subsequently a final number is then assigned (4).
pretreatment evaluation of rectal cancer and local staging
Response to neoadjuvant CRT is variable. A work
via its prospect to assess and predict circumferential
carried out by Glynne-Jones in 2016 reported a cPR in
margins, extramural invasion and venous invasion with
nearly 25% of cases (4).
good accuracy by high resolution T2 TSE (2).
Many systems were developed for grading response
Nowadays, locally advanced rectal carcinoma is
to therapy, the first of which was the Mandard system (5),
given neoadjuvant chemoradiation therapy (CRT)
then came the Dworak method (6), which was widely
targeting reducing local recurrence and increasing disease
employed in Europe. Following the idea of these authentic
free survival (3).
systems, the College of American Pathologists designed a
Although numerous diagnostic methods proposed to
regression grade (Figure 1) (7) focusing on recording
assess the degree of tumor response to neoadjuvant CRT,
residual tumor and found to correlate with better
it is vital to emphasize that a definitive diagnosis of
outcomes (8).
Figure (1): AJCC and College of American Pathologists Regression Grade (7)
99
Received: 10/8/2022
Accepted: 10/10/2022
c:\work\Jor\vol901_17
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 107- 112
Combined Effect of Nanohydroxyapatite and Chitosan on
Remineralization of Initial Enamel Lesion in Vitro
Fatima Saeed J. Al-Ward1 *, Nada Jafer MH. Radhi
Pedodontic and Preventive dentistry department, Baghdad University, College of Dentistry
*Corresponding author: Fatima Saeed Al-Ward, Mobile: (+964)7901652676,
Email: fatima.yahya1901@codental.uobaghdad.edu.iq
ABSTRACT
Background: The initial clinical manifestation of enamel caries is a white spot lesion (WSL). It is comprised of a porous
lesion body and a surface layer that is mostly unaffected. Dissolved calcium and phosphate ions that are somewhat trapped
in the adjacent dental plaque biofilm re-precipitate to form it. If remineralization mechanisms are undertaken, it is
anticipated that the WSL can be reverted when the process is still at an early stage.
Objective: This study aimed to examine the ex-vivo remineralization effectiveness of chitosan + nanohydroxyapatite
combination on artificially induced incipient lesion using Vickers microhardness tester.
Material and Methods: Artificial caries was created chemically by immersing 40 human teeth individually in
demineralizing solution for 72 hours. Then the teeth were subjected to a 10-day pH cycle. Samples were assigned to four
groups: (1) Control; (2) Chitosan (3) Nanohydroxyapatite and (4) Chitosan/nanohydroxyapatite complex. Surface
microhardness measurements were performed prior to lesion formation, after lesion formation and after treatment.
Diagnodent was used to assess mineral loss before and after demineralization. Results: The study's findings showed that
the sample from group 4 (combination of chitosan and nanohydroxyapatite) had the highest level of enamel remineralization,
and when compared to the control, there was a statistically significant difference(P0.05). The result of this study also
showed that DIAGNOdent was unable to detect mineral loss in vitro. Conclusion: We can state that the combination of
chitosan and nanohydroxyapatite promoted the remineralization of artificially induced incipient caries.
Keywords: Caries, Remineralization, Chitosan, Nanohydroxyapatite, Microhardness. Diagnodent.
INTRODUCTION
early enamel decay under a pH cycle model has been
The initial clinical manifestation of enamel caries is
shown in several research using NANO- HA as a
a white spot lesion (WSL). It is comprised of a porous
biomimetic substance (9,10). If NANO-HA is paired with
lesion body and a surface layer that is mostly unaffected.
some other efficient non-fluoride compound that will not
Dissolved calcium and phosphate ions that are somewhat
affect Nano HAP, could have a co-operative benefit in
trapped in the adjacent dental plaque biofilm re-
promoting remineralization. Then, full remineralization
precipitate to form it (1). If remineralization mechanisms
could be expected (9).
are undertaken, it is anticipated that the WSL can be
For our knowledge, no previous studies had been
reverted when the process is still at an early stage (2). The
conducted to determine the combined impact of NANO-
deposit of mineral onto demineralized enamel within the
HA and chitosan. Therefore, the present study was aimed
enamel lesion is caused by the movement of calcium and
to assess how NANO-HA and chitosan together might
phosphate out of the tooth into the lesion., which is
affect the ex vivo remineralization of initial lesions, also
described as remineralization of carious lesions (3) .
to determine if the chitosan- NANO-HA mixture is more
An N-deacetylated chitin derivative substance is
efficient at enhancing subsurface mineral deposition in
chitosan, has gained a great deal of attention. Because of
WSL under a dynamic pH cycling and then to establish a
its action in encouraging enamel remineralization due to
strong base on which to apply these remineralizing
its readily available nature, bio - compatibility,
materials in dental treatments. Mechanical characteristics
biodegradability, and nontoxic nature, chitosan has been
as well as visible surface alterations following
employed in dental biomaterial (4,5) . Another compound
remineralization were evaluated using the Vicker surface
which has anti carious properties is hydroxyapatite, a
microhardness as well as the fluorescence technique by
substance that is both bioactive and biocompatible and is
DIAGNOdent. The null hypothesis has been stated that
frequently utilized in dental and medical procedures (6).
chitosan/ NANO-HA mixture has no additional effect on
Nano-hydroxyapatite (NANO-HA) is identical to dental
each of the material when applied separately on artificial
apatite in structure but it is more soluble, more bioactive
WSL.
and has better surface energy than hydroxyapatite (7).
MATERIALS & METHODS
According to available reports, NANO-HA may act as a
Sample preparation
remineralizing agent (8,9,10). NANO-HA can defend teeth
40 human upper first premolars extracted for orthodontic
by adding a fresh coat of artificial enamel to the tooth's
purposes from individuals between the ages of 12 and 18
surface, rather than making the current layer harder by
years old were chosen. The study excluded any teeth
adding fluoride (11). This capability of remineralization of
having apparent or identifiable caries, fillings,
107
Received: 13/10/2022
Accepted: 13/12/2022
c:\work\Jor\vol901_18
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 113-120
Alternation in circARF3 (ADP-ribosylation Factor 3) and its Target Gene
miR-103 Activity Promotes Hepatocellular Carcinoma in Obese Patients with
Metabolic-Associated Fatty Liver Disease
Nearmeen M. Rashad*1, Abdalla M. Nawara1, Sherweet M. Ahmed2,
Hala Mosaad3, Amany Moheldin Sediq4, Ola M. Elfarargy5, Hassan Mahmoud Hassanin1
Departments of 1Internal Medicine, 2Tropical Medicine, 3Medical Biochemistry ,4Clinical Pathology and 5Medical
Oncology, Faculty of Medicine, Zagazig University, Zagazig 44511, Egypt.
*Corresponding author: Nearmeen M. Rashad, Mobile: (+20) 01224248642,
E-mail: nrashad78@yahoo.com & n.rashad@zu.edu.eg.
ABSTRACT
Background: Hepatocellular carcinoma (HCC) is the fourth most common cancer-related cause of death worldwide
and poses a severe threat to public health. In addition to being an underlying risk factor for HCC, obesity is one of the
common causes of metabolic-associated fatty liver disease (MAFLD). Objective: Therefore, the current study aimed to
investigate the expression levels of both circARF3 (ADP-ribosylation factor 3) and its target gene miR-103 in obese
patients with MAFLD and to assess their relations to susceptibility and clinicopathological features of HCC.
Patients and methods: The current study was conducted on 100 subjects (50 control groups and 50 obese patients with
MAFLD). The case group was subclassified to 39 patients without HCC and 11 patients with HCC. The expression
levels of circARF3 and miR-103 were investigated by RT PCR. Results Our results revealed statistically significant
higher values of circARF3 in MAFLD (1.89±0.614) compared to control (0.72±0.341). In addition, the level of miR-
103 was statistically significantly higher in MAFLD (2.41±0.82) compared to control (0.912±0.335), P 0.001. Also,
there were statistically significant higher values of circARF3 in HCC (4.67±1.63) compared to non-HCC (1.44± 0.74).
In addition, the level of miR-103 was statistically significantly higher in HCC (4.99±1.32) compared to non-HCC
(1.512±0.45), P <0.001. Interestingly, circARF3 and miR-103 significantly correlated with obesity indices and
metabolic and hepatic dysfunction biomarkers. Cut-off values 0.94, 1.2, 1.8, 2.98 were able to discriminate simple
steatosis, steatohepatitis, cirrhosis, and HCC with AUC 0.78, 0.64, 0.77, 0.81 respectively. Conclusions The current
study results detected upregulation of both studied epigenetic markers; circARF3 and miR-103 in obese MAFLD
patients especially patients with HCC. Thus, they could be used as diagnostic biomarkers of MAFLD-associated HCC.
Keywords: MAFLD, HCC, circARF3, obesity, miR-103 relative expression.
INTRODUCTION
of fatty tissue, changes of gut microbiota, and
Hepatocellular carcinoma (HCC) is a major
dysregulated microRNA in increasing the relative risk
public health problem and the 4th leading cause of
of HCC among obese patients (10,11).
cancer related mortality worldwide (1). Recently, a
There is published data indicating that
report demonstrated that metabolic-associated fatty
circRNAs in adipose tissues can gain access to the
liver disease (MAFLD) is emerging as the main
circulation inside microvesicles and have functions in
etiology for chronic liver disease progressing HCC (2).
target organs. In support of this hypothesis, a recent
The diagnosis of MAFLD is based on the presence of
report indicated that adipose-derived exosomes,
hepatic steatosis plus one or more of other conditions
through regulating the deubiquitination-related miR-
such as overweight/obesity, type 2 diabetes mellitus
34a/USP7 axis, can mediate the delivery of circRNAs
(T2DM), or metabolic abnormalities with no additional
and promote the tumorigenesis of HCC (12).
exclusion criteria (3). Regarding metabolic dysfunction,
Risk factors for MAFLD-associated HCC
the definition includes at least two features from the
including obesity, diabetes, deposition of iron, genetic
following: increased waist circumference, arterial
and epigenetic factors, microRNA, and gut microbiota.
hypertension, elevated triglycerides, low high-density
The aim of this work is to investigate the expression
lipoprotein (HDL-C), prediabetes, insulin resistance,
levels of both circARF3 and its target gene miR-103 in
and subclinical inflammation (4).
obese patients with MAFLD and assess their relations
Of interest, increased prevalence of treatment of
to susceptibility and clinicopathological features of
hepatitis C virus (HCV) by antiviral therapy leads to a
HCC.
decrease HCV-related HCC (5). Additionally, the
PATIENTS AND METHODS
increased prevalence of western dietary pattern and
The current study enrolled 50 healthy subjects as a
decrease physical activity has accelerated the incidence
control group and 50 obese patients with MAFLD; both
rates of MAFLD (6,7). Obesity is one of the usual causes
groups were sex and age matched. For accurate
of MAFLD, which is also an underlying risk factor for
assessment of body fat, a dual energy X-ray
HCC (8). One must bear in mind that obesity is strictly
absorptiometry (DEXA) scan was done for estimation
associated with HCC (9). There is a lot of evidence
of fat mass index (FMI) and fat-free mass index (FFMI).
emphasizing the pathogenic role of increased reactive
The study design is shown in figure 1.
oxygen species, adipokines dysregulation, remodeling
113
Received: 14/08/2022
Accepted: 15/10/2022
c:\work\Jor\vol901_19
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90(1), Page 121- 131
The prognostic Value of Cancer Stem Cell Marker, Cluster of
Differentiation 133 Expression in Stage III Colorectal Carcinoma
Mohamed Ali Alabiad1*, Warda M. M. Said2, Ibtesam Elhasadi2, Amany Mohamed Shalaby3,
Mohammed Alorini4, Ola M. Elfarargy5, Heba F. Taha5, Ahmed M.Yehia6 ,
Dina Ahmed Khairy7, Abla Sayed Mahmoud7
1Departments of Pathology, 5Medical Oncology and 6General Surgery,
Faculty of Medicine, Zagazig University, Egypt.
2Department of Pathology, Faculty of Medicine, University of Benghazi, Libya.
3Department of Histology and Cell Biology, Faculty of Medicine, Tanta University, Egypt.
4Department of Basic Medical Sciences, Unaizah College of Medicine and Medical Sciences,
Qassim University, Unaizah, Kingdom of Saudi Arabia.
7Department of Pathology, Faculty of Medicine, Beni-Suef University, Egypt
Corresponding author: Mohamed Ali Alabiad,Email: maabyad@medicine.zu.edu.eg,,
ORCID: https://orcid.org/0000-0002-6006-3711, Tel: 00201150509554
ABSTRACT
Background: Colorectal cancer (CRC) is the 3rd most prevalent diagnosed cancer and the 4th leading cause of cancer-related
deaths globally. Nodal staging is significantly more essential in rectal cancer that detects most the therapy options.
Objectives: This study aimed to evaluate CD133 expression in the colorectal carcinoma stage III using immunohistochemistry
as well as its relationship to clinicopathological characteristics and patient outcomes.
Patients and Methods: The study includes 60 cases with stage III CRC five years after surgical removal of the tumor and
regular follow-up with the Departments of Medical and Clinical Oncology where clinicopathological and prognostic data are
collected from the archives. The patients were classified into two groups, GI includes 22 CRC patients with relapse, and GII
includes 38 CRC patients without relapse. Sixty archive paraffin blocks of primary resection and metastatic lymph nodes were
extracted from the archives of the Pathology Department processed for CD133 immunohistochemistry. CD133 expression
levels were assessed, analyzed, and correlated with clinicopathological and prognostic criteria.
Results: Positive CD133 expression was significantly linked with old age ( P=0.034 ), large tumor size ( p < 0.001), perineural
invasion (p = 0.0017), lympho-vascular invasion ( P < 0.001 ), high-grade ( p < 0.001 ), resistance to chemotherapy (p = 0.011),
lymph nodes metastasis and relapse (p = 0.005*) and DFS (p = 0.005)
Conclusion: CD133 expression in colorectal carcinoma is related to tumour progression and is considered a marker of poor
prognosis and a strong indicator of relapse and poor survival. Moreover, CD133 stem cell marker may act as a targeted therapy
in chemotherapeutic resistance patients with colorectal carcinoma.
Keywords: Cancer stem cell marker, CD133, Stage III, Colorectal carcinoma.
INTRODUCTION
Colorectal cancer (CRC) is the 3rd most commonly
CRC patients are frequently treated with neo-adjuvant
diagnosed cancer and the 4th major cause of cancer-related
radiation-based therapy. The first appearance of LN
deaths worldwide. Its deadly consequences are anticipated
metastasis in CRC is stage IIIa, which has spread to 1 to 3
to rise by 60% to more than 2.2 million new cases and 1.1
nearby lymph nodes (N1) (5, 6).
million cancer deaths by 2030 (1).
This study aimed to assess CD133 expression in stage
Cancer stem-like cells (CSC) were discovered first by
III colorectal carcinoma using immunohistochemistry as
John Dick in acute myeloid leukemia (AML) in the late
well as its relationship to clinicopathological characteristics
1990s. They are a group of highly tumorigenic cells that can
and patient outcomes.
repopulate tumours following apparent curative treatment.
They have characteristics similar to normal intestinal stem
PATIENTS AND METHODS:
cells, such as the ability to self-renew and long-term
The study includes 60 cases with stage III
repopulation, which leads to tumour heterogeneity. They
CRC(50colon ,and 10 rectal cancer) five years after surgical
can also give rise to all types of cells found in a cancer
removal of the tumor at the Department of General Surgery,
sample (2).
Faculty of Medicine, Zagazig University, and after
prominin-1, also known as CD133 is a transmembrane
receiving planned treatment according guidelines for stage
glycoprotein found in various tissues, including
III colorectal cancer they were on regular follow-up with the
hematopoietic cells, neuroepithelial cells, and endothelial
Departments of Medical and Clinical Oncology, Faculty of
cells. CD133 is a clear marker of primary colorectal cancer
Medicine, Zagazig University, where clinicopathological
stem cells (CSC), and its expression has been associated
and prognostic parameters were collected from their
with differentiation and tumour growth in colorectal cancer
archives, including ( age, sex, tumor type, tumor size, tumor
(3). CD133 could identify a group of tumor cells with
grade, drug resistance, and relapse after therapy).
characters of stem cells. Those CD133-positive tumor-
The patients were classified into 2 groups, the 1st
initiating cells can self-renewal, differentiate, regenerate,
group (GI) includes 22 patients with relapse, and the 2nd
and form tumors when injecting them into immunodeficient
group (GII) includes 38 patients without relapse. Sixty
mice. CD133 expression has a crucial influence in CRC
archive paraffin blocks of metastatic lymph nodes of
development (4).
primary resection were extracted from the Pathology
The proper preoperative staging of lymph nodes
Department's archives and processed for CD133
underpins several CRC therapeutic approaches. Nodal
immunohistochemistry. CD133 expression levels were
staging is vital in rectal cancer since clinically node-positive
assessed, analyzed, and correlated with clinicopathological
121
Received: 20/10/2022
Accepted: 22/12/2022
ABSTRACT
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 132-138
Prognostic Value of Pentraxin 3 and Procalcitonin in Late Onset Neonatal Sepsis
Mohamed Omar Abd El Aal1, Ibrahim Saad Abo Seif1,
Shimaa Ahmed Abd El Kareem1, Marwa Ali Abdel-Wahed*2
Departments of 1Pediatrics and 2Clinical Pathology, Faculty of Medicine, Ain Shams University, Cairo, Egypt
*Corresponding author: Marwa Ali Abdel-Wahed, Mobile: +201065644724, Email: marrwa_ali3110@yahoo.com
ABSTRACT
Background: High percentage of intensive care unit (ICU) admissions are due to sepsis. Some evidence suggests
procalcitonin (PCT) is a useful sepsis prognostic marker. Acute phase protein, which is called pentraxin3 (PTX3) may help
in sepsis screening.
Objective: To assess the prognostic value of the PTX3 and PCT in neonatal sepsis in comparison with other screening
markers.
Patients and Methods: A prospective study included 40 neonates with sepsis. The study had been conducted in the neonatal
ICUs of Ain Shams University, Children's Hospital during the period from January 2020 to May 2022. All neonates had been
subjected to clinical examination, anthropometric measurements and sepsis scoring by neonatal sequential organ failure
assessment (nSOFA). Laboratory investigations were performed including complete blood count, blood culture, assay of
serum levels of C-reactive protein (CRP), PCT and PTX3.
Results: The CRP levels were significantly lower in the deteriorated group compared to the better group, whereas PCT and
PTX3 levels were significantly higher with p-value=0.004, 0.016 and 0.019, respectively. After 3 days, CRP, PCT and PTX3
levels increased significantly in deteriorated group than improved group with p-value=0.002, <0.001 and <0.001, respectively.
The combination between baseline nSOFA score, CRP and PCT levels had a sensitivity of 84.62%, specificity of 92.59% and
AUC 0.906. While combination between baseline nSOFA CRP and PTX3 levels had the highest sensitivity of 100% and
AUC of 0.909 in prediction the poor outcome of the studied patients.
Conclusion: Serum levels PCT and PTX3 seem to be promising prognostic markers in neonatal sepsis.
Keywords: C-reactive protein, nSOFA, procalcitonin, pentraxin 3, Late onset neonatal sepsis.
INTRODUCTION
as much as 100-fold in 6-8 hours. For PTX3, IL-6 is
In low and middle-income nations, sepsis
only a marginal inducer (7).
continues to be a major contributor to newborn
Patients with sepsis can have detectable levels
mortality and morbidity. Due to the lack of specificity
of PTX3, PCT in their serum for a long time after the
in the symptoms of neonatal sepsis, testing is required
onset of sepsis, whereas other novel proinflammatory
to make a diagnosis. Better clinical outcomes and less
cytokines (like and tumour necrosis factor-a as well as
unnecessary antibiotic use can be achieved through
interleukin) have a short window of expression, despite
rapid and precise detection of infection(1).
showing good prognostic values for mortality. Because
Mild symptoms of neonatal sepsis can quickly
of this, multifactor assays are superior to those based on
deteriorate into life-threatening complications like
a single factor in identifying sepsis and measuring
organ failure and meningitis(2). Subclinical infection can
infection severity(8).
progress to severe local or systemic infection in the
There is a lack of neonatal-specific data, but
clinical setting(3). Therefore, it is crucial to identify
there is an established scoring system similar to the one
reliable early indicators of sepsis to improve diagnosis
used to determine sepsis in adults and it can be used in
and prognosis. Several potential biomarkers have been
neonates, called the neonatal sequential organ failure
presented recently(2).
assessment (nSOFA) (9).
Procalcitonin (PCT) could be an important
Our study's objective is to evaluate the PTX3,
prognostic marker for sepsis(4). Following bacterial
PCT for its predictive significance in newborn sepsis in
infection, the PCT level rises in 6 to 12 hours and drops
relation to other sepsis screens. Using a model that
by 50% after 24 hours with the help of appropriate
incorporates PTX3 and PCT, we can better predict
antibiotherapy and the work of the immune system. The
progression in these neonates.
level is not affected (does not decrease) by anti-
inflammatory drugs(5). PCT appears to be a useful
PATIENTS AND METHODS
biomarker to differentiate bacterial infections from viral
During the months of January 2020 through
infections with high sensitivity and specificity rates.
May 2022, at Ain Shams University's Children's
One of these studies evaluating the rapid diagnosis of
Hospital, we analyzed data from a prospective study of
sepsis suggested that PCT could be used to differentiate
the NICU there.
severe clinical situations like sepsis and septic shock, as
Forty clinically suspected neonates with sepsis,
well as to help determine the type of microbe(6).
who were clinically free before this age were included
In response to activation by primary
in this study. The International Sepsis Definitions from
inflammatory signal proteins, the serum concentration
2001 were used to diagnose sepsis. In neonates, the
of pentraxin 3 (PTX3), an acute phase protein that
presence of sepsis can be suspected from the presence
represents the long pentraxin subfamily, can increase by
of inflammatory symptoms such as hyper or
132
Received: 26/08/2022
Accepted: 27/10/2022
RELATIONSHIP BETWEEN SLEEP DISORDERED BREATHING AND PRO-INFLAMMATORY MARKERS IN ACUTE ISCHEMIC STROKE
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 139-142
Evaluation of Neutrophil to Lymphocyte Ratio in Patients with
Chronic Spontaneous Urticaria
Hossam Moustafa Elkady
Department of Internal Medicine, Allergy and Clinical immunology,
Faculty of Medicine, Ain Shams University, Cairo, Egypt.
Corresponding Author: Hossam Moustafa Elkady, Mobile: (+2) 01090751701, E-mail: hossamelkady86@ymail.com
ABSTRACT
Background: Chronic spontaneous urticaria (CSU) is an immune-inflammatory disorder. The urticaria activity score
(UAS 7) is used to assess urticaria activity. The neutrophil to lymphocyte ratio (NLR) is a reliable indicator for
inflammatory conditions. Parameters useful for the evaluation of patients with CSU are not currently available.
Objectives: To assess NLR in CSU patients and its correlation with urticaria activity score.
Patients and methods: Of the patients attending the allergy clinic of Ain Shams University Hospital, 200 patients
with CSU, including 62 patients with mild disease, 68 with moderate disease, and 70 with severe disease according to
urticaria activity score 7 (UAS7), and 200 controls, were included in this study. NLR values were compared among
various study groups.
Results: NLR values were significantly higher among CSU patients than controls (p<0.001), with no significant
correlation with urticaria activity score.
Conclusion: NLR is a rapid, simple, and low-cost blood marker that can be used to detect systemic inflammatory
processes in patients with CSU.
Keywords: Neutrophil to lymphocyte ratio, Chronic spontaneous urticaria, Urticaria activity score.
INTRODUCTION
triggers or causes of chronic spontaneous urticaria were
Chronic urticaria (CU) is a mast cell-driven dermal
ruled out by history and proper investigations for all
disease, presented by at least 6 weeks of daily or
patients.
Patients
were
diagnosed
according
intermittent itchy wheals with or without angioedema
to EAACI/GA2LEN/EDF/WAO guideline (1).
(1). Chronic spontaneous urticaria (CSU) is the most
Each patient underwent the following investigations to
prevalent type of chronic urticaria. CSU occurs
exclude other causes of chronic urticaria: differential blood
spontaneously in the absence of any definite stimulus (1).
count, C-reactive protein (CRP), antithyroid antibodies,
The urticaria activity score (UAS 7) is a frequently used
thyroid function tests, and erythrocyte sedimentation rate
patient-reported CSU score based on symptoms, such as
(ESR). Patients with acute or chronic infection,
the number of hives and severity of pruritis, to assess
autoimmune disease, acute or chronic inflammation,
disease activity and therapy response (1).
tumors, any other dermatological or systemic disorder, or
Therefore, the UAS7 lacks objectivity, so different
pregnant women were excluded from this study.
markers have been studied to evaluate the activity of the
Also, patients on immunosuppressive drugs,
disease.
omalizumab, or corticosteroid treatment for CSU, as well as
Mast cells are the key cells in CSU pathogenesis.
smokers or alcoholic patients, were excluded. The body
However, various inflammatory cells, including
mass index (BMI) was within the normal range for all
basophils, eosinophils, T-lymphocytes, and neutrophils,
subjects.
are essential in the pathogenesis of CSU (2)
The neutrophil-lymphocyte ratio (NLR) is the
Assessment of urticaria activity score (UAS7):
division of absolute neutrophil count by absolute
According to the EAACI/GA2LEN/ EDF/WAO
lymphocyte count. It is a simple, cheap, and easily
guideline (1), urticaria activity is determined by urticaria
accessible hemogram, which increases in a lot of
activity score 7. Itching and hives (wheals), the two
inflammatory disorders, such as diabetes mellitus,
main urticaria symptoms, are evaluated by the UAS7.
ulcerative colitis, and psoriasis (3-5). Correlations
Depending on the number of wheals and the level
between parameters of inflammation such as NLR and
of pruritis, the UAS7 values were assessed during the
disease severity or activity have been defined in other
previous 7 days. Then the scores of wheals and pruritis
skin disorders (6-7).
were summed up over seven days (minimum score 0-
The aim of the current study is to evaluate NLR in
maximum score 42). UAS7 6 is considered a
CSU patients and its correlation with UAS7.
controlled urticaria, UAS7 (715) is a mild urticaria,
UAS7 (1627) is a moderate urticaria, and UAS7 (28
PATIENTS AND METHODS
42) is a severe urticaria (8).
A case-control study was conducted on 200 CSU
Assay of NLR:
patients presenting to the allergy clinic of Ain Shams
For all participants, blood samples were drawn and
University Hospital, and 200 healthy control volunteers
analyzed using (Sysmex XN-1000, Sysmex corp.,
without any dermatological or systemic disease, matched
Japan) hematology analyzer. Total and differential
for gender and age, were included in this study. Any
white blood cell counts were assessed in terms of the
139
Received: 26/8/2022
Accepted: 26/10/2022
c:\work\Jor\vol901_22
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 143-147
Association of Subclinical Hypothyroidism with Metabolic
Syndrome in Young Adult Egyptians
Hassan Mahmoud Hassanin*1, Usama A. Khalil1, Abdalla M. Nawara1, Amany Moheldin Sediq2,
Mayada M. Mousa1
Departments of 1Internal Medicine and 2Clinical Pathology, Faculty of Medicine, Zagazig University, Zagazig, Egypt
*Corresponding author: Hassan M. Hassanin, Mobile: (+20)1113657464, Email: drhassan_h99@yahoo.com,
ORCID: 0000-0002-9548-652X.
ABSTRACT
Background: Subclinical hypothyroidism (SCH) and metabolic syndrome (MetS) are two common medical conditions.
Thyroid dysfunction, prominently SCH has been described more frequently in MetS patients than general population.
SCH affect MetS parameters including high-density lipoprotein cholesterol (HDL-C), triglycerides (TG), plasma
glucose and blood pressure. The relation between the two conditions looks like a bi-directional relationship.
Objectives: The aim of this study was to investigate the association between SCH and MetS in Egyptian young adults
and to study the prevalence of MetS and its components in SCH subjects.
Patients and methods: The study was conducted at Zagazig University Hospitals. 602 freshman-year students with no
history of medical disease were included in the study. General examination, anthropometric, and routine investigations
plus thyroid function tests were done for all.
Results: Diastolic hypertension (DBP) and impaired fasting glycaemia (IFG) showed significant differences between
SCH and EUT. Among the 602 participants, 23.9 % were diagnosed with MetS and 8.9 % with SCH. MetS was found
in 22.4 % in the euthyroidism (EUT) group and in 39 % in the SCH group. SCH was found in 14.6 % in subjects with
MetS and in 7.2% in non- MetS subjects. There was a significant association between MetS and SCH (2=7.3, p0.05).
Weight, BMI, and DBP were the significant predictors for SCH in patients with MetS.
Conclusions: It could be concluded that there is a significant association between MetS and SCH. DBP and IFG show
significant difference between SCH and EUT.
Keywords: Subclinical hypothyroidism, Metabolic syndrome.
INTRODUCTION
MetS appears to be a risk factor for subclinical
One of the most common medical issues,
hypothyroidism (4).
particularly in women, is thyroid dysfunction.
The relation between the two conditions looks like
Subclinical hypothyroidism (SCH), which is the initial
a bi-directional relationship.
biochemical aberration in hypothyroidism, is
The aim of this study was to investigate the
characterized by a rise in blood thyroid stimulating
association between SCH and MetS in young adult
hormone (TSH) concentration in conjunction with
Egyptians and to study the prevalence of MetS and its
normal serum free thyroxine (FT4) concentration (1).
components in SCH subjects.
The prevalence of SCH varies by gender and age,
with women over 60 years of age experiencing rates as
PATIENTS AND METHODS
high as 20% in certain studies. Worldwide the
This cross-sectional study included a total of 602
prevalence ranges from 1 to 10% (2).
freshman-year students with no history of medical
The term "Metabolic Syndrome" (MetS) refers to a
disease, examined at Zagazig University Hospitals.
"constellation" of cardiometabolic risk factors that
All participants were new faculty students doing
together raise the risk of developing type 2 diabetes
medical examination as a part of undergraduate
mellitus (DM) and cardiovascular disease (3). Although
admission requirements. Data were collected from
it has been linked to coronary and carotid artery disease,
them, and they were subjected to history taking and
the link between SCH and MetS and each of its
physical examination.
components is still up for debate (4).
Physical
examination
included
waist
In relation to this topic, numerous researches have
circumference, WC (defined as the midpoint from the
shown a correlation between rising TSH levels and
lower costal margin to the iliac crest, standing and at the
increasing body mass index (BMI) and percentage of
end of normal expiration), and BMI (kg/m2) was done
body fat (5).
to all participants. Body weight was taken while
Although visceral obesity and insulin resistance are
wearing the less amount of clothes.
thought to be key factors in the etiology of MetS, an
Personal and family medical history was gathered,
imbalance of other hormones, such as thyroid and
with stress on endocrine, metabolic, and cardiovascular
glucocorticoids, may hasten metabolic problems and
diseases history. Blood samples were taken for routine
raise the risk of MetS (6).
checkup after 8 hours fasting plus TSH and FT4. The
On the other hand, thyroid dysfunction,
MetS was defined according to the International
prominently SCH is found more frequently in MetS
Diabetes Federation (IDF) by presence of WC > 94 cm
patients than general population (7).
(men) or > 80 cm (women) in addition to the presence
of two at least from the following: 1. Fasting blood
143
Received: 30/06/2022
Accepted: 06/09/2022
c:\work\Jor\vol901_23
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 148-153
Breastfeeding Effect on The Genetic Variations of Primary Teeth Emergence in
Relation to Salivary Transforming Growth Factor-B 1 Among Iraqi Infants
Shaimaa Thabit Salih1 *, Ban Sahib Diab
Pedodontic and Preventive dentistry department, Baghdad University, College of Dentistry, Iraq
*Corresponding author: Shaimaa Thabit Salih, Mobile: (+964)7702547120,
Email: shaima.hamoudi1901@codental.uobaghdad.edu.iq
ABSTRACT
Backgrounds: Mother`s milk has many necessary nutrients and cytokines, for instance transforming growth factor b1
(TGF-b1), which all are essential for teeth eruption and development. Additionally, human milk is considered as the best
source of nucleotides, hence it may have effect on genetic variations of infants.
Objectives: This study aimed to assess the effects of breastfeeding on timing of teething in relation to bone morphological
protein type 4 (BMP4) gene polymorphisms, and TGF-b1.
Patients and Methods: This study is cross sectional comparative study concerning salivary biochemical analysis with
prospective view concerning timing of eruption. Sample was composed of 100 breastfed infants compared to 100 infants
depending on formula milk. For the biochemical analysis including, saliva was collected only form subsample infants'
groups (40 from each group). While clinical examinations and follow up for teeth emergence was done for the whole sample.
Results: Findings showed that there were highly significant differences between breastfeeding and early eruption time.
While there were no significant differences between time of teething and both of salivary TGF-b1, and BMP4 gene by
feeding pattern. However, there was an antagonistic effect between BMP4 and TGF-b1, especially with AA genotype by
feeding pattern.
Conclusions: The current study confirmed the actual and pure effect of human milk on early primary teeth eruption in
comparison with formula-milk fed infants. However, there were no effects of other factors (salivary TGF-b1, and BMP4
gene) on the timing of teething. In addition, an antagonistic effect between BMP4 and TGF-b1 was confirmed in this study.
Keywords: Breastfeeding, BMP4 gene, Eruption time, Salivary TGF-b1.
INTRODUCTION
underlying mechanisms are still unknown. Numerous
Infant feeding habits include the sorts of food the
research shed light on the actual impact of human breast
child consumes beginning at birth. The milk is basic
milk on genetic expression, particularly when it comes to
material of an infant's diet, and it can be either breast or
the risk of non-communicable diseases, with the potential
bottle milk (1). The WHO recommends starting weaning
to improve the health and long-term development of the
not earlier than 4 months old and exclusively
infant (8-10). On another hand, several animals and humans
breastfeeding until age of 6 months (2).
studies support the idea that genetic factors may be linked
In addition to its nutritional benefits, breastfeeding has
with early or delay teeth eruptions (11-13).
many other documented positive effects on baby's health.
Bone morphological proteins (BMPs) belong to
Human breast milk components shield breastfed
the secreted protein family known as the TGF-b
newborns from infections and inflammation. Breast milk
superfamily (14). One of the important routes controlling
has distinct nutritional advantages over formula because
craniofacial development is BMP signaling. It controls
its nutrient profile is tailored specifically for infants and it
the growth of its mineralized structures, including the
adapts over time to a child's changing demands (3, 4).
cranium, mandible, maxilla, palate, and teeth (15, 16).
Human milk is the best source of nucleotides for
Genome-wide association studies disclosed a linkage of
infants. Nucleotides are essential for encoding genetic
BMP4 in the SNP rs17101923 is likely to contain novel
information, controlling energy metabolism, signal
height-associated variants with earlier primary tooth
transduction, and enabling fast growth in early infancy.
eruption and craniofacial growth (11).
They are the monomeric units of ribonucleic acid (RNA)
Numerous non-syndromic and syndromic human
and deoxyribonucleic acid (DNA). Whereas, infants'
craniofacial abnormalities have been linked to gene
ability to produce the endogenous nucleotides required to
polymorphisms and mutations in the BMP pathway, as in
satisfy their increased metabolic demands for growth and
cleft palate, tooth agenesis and hypodontia (17, 18).
development is limited (5, 6).
Breast milk contains necessary nutrients for
Numerous studies have demonstrated that early in
healthy teeth development such as phosphate, calcium, and
development or during key times, the environment and
vitamins A, C, and D. For hydroxyapatite crystals to form
diet may have an impact on the expression of genes that
properly, calcium and phosphorus are necessary. So,
have both short- and long-term consequences on the
deficiency in the previous nutrients can have an effect on
organism (6, 7). Some elements of human breast milk may
tooth development (4, 19).
directly influence epigenetic alterations, while the
148
Received: 30/06/2022
Accepted: 06/09/2022
c:\work\Jor\vol901_24
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 154-161
Drug Use Indicators in Urban and Rural Primary Health Care Facilities in
Mansoura District, Dakahlia Governorate, Egypt
Mohamed Wahdan Elbrashy1, Abdel Hamied Mohamed Abdel Hamied2*, Mohamed Azmy Khafagy1
Departments of 1Public Health and Community Medicine and
2Industrial Medicine and Occupational Health, Faculty of Medicine, Mansoura University, Egypt
*Corresponding author: Abdel Hamied Mohamed Abdel Hamied, Mobile: (+20) 01001257474,
E-Mail: abdelhamied_com @yahoo.com
ABSTRACT
Background: The WHO and International Network for Rational Use of Drugs (WHO/INRUD) developed a list of
indicators that are broadly used for evaluating irrational drug prescribing. The objective of the current study is to measure
drug use indicators in urban and rural primary health care facilitates in Mansoura district.
Patients and methods: A cross-sectional comparative study was carried out on 450 encounters attended urban and rural
primary health facilities in Mansoura district, Dakahlia Governorate during the period from October 1, 2016 to
September 30, 2017.
Results: Prescriptions of drugs with generic names and prescriptions with antibiotics were 51.9% and 40.9%
respectively. The average number of drugs prescribed per encounter was 1.9 (SD 0.41). The average consultation time
and the average dispensing time were 7.3 (SD 1.7) minutes and 32.2 (SD 6.9) seconds respectively. Drugs adequately
labeled were 57.6% and 52.4% of encounters knew the correct dosage. In addition, 14.7% of encounters were cured
without drugs. The average drug cost per encounter at the time of the study was 19.67 (SD 2.92) EGP. Regarding urban-
rural inequality concerning drug use indicators, the following were significantly higher in rural than in urban health care
facilities (prescriptions with antibiotics, average number of drugs prescribed per encounter, average consultation time,
average dispensing time, drugs adequately labeled, percentage of cure without drugs and the average drug cost per
encounter at the time of the study).
Conclusion: There is an irrational use of drugs in primary health care facilitates in Mansoura district when investigated
by the WHO/INRUD drug indicators.
Keywords: WHO, INRUD, Drug use, Indicators, Primary health care, Urban, Rural, Mansoura.
approaches for the quantification, understanding and
INTRODUCTION
assessment of the process of prescribing, dispensing and
The World Health Organization (WHO) describes
consumption of drugs and for testing of interventions to
the rational utilization of drugs as "patients receiving
improve the quality of such processes (9). Different
medications proper to their clinical requirements, in
researches were conducted in different nations to access
dosages that match their own needs, for a proper period
the rationality of drug prescribing. Such researches aim
of time, and at the lowest cost to them and their
to follow up and assess and after that suggest
community" (1). Unluckily, the irrational usage of drugs
modifications in prescribing pattern to make the drug
is endemic, particularly in middle- and low-income
use rational and of minimal charge (10).
countries (2). Irrational use of drugs is common in all
nations but comparatively greater in developing ones, in
The regular evaluation of drug use pattern in a
which traditional supervision of medicine use is weak
healthcare facility could help to recognize the drug use
(3).
problems and as a result to encourage rational drug use
and assist policy makers to apply policies on drug
Rational drug prescribing participates in global
prescribing practices in the healthcare facility (4).
drops in population morbimortality with substantial
Essentially, drug utilization researches might provide
medical, social and economic advantages (4). Rational
insights to the pattern of drug use could evaluate the
prescribing is favored by the WHO/INRUD to evade
quality of use and identify predictors for use (11).
unwarranted extensive use of drugs and potential
adverse events on the cases (5). On the other hand, as
The use of generic name participates in cost
researches indicate, the majority of developing nations
reduction and offers more substitutions for drug
have a major gap from the WHO/ INRUD
purchases. Confusion over drug terminology could be
recommendations (6).
associated with adverse events. The use of non-
proprietary terminology in medicine must be promoted
Quality of life (QoL) could be enhanced by
to save charges, restrict commercial influences and
improving standards of medical management at all
decrease the likelihood for prescribing errors (12).
levels of the healthcare delivery system (7). Evaluation
of medicine use is of great importance for clinical,
The objective of the current study is to measure
educational and economic aims (8).
drug use indicators in urban and rural primary health
care facilitates in Mansoura district, Dakahlia
Drug utilization research could be described as an
Governorate, Egypt.
eclectic collection of descriptive and analytical
154
Received: 20/08/2022
Accepted: 20/10/2022
c:\work\Jor\vol901_25
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 162-165
COVID-19 Adult Patients Undergoing Cardiac Surgery: Early Outcomes
Mohamed Elkhouly*, Ahmed Fouad
Department of Cardiothoracic Surgery, Faculty of Medicine, Cairo University, Egypt
*Corresponding authors: Mohamed Elkhouly, Mobile: (+20) 01115551412, E-mail: elkhoulymohamed98@gmail.com
ABSTRACT
Background: COVID-19 illness is a major problem that has the possibility of resulting in morbidity and death. Research
on harmful outcomes of SARS-CoV-2 on the cardiovascular and circulatory systems have been documented,
complicating the therapy of these patients even more. Objective: The purpose of this research was to evaluate the safety
and consequences of heart surgery in COVID-19 previously infected patients. Patients and Methods: A retrospective
observational study on patients receiving open heart surgery was carried out at Elkasr Elaini Medical Center,
Cardiothoracic Surgery Department, Cairo University. Patients who tested positive for COVID-19 before surgery were
detected and included. Data from patient files were examined and evaluated in real time, complemented by telephone
following discharge. Results: Nineteen positive cases of COVID-19 underwent open heart surgery; June 2020-
September 2021in our center. Mean age of patients was 58±9 years old. Mean time from confirmed COVID-19 with
positive swab using PCR to surgery was 45±15 days. The vast majority of patients (94.7%) were extubated within 24
hours following operation. Acute renal failure developed in 10.5% of the patients, and one patient suffered severe heart
failure, seven patients (63.8%) required less than or equal to seven days in the hospital, whereas 11 patients (57.9%)
required between eight and fourteen days, one patient required more than 14 days. There were 2 mortalities one was
covid related while the other died from severe heart failure refractory to treatment. Conclusion: After a period of
convalescence, cardiac operation might be conducted successfully in individuals who suffered from COVID-19 illness
before undergoing surgery.
Keywords: Cardiopulmonary bypass, Heart surgery, CABG, COVID 19 mortality.
INTRODUCTION
damage, coronary thrombosis, significant systemic
The extraordinary coronavirus (COVID-19)
inflammatory response, coronary plaque damage and
pandemic, driven by SARS-CoV-2, has had a
hypoxia. In a patient who has previously been infected
significant impact on the global population (1). With the
with COVID-19, there is an increased risk of surgical
introduction of vaccines in late 2020, numerous
complications such as pulmonary dysfunction, arterial
government initiatives encouraged, and in some cases
and venous embolism, difficulties weaning from
mandated, immunizations for certain segments of the
ventilators and residual neuromuscular weakness (9).
population. Increased immunization among the aged,
immunocompromised, and fragile patients resulted in
AIM OF THE STUDY
fewer viral infections, hospitalizations, and deaths.
The aim of our research is to assess the safety and
Governments that had adopted physical separation laws
consequences of heart surgery after a recovery period
to minimize transmission lifted these limits in part or
following COVID-19 infection.
whole (2). Due to their increased transmissibility and
capacity to elude vaccination protection, new
PATIENTS AND METHODS
strains of concern have recently posed a fresh danger (3
A retrospective observational study was conducted
5).
on nineteen patients --- undergoing open heart surgery
Cardiac surgery is not without danger. The
in Elkasr Elaini Medical Center, Cardiothoracic Surgery
determination to undergo the surgery is dependent on
Department in Cairo University, Egypt, from June 2020
the patient and surgeon's risk assessment. Patient
to September 2021.
demographic data, as well as clinical urgency, surgical
Inclusion and exclusion criteria:
distresses and expected post-surgical recovery, are
Adult patients undergoing elective, emergency and
considered (6).
urgent open heart surgery, who were screened and
Ongoing COVID-19 illness is a major problem that
confirmedly diagnosed pre-operatively with COVID-19
has the possibility of causing morbidity and death.
infection via Polymerase Chain Reaction (PCR) as
Several studies have been published showing that
positive swab test, were included in our study.
SARS-CoV-2 has negative effects on the heart and
Vaccinated patients against COVID-19 were excluded.
circulatory system (7). Open heart surgery in COVID-19
patients causes coagulopathy, difficulties, weaning,
Data collection: Patients were determined using the
hypoxia, and vulnerability to subsequent bacterial
hospital's heart surgery database. Data from medical
infections. Beside operational damage, reduced
computerized patient records and records from patients
extracorporeal circulation (ECC) and poor cardiac and
were evaluated retrospectively. To augment the data,
chest reserve might result in weakened immune system
phone calls and interviews were conducted.
and coagulopathy, complicating these patients' care (8).
COVID-19
infection
can
cause
severe
cardiovascular outcomes such as direct myocardial
162
Received: 02/07/2022
Accepted: 08/09/2022
c:\work\Jor\vol901_26
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 166-171
Distribution of Some Virulence Genes among Enterococcus Faecalis
Isolates from Urine Samples
Diyar A. Najm Al-shawi*, Ghadah M. S. Al-Quraishi
Department of Biology, Collage of Science, University of Baghdad, Baghdad, Iraq
*Corresponding author: Diyar A. Najm Al-shawi, E-mail: Diyarabd96@gmail.com, Mobile: +9647733518724
ABSTRACT
Background: Enterococcus faecalis is one of the human and animal gastrointestinal flora. They are very robust so that
they can live in humid, salty, or acidic environments. Understanding the link between enteric and extra-enteric E. faecalis
strains is interesting as it is widely distributed throughout a variety of different habitats.
Objective: This research was carried out to investigate the percentage presence aggregation substance, cytolysin and
hyaluronidase genes (asa-1, cyl A, hyl) in the E. faecalis isolates from UTI samples via the method of Polymerase Chain
Reaction (PCR).
Materials and Methods: In the current study, collected 64 Samples during the period from November 2021 to January
2022 at Medical City Hospital in Baghdad city, included 18 men and 46 women. The patients ages were ranged from (17-
54) years. Urine samples cultured on Pfizer specific Enterococcus media, a selective medium for the isolation and growth
of Enterococcus spp, and then molecular detection was done to detect the E. faecalis gene and all three-virulence gene.
Results: Results demonstrated that the proportion of isolation for E. faecalis was 48%, while the percentage of cyl and
asa-1 genes was 100% and 97% respectively, although hyl gene was not detected in any isolates of E. faecalis isolated
from urine samples.
Conclusion: Virulence genes may be prevalent is some isolates and absent from other depending on many factors such as
the source of isolation.
Keywords: Virulence gene, PCR, Urinary tract infections.
INTRODUCTION
hemolytic, with colonies on blood agar measuring around
Bacterial infections continue to be a serious issue
1-2 mm in diameter. Lactic acid is produced by
because of the considerable effects they have in public
Enterococci as a result of fermentation with no gas
and medical settings. Enterococci are one category of
production. Catalase and oxidase reactions in
microorganisms linked to opportunistic infections,
Enterococcus are negative. So capable of growing in
notably in medical settings. Urinary tract infections,
6.5% salt medium with a pH range of 4.8 to 9.6 and an
bacteremia, endocarditis, wound infections, and intra-
ideal temperature range of 35 to 37°C (3).
abdominal infections are only a few examples of
Infections of the urinary tract are among the most
enterococci-associated illnesses. Since enterococci
common diseases; 150 million people worldwide are
infections have significant negative effects on mortality,
affected by it each year. The most frequent cause of these
morbidity, and economic costs, they have been a growing
diseases is bacteria, the majority of cases (7080%)
source of worry. According to estimates, enterococci
Uropathogenic Escherichia coli (UPEC) is the primary
infections, particularly those caused by vancomycin-
causative agent, followed by Staphylococcus, Klebsiella
resistant bacteria, increased by 1.4 to 3.5 times the
spp., Enterococcus spp., and numerous other pathogens
likelihood of death, major surgery, admission to the
(4).
critical care unit, length of hospital stays, and release to a
A UTI can occur anywhere in the Urinary tract. It
long-term care facility (1).
includes
(urethritis,
cystitis,
pyelonephritis,
Enterococcus faecalis is one of the human and
epididymitis', prostatitis, per nephritis), and it is
animal gastrointestinal flora. They even reside in the
considered as one among the most common infectious
mouth and the vagina. They are very robust so that they
diseases that are widely seen among all age groups of
can live in humid, salty, or acidic environments.
individuals (5).
Additionally, E. faecalis frequently inhabits soil and
Virulence factors play a role in pathogenesis by
water. Understanding the link between enteric and extra-
mediating adherence colonization and invasion into host
enteric E. faecalis strains is interesting as it is widely
tissues, and the production of toxin and enzymes, all of
distributed throughout a variety of different habitats(2).
which can increase the severity of infection. There are
Enterococcus faecalis bacteria are often described
several
virulence
factors,
includes
cytolysin,
as Gram-positive bacteria that are seen individually, in
hyaluronidase, gelatinase, aggregation substance,
pairs, or in short chains under the microscope. That are
enterococcal surface protein, and others (6).
facultative anaerobes and non-motile and typically non-
Objective:
166
Received: 15/10/2022
Accepted: 15/12/2022
c:\work\Jor\vol901_27
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 172-178
Multidrug Resistant Enterococcus Faecalis isolated from Root Canals and
Its Relationship with The Presence of Some Virulence Genes
Diyar A. Najm Al-shawi*, Ghadah M. S. Al-Quraishi
Department of Biology, Collage of Science, University of Baghdad, Baghdad, Iraq
*Corresponding author: Diyar A. Najm Al-shawi, Mobile: +9647733518724, E-mail: Diyarabd96@gmail.com
ABSTRACT
Background: Enterococcus bacteria are normal flora found in the gut of different organisms, this bacterium has the potential
to become an opportunistic pathogen and harm the host's extra intestinal sites. Dental infections also associated with
Enterococci.
Objective: In order to shed light on multidrug resistance E. faecalis in root canals infections and also this research was
carried out to investigate the percentage of asa-1, cyl genes A in the E. faecalis isolates from root canal samples by using
polymerase chain reaction technique (PCR).
Materials and Methods: During the period of November 2021 to January 2022, root canal samples were collected from
(40) patients, (9) men and (31) women, and then were cultured on Pfizer specific Enterococcus media, a selective medium
for the isolation and growth of Enterococcus spp, after that antibiotic sensitivity test was done on all E. faecalis isolated.
And then molecular detection was done to detect the E. faecalis, asa-1 and Cyl A genes.
Results: The results showed percentage of E. faecalis isolates from root canal was 55% (22 isolates) and all isolates were
positive for E. faecalis gene, also 100% of isolates were positive for Cyl-A gene and 86.36% of isolates were positive asa-
1 gene. The antibiotics sensitivity result showed that 100% of E. faecalis isolates were sensitive to Imipenem and Linezolid,
whereas 100% of E. faecalis isolates were resistant to Tetracycline and Trimethoprim.
Conclusion: Most of isolates were multidrug resistant and also almost all the isolates had asa-1 and Cyl-A genes together.
Keywords: Virulence gene, PCR, Root canal, Antibiotic.
INTRODUCTION
Antibiotic resistance affects pathogenicity, which
Enterococcus faecalis as Gram-positive bacteria
makes it more challenging to treat enterococcal
are often seen individually, in pairs, or in short chains
infections medically since there are fewer treatment
under the microscope. That have colonies on blood agar
options available (6).Virulence factors play a role in
that are about 1-2 mm in diameter and are facultative
pathogenesis by controlling adhesion and colonization,
anaerobes, non-motile, and often non-hemolytic. As a
invasion into host tissues, and the production of toxin
result of fermentation without gas generation,
and enzymes, all of which facilitate microorganism
Enterococci create lactic acid. The responses of catalase
adherence to root canal walls and surfaces, making it
and oxidase in Enterococcus are negative. So capable of
difficult to remove them even after instrumentation.
growing at an ideal temperature range of 3537°C, pH
They can also harm the host in a number of different
4.89.6, and medium containing 6.5% salt(1).
ways by triggering the periapical tissue reaction to
Enterococcus bacteria has the capacity to develop
become more pronounced (7).
into an opportunistic pathogen and affect the host's extra
A pheromone-induced E. faecalis surface protein
intestinal locations despite being in the gut of many
called "aggregation substance" (AS) encourages the
organisms as normal flora(2).
formation of mating clumps during bacterial
Enterococci are linked to dental infections as well.
conjugation. As a component of the bacterial
Endocarditis, one of the most medically challenging
pheromone-responsive genetic exchange system,
diseases, might result from the oral infection if it
aggregate material aids plasmid transfers by promoting
develops into a bacteremia (3). The oral cavity may act
effective donor-recipient contact between Enterococcal
as a reservoir for superinfection microorganisms,
bacteria. Aggregation components facilitate adhesion to
including E. faecalis, E. faecium and E. coli, as assessed
a variety of eukaryotic cell surfaces in vitro and promote
by anti-biotyping studies (4).
uptake by human intestinal cells that have been cultured
E. faecalis has been associated to the occurrence
(8).
of several endodontic diseases, including primary and
Target cells such as erythrocytes, macrophages,
chronic endodontic infections. In original infections,
polymorphonuclear cells, and other eukaryotic cells can
asymptomatic chronic periradicular lesions are more
all be lysed by cytolysin. It has been demonstrated that
commonly seen than acute periradicular periodontitis or
cytolysin facilitates the invasion by harming the host
abscesses (5).
tissue (9). Together with Aggregation Substance (AS), it
will prevent the development of other bacteria (10).
172
Received: 15/10/2022
Accepted: 15/12/2022
c:\work\Jor\vol901_28
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 179-185
Mediastinal Goiter from the View of Thoracic Surgery
Tamer Eid Fouda*, Tarek Mohsen, Ahmed Sultan, Mahmoud Gamaleldin Ali, Ali Hetiba
Department of Cardiothoracic Surgery, Faculty of Medicine, Cairo University, Egypt
*Corresponding Author: Tamer Eid Fouda, Mobile: (+20)1113647910, Email: tamereidfouda@cu.edu.eg
ABSTRACT
Background: Several definitions were used to describe retrosternal goiter (RSG). The most accepted one describes
when 50% of the mass portion of the goiter is in the mediastinum. It is considered a surgical challenge because of the
difficulties faced during resection and the potential need for an extracervical approach.
Objective: It is to present some of the operated cases referred to our Thoracic Surgery Department after
multidisciplinary discussion and decision to operate such cases in combined team with ENT/General Surgery with
analysis of their data.
Materials and Methods: A retrospective analysis of 42 patients who underwent resections in a combined team for RSG
between 2018 and 2022 in the theater of Cardiothoracic Surgery, Cairo University Hospitals. The patients were
evaluated regarding their demographics, symptoms, level and side of extension in the mediastinum, approach,
pathology, and postoperative complications.
Results: The mean age was 57.1 years with male: female ratio 1:4.25. The most common symptom was dyspnea in 54%
of cases. History of previous thyroid surgery was found in 17(40%) patients. There were 15(36%) patients who had
extensions below the aortic arch. Sternal splitting was performed in 18 cases (43%) while thoracotomy was performed
in 3cases (7%). Morbidity occurred in 5cases (11.9%) in the form of RLN palsy, phrenic nerve palsy, need for
tracheostomy or Montgomery's tube with no postoperative mortality. The extension of RSG beyond the aortic arch and
history of previous thyroidectomy were significant calling for extracervical approach.
Conclusion: Retrosternal goiter is an indication for surgery to avoid airway compression, malignancy and difficult
excision if the operation is delayed.
Keywords: Retrosternal, mediastinal, goiter, sternotomy, thoracotomy.
INTRODUCTION
Several factors favor the downward extension
Substernal, retrosternal, intrathoracic, or
of the goiter into the mediastinum which are downward
mediastinal goiters are expressions used to describe a
traction caused by normal swallowing, negativity of
goiter extending below the inlet of the thoracic cavity.
intrathoracic pressure, and the force of gravity(2).
Albrecht von Haller in 1749 was the first one to describe
Others classified mediastinal goiters as follows;
retrosternal goiter (RSG) (1,2).
Type I (85%) into the anterior mediastinum, Type II
There have been many definitions of RSG since
(15%) into the posterior mediastinum and Type III (less
then till now. However, the most accepted definition of
than 1%) isolated mediastinal goiter(9).
RSG nowadays describes when 50% of the mass
Retrosternal goiters are closely related to
portion of the goiter is in the mediastinum(1,3,4). Other
thoracic surgery not only because of the potential need
different definitions have been also assumed for the
of endocrine surgeons during surgery for an additional
expression, e.g., goiter that extends beyond the thoracic
help by extending the operation into the thoracic cavity
inlet into the mediastinum for more than 2 cm is
but also due to the close relationship of the goiter to
considered retrosternal(1), or when the part of the goiter
nearby mediastinal structures and the potential,
in the mediastinum is larger than the cervical one and it
although rare, related complications in some cases, e.g.,
extends downwards beyond the thoracic inlet by two
chylothorax(10).
fingers, or by at least 4 cm(4-6).
Some studies stated that RSG usually descends
In endemic areas for goiter, it is found that 20%
downwards to the right, because it takes the path of the
of the population over 70 have substernal goiter.
least resistance pathway and grow away from the aortic
However, diagnosis of RSG is most frequently made in
arch and its branches(11). However, other studies
the fifth or sixth decade of life, with female/male ratio
mentioned that retrosternal extension is more common
of 4:1(1,2). Mediastinal goiters are classified as primary
on the left than the right side due to a more capacious
or secondary. Primary mediastinal goiters (represent
anterior mediastinum on the left side, anterosuperior to
less than 1% of intrathoracic goiters) are those without
the aortic arch(12).
any direct vascular connection to the cervical part of the
Retrosternal goiter has always been considered
gland, whereas the blood supply comes from a
a surgical challenge because of the difficulties that may
mediastinal source, with no history of prior thyroid
be faced during surgical excision(1).
surgery and a lack of similar pathology in the other
In most cases, retrosternal goiters can be safely
portions of the thyroid gland. Secondary goiters are far
delivered and resected through the standard collar
more common, with a blood supply derived from
incision, but sometimes the resection is problematic to
cervical branches of the thyroid arteries(7,8).
the surgeon and necessitates an extra cervical incision
with the assistance by a thoracic surgeon(3,13).
179
Received: 08/07/2022
Accepted: 13/09/2022
c:\work\Jor\vol901_29
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 186-193
Early Outcome of Minimally Invasive Versus Conventional
Mitral Valve Replacement Surgery
Amr M. Eltonsy, Wagih S. Elborae, Hesham M. Elkay, Hosam Fathy Ali*
Department of Cardio-Thoracic Surgery, Faculty of Medicine, Cairo University, Egypt
*Corresponding author: Hosam Fathy Ali, Mobile: (+20) 01114567170, Email: amy.rh.209@gmail.com
ABSTRACT
Background: Recent justifications for minimally invasive techniques include the desire to reduce surgical trauma,
enhance patient recovery, and lower costs without sacrificing the effectiveness of mitral valve repair or replacement.
The objective of the current study is to ascertain whether minimally invasive mitral valve surgery using lower mini-
sternotomies and mini-thoracotomies results in better postoperative outcomes than traditional surgery using a full
sternotomy. Patients and methods: A total of 60 patients were included in this study, of which 30 cases were operated
upon conventionally through full median sternotomy, 15 cases were operated upon through mini-sternotomy, and 15
cases were operated upon through right anterolateral mini-thoracotomy. Matched groups of patients were used.
Results: Statistical analysis of the basic data of patients before operations showed no statistical significance between
the groups. Minimally invasive mitral valve surgery was statistically associated with a significantly better outcome
regarding ventilation time, chest tube drainage, blood transfusion and postoperative pain in comparison to conventional
mitral valve surgery. These better results were not accompanied by significant increase in ICU stay, duration of inotropic
support, postoperative complications, hospital stay and in-hospital mortality. On the other hand, intra-operative time
parameters were shorter in conventional cases with statistical significance in total operative time when compared with
minimally invasive cases. Mini-thoracotomy as an approach showed superior results when compared with the mini-
sternotomy approach regarding chest tube drainage, and blood transfusion. However, mini-sternotomy cases showed
less intra-operative time parameters, ventilation time, duration of inotropic support and postoperative pain with
statistical significance in total operative time.
Conclusion: Minimally invasive mitral valve surgery improved significantly the early outcome regarding ventilation
time, chest tube drainage, blood transfusion and postoperative pain in comparison to conventional mitral valve surgery.
Keywords: Mitral valve replacement, Median sternotomy, minimally invasive mitral valve surgery, Mini-sternotomy,
Mini-thoracotomy, Comparative study, Clinical Trial, Cairo University.
INTRODUCTION
of recuperation. However, this method has drawbacks,
Since the development of cardiac surgery in the
such as a longer learning curve required by the use of
1950s, the full median sternotomy has been the accepted
specialized long-shafted equipment and the non-
method for the majority of cardiac surgeries because it
standard approach to the mitral valve, as well as
provides the best opportunity for exposing and treating
lengthier CBP, cross-clamp, and overall treatment
the heart and surrounding structures. However,
times. Additionally, problems from peripheral
"surgical aggression" in the form of postoperative
cannulation are more likely when groyne vessels are
bleeding, wound infection, discomfort, and lengthy
cannulated [4].
scars compromises this strategy [1,2].
The aim of the current study is to determine
The need for minimally invasive techniques stems
whether minimally invasive mitral valve surgery
in part from the need to reduce surgical trauma, enhance
through lower mini-sternotomy and mini-thoracotomy
patient recovery, and lower costs without sacrificing the
improves postoperative outcome when compared to the
effectiveness of mitral valve repair or replacement.
conventional surgery through total sternotomy,
Access to all heart regions must be possible using a
including
intra-operative
time
parameters,
minimally invasive technique with little to no need for
postoperative complications, intensive care unit and
highly specialized equipment. Additionally, better
hospital stays, in-hospital mortality and postoperative
cosmetic outcomes and reduced surgical discomfort
pain.
should be offered. Additionally, it must offer the benefit
PATIENTS AND METHODS
of a patient's early recovery and quick return to work [2].
This is a comparative study, which included
A lower mini-sternotomy uses a smaller incision
retrospective data. It included 60 patients underwent
and well-known tools to expose the heart as is
Mitral valve replacement (MVR) surgery, of which 30
customary. Additionally, it keeps the shoulder girdle
cases were operated upon conventionally through full
continuous, which enhances postoperative breathing
median sternotomy (Group A), 15 cases were operated
mechanics. In addition, if difficulties arise or the
upon through mini-sternotomy (Group B), and 15 cases
exposure is insufficient, it enables quick and simple
were operated upon through right anterolateral mini-
conversion to a full sternotomy. Also, it is more prone
thoracotomy (Group C). Patients were operated upon in
to keloid formation than a full sternotomy and does not
Kasr Al-Aini Hospitals in the period from June 2012 to
produce significantly superior cosmetic effects than a
June 2018.
mini-thoracotomy [3]. Due to the preservation of the
Surgical techniques
entire sternum in its entirety, mini-thoracotomies have
A. Conventional mitral valve surgery:
the finest cosmetic outcomes and need the least amount
186
Received: 25/08/2022
Accepted: 26/10/2022
c:\work\Jor\vol901_30
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 194-199
Study of the Relationship between Insulin-Like Growth Factor 1,
Myostatin and Muscle Status in a sample of Egyptian Patients on Hemodialysis
Dina Ahmed Marawan Marawan*, Khaled Mahmoud Makboul,
Hanan Mahmoud Ali Mahmoud, Sayed Abdou Sayed Younis, Hany Khairy Mansour
Internal Medicine and Endocrinology, Faculty of Medicine, Ain Shams University, Egypt
*Corresponding author: Dina Ahmed Marawan, Mobile: (+20) 01018086289, E-mail: dr_dina2010 @hotmail.com
ABSTRACT
Background: Sarcopenia is a common occurrence in people receiving hemodialysis. For hemodialysis patients, early
sarcopenia identification is essential since it can be treated with nutritional strategies and exercise. Measurement of
muscle mass and strength requires specialised equipment and takes time. Biomarkers are required to assist sarcopenia
screening and follow-up. Serum creatinine (SCr), which is impacted by residual renal function and the type of dialysis
being used, has been found to be the best biomarker too far for measuring muscle function in hemodialysis patients. In
the general population, new biomarkers relating to muscle function have appeared. The aim of the current study is to
evaluate the ability of insulin-like growth factor 1(IGF-1) and myostatin to assess muscle status in hemodialysis patients.
Patients and Methods: A case control study was conducted on 30 apparently healthy individuals as a control group
(Group A) and 30 Egyptian patients on hemodialysis (HD) with muscle wasting Group (B) recruited from Ain Shams
University Hospital.
Results: On comparing the studied groups, there were significant differences in the characteristics and parameters
between the HD patients and healthy control subjects reflect the sarcopenia and malnutrition status in our HD patients.
IGF-1 levels were found to be negatively correlated with sarcopenia status in HD patients according to correlation
analyses (p 0.05). On the other hand, in HD patients, myostatin levels were p/ositively correlated with the presence of
sarcopenia (all p 0.05). Conclusion: Our findings showed that in individuals undergoing HD, IGF-1 and myostatin
levels linked with the presence of sarcopenia. To verify these findings, however, additional research is required.
Keywords: Insulin-Like Growth Factor 1, Myostatin and muscle status, Hemodialysis.
INTRODUCTION
Sarcopenia is a common sign in patients with
Group B (Patients) that included 30 patients on
chronic kidney disease (CKD), particularly those
hemodialysis (3 sessions per week) having muscle
receiving hemodialysis (HD) for end-stage renal disease
wasting recruited from the Hemodialysis unit at Ain
(1). Muscle mass, strength, and function loss is a chronic
Shams university Hospitals throughout six months.
condition that raises the risk of cardiovascular disease,
morbidity, and mortality. It also encourages sedentary
Inclusion Criteria: Adult (>18years), both sex (male
behavior and a lower quality of life (2).
and female) and patients with maintained HD for at least
Sarcopenia may result from a number of
6months.
reasons, such as an anabolic/catabolic imbalance. IGF-
1 is a hormone that promotes growth, differentiation,
Exclusion Criteria: Patients with acute diseases, such
and maintenance of skeletal muscle (3).
as infections or immunological disorders, patients with
The transforming growth factor (TGF)
history of primary muscle diseases and patients with
superfamily member myostatin, which acts as a
history of cerebrovascular stroke.
catabolic factor and a negative regulator of muscle
growth, is the alternative (4). Myostatin levels were
Study Procedures:
shown to be elevated and inversely linked with muscle
All patients in this study were subjected to the
atrophy in chronic illnesses (5). IGF1 levels were
following:
discovered to be lower, which caused a decline in
1. Full medical history taking including (age,
muscle protein synthesis and concomitant muscle
dialysis vintage (the duration since the first day of
protein breakdown, aggravating catabolic disorders
dialysis), body mass index (weight and height).
such end-stage chronic renal disease (6).
2. Full clinical examination (pulse, blood pressure
The aim of the current study was to evaluate the
and muscle status tests as below).
relationship between Insulin-Like Growth Factor 1 and
3. Laboratory parameters including: (A) Complete
myostatin and Muscle status (strength and mass) in a
blood count, kidney function test (Urea and
sample of Egyptian patients on Hemodialysis.
Creatinine), serum sodium, potassium, phosphate,
Calcium and albumin were taken from the patients'
PATIENTS AND METHODS
medical records. (B) Myostatin levels and IGF-1
A case control study that was conducted on 60 subjects
levels were measured using the Rayto tool with
divided into 2 groups matched for age and sex:
Enzyme-linked Immunosorbent Assay (ELISA)
Group A (Control) that included 30 apparently healthy
method before HD (USA).
individuals.
194
Received: 12/07/2022
Accepted: 15/09/2022
c:\work\Jor\vol901_31
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 200-205
Safety and Tolerability of Sodium Glucose Co-Transporters-2
Inhibitors Among Elderly Patients with Type 2 Diabetes Fasting Ramadan
Hossam Arafa Ghazi
Department of Internal Medicine, Faculty of Medicine, Mansoura University, Egypt
*Corresponding Author: Hossam Arafa Ghazi, Mobile: (+20) 01006408074, Email: hossamghazi7@gmail.com
ABSTRACT
Background: One of the main five pillars of Islam is Ramadan fasting and it may carry some hazards on some patients
especially elderly patients. Sodium Glucose Co-Transporter-2 inhibitors (SGLT2i) is a new family which introduced in
the market few years ago and used to treat patients with Type 2 Diabetes (T2D).
Objective: The objective of this study is to investigate the safety and tolerability of SGLT2i among elderly patients
with T2D fasting Ramadan.
Patients and methods: The current study was conducted on 100 patients aged 60 years and more, both males and
females (Group 1: 50 patients on vildagliptin and metformin and Group 2: 50 patients on empagliflozin and metformin).
Glycated haemoglobin (HbA1c) and estimated glomerular filtration rate (eGFR) were measured before and 2 months
after Ramadan. Episodes suggesting hypoglycemia and/or volume depletion were estimated. Days to break fasting were
also compared.
Results: The mean age among group 1 was 65.34 + 2.9 years versus 66 + 3.4 years among group 2 [P value: 0.25].
Mean HbA1c before Ramadan was 7.26±0.46 among group 1 versus 7.28±0.53 among group 2 [P value: 0.84]. No
statistically significant difference was found regarding episodes suggesting hypoglycemia and/or volume depletion nor
days to break fasting.
Conclusion: The conducted study has addressed that SGLT2i may be used safely and well tolerated mong elderly
patients with T2D fasting Ramadan if patients were well prepared and educated before Ramadan.
Keywords: Elderly, Type 2 Diabetes, Ramadan Fasting, SGLT2 inhibitors.
INTRODUCTION
higher among elderly in comparison to those younger
Ramadan is a holy month for Muslims and its
patients [2].
fasting is considered as one of the main five pillars of
Sodium Glucose Co-Transporter-2 Inhibitors
Islam. Often, Muslims fast 29 to 30 days from the sohor
(SGLT2i) are new family of oral antidiabetic drugs
(dawn) to iftar (sunset). Last few years; Muslims in
approved to treat T2D, they are recently introduced in
Egypt fasted for a duration ranging from 12 to 16 hours.
the Egyptian market few years ago. They act by
Although many elderly patients with diabetes have the
inhibition of Sodium Glucose Co-Transporter -2
permission not to fast, but most of them reject this and
(SGLT2) receptors in the proximal convoluted tubules,
insist on fasting [1]. On the other hand, Ramadan fasting
leading to glucosuria and subsequently lowering of the
may carry some hazards on few patients with diabetes
renal threshold of glucose reabsorption by about 50-60
especially elderly patients. First of these hazards is
% [5]. Furthermore, this family passed a long journey
fluctuation of blood glucose level that may occur during
from neutrality to benefits. Adding to its control of
fasting (hypoglycaemia and/or hyperglycaemia),
blood glucose, a lot of -well conducted- mega trials have
increased risk of thromboembolic manifestation and
shown that they have more advantages beyond the
increase the risk of ketosis [2].
glycaemic control like decreasing Major Adverse
In addition, Egypt is listed as one of the top ten
Cardiovascular Events (MACE) and progression of
countries having large number of people living with
Diabetic Kidney Diseases (DKD) [6].
diabetes. According to the International Diabetes
At the beginning of launching these drugs, there
Federation (IDF), 10.9 million people living in Egypt
was some worry from diabetologists regarding this
have diabetes (in the age range from 20-79 years) in
family to be prescribed among elderly population with
2021 and it is supposed to be doubled in 2045 by
T2D especially those aged above 70 years due to risk of
reaching about 20 million patients with diabetes [3].
hypovolemia especially during Ramadan fasting. Some
Also, in the last few years it was noticed that there is
trials were conducted to investigate the safety and
increase in the relative and absolute number of elderlies
tolerability of SGLT2i during Ramadan among general
in Egypt. Central Agency for Public Mobilization and
population with T2D like Canagliflozin in Ramadan
Statistics reported that elderlies represented about 7% of
Tolerance Observational Study (CRATOS) trial [7],
total Egyptian population in 2019 and expected to
which concluded that canagliflozin -which is one of
represent about 12% to the total population by the year
SGLT2i- could be used during Ramadan fasting.
2030 [4].
Nevertheless, some increased risk of hypovolemia
Prevalence of diabetes is increased with age,
during fasting was noticed. We previously studied the
subsequently total number of elderly patients having
use of SGLT2i among Egyptian patients with T2D and
type 2 diabetes (T2D) and willing to fast Ramadan will
we concluded that SGLT2i are effective, safe and well-
be increased. Complications of fasting are relatively
200
Received: 12/07/2022
Accepted: 15/09/2022
RELATIONSHIP BETWEEN SLEEP DISORDERED BREATHING AND PRO-INFLAMMATORY MARKERS IN ACUTE ISCHEMIC STROKE
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 206-212
The Association of Serum Ferritin with Disease Severity in
Non-Alcoholic Fatty Liver Disease
Shaimaa Hussein GadAllah*, Zainab Ahmed AliEldin, George Safwat Matta, Rafik Youssef Awad Youssef
Internal Medicine & Gastroenterology Department, Faculty of Medicine, Ain Shams University, Egypt
*Corresponding author: Shaimaa Hussein GadAllah, Mobile: (+20) 01020911390, E-mail: shaimaahussen2022@gmail.com
ABSTRACT
Background: It is widely acknowledged that non-alcoholic fatty liver disease (NAFLD) is the most common chronic
liver disease in the West. It is associated with insulin resistance and frequently coexists with metabolic syndrome
symptoms. Ferritin is an acute phase reactant, though, thus its increase in a patient with fatty liver disease's serum could
perhaps be a sign of inflammation in addition to disease activity.
Objective: The aim of our study was to evaluate the association of serum ferritin with non-alcoholic fatty liver disease
in patients with normal and elevated lipid profile.
Patients and Methods: The study was cross sectional study, which conducted at Ain Shams University Hospital. This
study was conducted on 80 patients. They were divided in to 2 groups as following: Group I included: 40 NAFLD
patients with normal lipid profile. Group II included: 40 NAFLD patients with elevated lipid profile. Lipid profile and
serum ferritin were done.
Results: Our research showed that patients with increased lipid profiles and non-alcoholic fatty liver disease had
considerably higher serum ferritin levels than those with normal lipid profiles. However, there was no connection
between serum ferritin and the fibrosis score for NAFLD, hepatic steatosis index, or fatty liver index.
Conclusion: Serum ferritin may be promising adjuvant inflammatory marker of predication and prognosis in NAFLD
patients especially in those with elevated lipid profile. Also, serum ferritin level cannot alone reflect severity of NAFLD.
Keywords: Serum Ferritin; lipid profile, Disease Severity; Non-alcoholic Fatty Liver Disease.
INTRODUCTION
research about the relationship between serum ferritin
The risk of diabetes mellitus, cardiovascular
and the severity of NAFLD.,
disease, and chronic renal disease is increased by non-
alcoholic fatty liver disease (NAFLD), which is
AIM OF THE STUDY
regarded as a multisystem disease (1). From basic
Our study objective is to determine the
steatosis through non-alcoholic steatohepatitis (NASH)
association of serum ferritin with non-alcoholic fatty
to cirrhosis and its associated complications such
liver disease in predication of severity and progression
hepatocellular cancer and mortality, there is a broad
in patients with normal and elevated lipid profile.
range of liver disease (2).
There is considerable evidence linking insulin
PATIENTS AND METHODS
resistance to the development of non-alcoholic fatty
The study was cross sectional study, which
liver disease, even though the aetiology of the condition
conducted at Ain Shams University Hospital. This study
(non-alcoholic steatohepatitis/non-alcoholic fatty liver
was conducted on 80 patients of both sexes, with age
disease) is not yet fully understood (3).
(18years old - 60 years), duration of study was 6
One non-invasive marker, serum ferritin, has
months. Patients were divided in to 2 groups as
recently emerged as a potential predictor of the presence
following: Group I included: 40 patients with normal
of non-alcoholic steatohepatitis as opposed to simple
lipid profile (Triglyceride < 150mg/dl, Cholesterol <
steatosios. Iron excess can be found in up to one-third
200mg/dl, HDL = 60mg/dl, LDL < 100mg/dl). Group
of patients with non-alcoholic fatty liver disease.
II included: 40 patients with elevated lipid profile
Steatosis, insulin resistance, and inflammation all
(Triglyceride >150mg/dl, Cholesterol > 200mg/dl, HDL
contribute to an altered control of iron transport.
= 60mg/dl, LDL >100mg/dl).
Although ferritin is an acute phase reactant, its rise in
the blood of a patient with fatty liver disease may not
Exclusion criteria: Alcohol abuser, chronic or acute
only indicate the presence of the disease but also the
viral hepatitis patient (hepatitis A, B, C), patients with
presence of other inflammatory conditions and some
other chronic metabolic liver disease as Wilson disease,
cancers (such as lymphoma) (5).
hereditary hemochromatosis, auto immune hepatitis,
Numerous research have been interested in
primary sclerosing cholangitis, pregnancy and lactation,
examining the role of altered iron metabolism in the
alpha-1
antitrypsin
deficiency,
patients
with
onset and progression of non-alcoholic fatty liver
malignancy, immunocomprimised patients, anemia and
disease. The generation of reactive oxygen species,
the patients who refuse to be entitled in the study.
impaired insulin signalling, changed lipid metabolism
in hepatic tissue, and the harm they cause are only a few
All cases had underwent:
of the pathogenic pathways for iron that have been
Medical history taking according to pre-
identified (6). Since there is no consensus among
designed questionnaire.
206
Received: 12/07/2022
Accepted: 15/09/2022
c:\work\Jor\vol901_33
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 213-225
Gastroprotective and Healing Effect of Naringin and Quercetin in
Experimentally Induced Gastric Ulcer by Diclofenac Sodium in Adult Male
Albino Rat: A Histological and Immunohistochemical Study
Hend Ragab Mousa*, Nehal Fahmy Shaheen
Anatomy and Embryology, Benha Faculty of Medicine, Benha University
*Corresponding author: Hend Ragab Mousa, Mobile: (+20) 1222898035, E-mail: drhendragab@yahoo.com
ABSTRACT
Introduction: Diclofenac (DFC) has been widely utilized as anti-inflammatory and analgesic medication. Naringin is
a natural flavanone glycoside that is found in citrus fruits. Quercetin is a natural flavonoid found in vegetables and fruits.
Aim: evaluation of the roles of naringin and quercetin in protection and recovery of rats' stomach ulcers caused by DFC.
Material and methods: Forty male albino adult rats were divided into 4 identical groups: Control group, (DFC) group:
rats were given 10 mg/kg b.w. /day DFC by oral gavage for 4 weeks, (DFC + Naringin) group: rats were given100
mg/kg/body weight naringin daily along with previous dose of DFC dose for 4 weeks and (DFC + Quercetin) group:
rats were given 50 mg/kg body weight quercetin daily along with previous dose of DFC. The stomach tissues were
examined grossly and processed for microscopic examination.
Results: DFC group revealed ulceration of mucosa resulting in detachment of fundic mucosa, inflammatory infiltration,
and wide lumen of fundic glands. There was a thin, sporadic PAS-AB mucous coating over the surface epithelium. It
showed extensive iNOS immunoreaction in the cytoplasm of gastric epithelial cell and strong PCNA immuno-
expression in the cells lining the fundic glands. Both naringin and quercetin exhibited a protective effect by prevention
of histopathological changes caused by DFC on gastric mucosa. There is a persistent, thick mucus coating covering the
surface epithelium, weak iNOS immunoreaction and moderate PCNA.
Conclusion: The intake of naringin during taking diclofenac protects the stomach mucosa but quercetin has more
protection than naringin.
Keywords: Diclofenac, naringin, Quercetin, ulcer.
INTRODUCTION
The purpose of this study is to assess the roles of
One of the most prevalent gastrointestinal
naringin and quercetin on protection and curing of
disorders is gastric ulcer (1). It results from an imbalance
gastric ulcers in rats caused by DFC.
between the digestive factors, including prostaglandins
and blood flow, and the aggressive factors, including
MATERIAL AND METHODS
gastric acid and pepsin (2). Due to their excellent
Animals:
effectiveness against pain and inflammation,
nonsteroidal anti-inflammatory drugs (NSAIDs) are
Forty adult albino male rats that were 2 months old and
among the world's most frequently prescribed
weighed between 180 and 200 grams were used in this
medicines (3). Despite their ability to reduce
study. The laboratory animals' department at the faculty
inflammation, they have a variety of negative side
of veterinary medicine at Benha University in Egypt is
effects (4). Diclofenac, a member of this class of
where we obtained the rats. To prevent any metallic
medications, it is a phenylacetic acid derivative that has
contact, the rats were housed in plastic cages. The lab
long been used to treat a variety of illnesses as an
conditions were ambient, at a temperature of 20 ± 2°C
analgesic and anti-inflammatory medication (5).
with exposure to a planned illumination cycle
Diclofenac's adverse effects are brought on by oxidative
(light/dark 14 hours/dark 10 hours). Water and regular
stress and the suppression of the antioxidant defense
food were permitted.
system (6). Natural therapies are a key component in the
treatment and prevention of stomach ulcers (2).
Ethical approval:
Numerous plant species, particularly citrus fruits,
All aspects of this research approved from the
contain the flavanone glycoside naringin (NA), which is
Ethics Committee of the of Faculty of medicine, Benha
generated from the flavanone naringenin (7). NA has
University, Benha, Egypt.
actions against allergies, ulcers, inflammation, cancer,
The study conformed to "Guide for the care and
osteoporosis, and free radicals (8).
use of Laboratory Animals" for the use and welfare of
A flavonoid called quercetin (QU) is present in a
experimental animals, published by the US National
variety of plants, vegetables, and seeds (9).
Institutes of Health (NIH publication No. 8523).
The antioxidant, anti-inflammatory and free
radical-scavenging capabilities of quercetin are partially
responsible for its anti-ulcer actions (10). The strong anti-
Reagents:
inflammatory actions of quercetin are primarily
-Diclofenac sodium was purchased from El Nasr
achieved via cytokine suppression (11).
Pharmaceutical Co. (ADWIC). It was obtained in the
213
Received: 25/10/2022
Accepted: 25/12/2022
c:\work\Jor\vol901_34
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 226-235
Factors Affecting the Outcome of Surgical Management of
Atypical Meningiomas
Shawky A. Elmeleigy*, Ahmed M. Deabes, Mohammed H. Eltantawy
Department of Neurosurgery, Faculty of Medicine, Benha University, Benha, Egypt
* Corresponding author: Shawky A. Elmeleigy, Mobile: (+20)1003495755, Email: elmelegyshawkey@gmail.com
ABSTRACT
Background: Atypical meningiomas differ from Grade I meningiomas in aspects of the higher rate of recurrence, more
postoperative complications, and shorter life expectancy postoperatively.
Objective: This study was aimed to evaluate the clinical course of atypical meningioma and prognostic factors affecting
its surgical outcomes.
Patients and Method: This retrospective study investigated the medical records of 45 patients who had surgical removal
of atypical meningiomas at Benha University Hospitals between January 2010 and December 2021. Patients average
age was (56.69± 11.11) ranged from 29 to 74 years. The follow-up period was 60 months. Analysis included multiple
factors such as patient age, gender, tumor size, location, and the extent of surgical resection based on (Simpson Grading
System).
Results: There was significant relationship between recurrence and Simpson grade, size, and side. There was a
significant relationship between rate of recurrence and type of radiation used. The mean survival time was significantly
longer in Gamma knife group compared to radiotherapy. Rate of mortality was significantly higher in group radiotherapy
compared to gamma knife with hazard ratio (95% CI) (5.33(0.79-36.75%). Rate of recurrence was significantly higher
in group radiotherapy compared to gamma knife with hazard ratio (95% CI) (3.03(0.89-10.31%).
Conclusion: It could be concluded that atypical meningiomas in elderly patients with a large size especially more than
60cc, incomplete surgical resection; frequently have poorer prognosis following surgical intervention. Postoperative
radiotherapy could provide accepted local tumor control in patients with incompletely resected atypical meningioma.
Keywords: Atypical meningioma, Prognostic factors, Simpson grade, Recurrence, Cranial base, Stereotactic gamma
knife.
INTRODUCTION
Meningioma is an intracranial tumor that arises
This study was aimed to evaluate the clinical course
from the meninges of the brain. It is the most common
of atypical meningioma and prognostic factors affecting
tumor of the central nervous system, accounting for
its surgical outcomes.
around thirty percent of CNS neoplasms. Meningioma
subtypes with aggressive and malignant features have
PATIENTS AND METHOD
been found. The term (atypical meningioma of grade II)
This retrospective study investigated the medical
was created in 1985 [1].
records of 45 patients who had surgical removal of
In its most recent classification methods, the WHO
atypical meningiomas at Benha University Hospitals
classified meningiomas based on histological criteria as
between January 2010 and December 2021. Patients
atypical (Grade II) and anaplastic (Grade III) [2].
average age was (56.69± 11.11) ranged from 29 to 74
Since the adoption of the 2000 and 2007 WHO
years. The follow-up period was 60 months.
classifications, the percentage of atypical meningiomas
has increased [3]. Recent figures indicate that 2030% of
We collected demographic information, including
meningioma patients are now diagnosed with atypical
the patient's age and gender. Patients had a pre-
meningioma [4, 5].
operative contrast-enhanced MRI; with a definitive
According to a recent study, atypical meningiomas
radiological description of extra-axial brain SOL as
are linked with a greater risk of recurrence and shorter
regard site, size, side, focal pathological edema and the
overall survival lengths than benign meningiomas
midline shift of the brain. The tumor size was
(Grade I). Atypical meningioma is linked with a 78-
determined in cubic centimeters based on the largest
fold higher risk of recurrence and a 2-fold greater risk
tumor length in all three dimensions.
of death 36 years after diagnosis [5, 6].
According to the tumor location, meningiomas
In addition, prior research identified the following
are classified anatomically into four categories.
potential prognostic markers for the recurrence of
Convexity meningioma including (frontal, parietal
atypical meningioma: cellular proliferating index, age,
temporal, occipital and that extending into more than
tumor site, preoperative tumor size, degree of surgical
one lobe of them), parasagittal meningioma including
resection, and early postoperative irradiation [7-9].
(falcine and parasagittal), sphenoid meningioma
However, these studies are debated, and the appropriate
(lateral sphenoidal, mid sphenoidal and medial or
treatment technique for atypical meningioma has not yet
clinoidal) and Tentorial and olfactory groove
been found.
meningioma.
226
Received: 06/09/2022
Accepted: 05/11/2022
c:\work\Jor\vol901_35
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 236-240
Telerehabilitation of Temporomandibular Dysfunction Syndrome during the
COVID-19 Pandemic: A Pilot Study
Mohammed Safwat Shahine1, Safaa Ali Mahran2, Marwa Ahmed Abdel-Aziz Galal2
1Maxillofacial Surgery, 2Rheumatology, Rehabilitation, and Physical Medicine Department, Faculty of Medicine,
Assiut University, Assiut, Egypt
Corresponding author: Mohammed Safwat Shahine,Email: msafwat67@aun.edu.eg,
ORCID: 0000-0001-6527-4617,Mobile no.: +201025555420
ABSTRACT
Purpose: To evaluate the efficacy of telerehabilitation presented in a well-designed home exercise program on the
manifestation of refractory TMD during the lockdown period of the current COVID-19.
Material and Method: Twenty Adult subjects with TMD were included in this pilot study. After a full medical history
taking and clinical examination of the TMJ, the pain level was assessed by a visual analog scale of 100. Assessment of
the severity of TMD was done using Fonseca's questionnaire.
Results: The age of our patients ranged between 15-58 years old, with female predominance (55%). On using paired t-
test and Wilcoxon Signed Ranks test, very high statistically significant differences (P=0.001) were found between the
results of pain at rest and with movement, the distance of mouth opening, and severity of TMD before and after the
rehabilitation program. Spearman's correlation test showed a weak inverse significant correlation (P= 0.032) between
TMD duration and pain at rest difference. Conclusion: This pilot study showed that, during the containment period of
the COVID-19 pandemic, telerehabilitation of chronic refractory TMD with no internal derangement, in the form of a
home-based well-chosen exercise program with the motivating follow-up of the patients through phone calls and other
smartphone applications, were effective in reducing the pain both at rest and with movement, improving the range of
motion and the severity of TMD manifestations.
Keywords: Telerehabilitation, Temporomandibular disorder, home exercise program, COVID-
INTRODUCTION
AIM OF THE STUDY
Temporomandibular joint dysfunction/Disorder
To investigate the effectiveness of a well-designed
(TMD) is characterized by pain in the joint itself that
home-based exercise program applied as a
radiates into the mandible, ear, neck, and tonsillar
telerehabilitation method for reducing pain and
pillars(1). The prevalence of TMD was stated to range
improving the function of temporomandibular
from 25% to 75% of the population and was reported to
dysfunction pain syndrome refractory to medical
be the second musculoskeletal condition causing pain
treatment during the containment period of the COVID-
after low back(2).
19 pandemic.
It is of multifactorial etiology including muscle
hyperactivity, malocclusion, and emotional stresses(3).
METHODS
Pain and disability are the main drive of the patient to
Study design: A pilot clinical prospective study.
seek medical advice(4). Temporomandibular joint (TMJ)
Inclusion criteria: Twenty adult subjects with painful
dysfunction can be treated conservatively using
TMJ were included in this pilot study in March 2020.
medications, and a rehabilitation program or surgically
All patients were referred by an expert maxillofacial
through arthrocentesis, injection, arthroscopy, partial
surgeon to the Rheumatology and Rehabilitation
condylotomy, or open joint surgery. The effectiveness
outpatient clinics after establishing the diagnosis and
of the multidisciplinary approach has been affirmed and
excluding any intra-articular derangement by
conservative treatment can relieve pain and improve
panoramic x-ray and MRI on the painful TMJ. None of
function in up to 90% of TMD patients(5).
our patients had any manifestation suggestive of
During the lockdown period of the COVID-19
COVID-19 infection.
pandemic, the term telerehabilitation has been widely
Inclusion criteria were adult patients who were
used as an advisable method to deliver rehabilitation
diagnosed to have chronic TMD refractory to
care for patients in case of their inability to reach the
pharmacological treatment including muscle relaxants
rehabilitation institute for any reason. The best situation
and nonsteroidal anti-inflammatory medications
when telerehabilitation can be applied is during
(NSAIDS). Patients with a history of facial trauma or
infectious pandemics like the one we are passing
surgery and patients with rheumatic diseases were
through these days.
excluded.
For the sake of our patient's safety, and following
the international recommendation of confining and
Ethical consideration:
social distancing, this pilot study aimed to investigate
The protocol was approved by the Ethics Review
the effectiveness of telerehabilitation in the form of a
Board of the Faculty of Medicine, Assiut University
home-based exercise program in improving the
(identification number 17300389), and according to
manifestations of chronic refractory TMD.
the Declaration of Helsinki. It was registered at
clinical
trials
with
identification
number
236
Received: 06/09/2022
Accepted: 05/11/2022
c:\work\Jor\vol901_36
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 241-247
Effectiveness of Aerobic Exercise with Laughter Therapy on Functional,
Cognitive, and Psychological Well-Being in The Elderly:
A Randomized Controlled Clinical Trial
Marwa M. Elsayed*, Ebtesam N. Nagy
Department of Physical Therapy for Cardiovascular / Respiratory Disorder and Geriatrics,
Faculty of Physical Therapy, Cairo University, Egypt
*Corresponding author: Marwa Mahmoud Elsayed, Mobile: (+20)01156033818, Email: marwa.elsaid@cu.edu.eg.
ABSTRACT
Background: Physical and mental abilities generally diminish with the natural process of aging. Exercise on a regular
basis is essential for everyone. Adequate physical exercise in older adults is associated with a better life.
Improvements in both physical and mental health are linked to laughter therapy. The aim of the current study was to
examine the unrecognized combined effects of aerobic exercise and laughter therapy on functional, cognitive, and
psychological well-being in the elderly.
Patients and methods: A total of 60 elderly individuals were divided into two groups; the experimental group (n=30),
which received aerobic exercise with laughter therapy, and the control group (n=30), which received the identical
experimental group's aerobic exercise program only, 3 times a week over 6 weeks. Body mass index, blood pressure,
functional capacity (assessed by the 6-minute walk test distance), functional activity level (evaluated by the Functional
Independence Measure), cognitive function (determined by the Mini-Mental State Examination), and psychological
status (estimated by the Geriatric Depression Scale) were all assessed at baseline and after 6 weeks. All participants
completed the study, and the outcome measure data were analyzed.
Results: By comparing the experimental group to the control group, all measured variables revealed a significant
change in both groups (p<0.001) but in favor of the experimental group rather than the control.
Conclusions: The elderly may benefit physiologically and mentally from laughter therapy combined with exercise.
Laughter therapy may be a powerful method for inspiring people to engage in physical activity and obtain greater
results.
Keywords: Aged, Depression, Exercise therapy, Humor, Mental health, Walk test.
INTRODUCTION
Aerobic exercise, which involves the use of
The global population is rapidly getting older,
oxygen and the action of large groups of skeletal
with an astounding 50% predicted increase in the
muscles over an extended period of time, may enhance
number of those 65 and older between 2015 and 2050,
executive function, speed of processing, cognition, and
reaching more than 1.4 billion (1).
memorization in healthy elderly persons (6).
Compared to other age groups, older
Also, the cardiovascular and neurological
individuals have the quickest rate of population
repairing processes, muscle endurance, improved
growth, the largest frequency of chronic diseases and
psychological
well-being,
self-image,
anti-
disorders, and the highest extensive care costs (2).
inflammatory, and antioxidant effects (4).
Certain factors, like physical disability, deficits in
Around the world, laughter therapy has been
seeing and hearing, cognition, and so forth, pose
employed in a variety of participant groups and
substantial barriers to the adoption of therapies that
programs as a non-pharmacological therapy, an easily
require deep intuition for issues of mental health
available, non-invasive, mental, and psychological
because of the various psychosomatic issues that older
rehabilitation (7).
individuals experience (3). Global lifestyle guidelines
It is a style of engagement that encourages
for older individuals are linked to a slower
smiles, radiant faces, and natural nonverbal
deterioration in mental, physical, intellectual, and
communication through an emotional pathway that
social attributes over time, ranging from 1.8% to
supports interpersonal communication. Unlike the
10.8% (1). The advantages of living a generally healthy
conventional forms of therapy, laughter therapy adopts
lifestyle were equally beneficial for men and women
a different strategy that has a favorable impact on body
of all ages, and occasionally they were even greatest, a
processes, the immune system, increases the activity of
healthy lifestyle is thought to be a key component of
natural killer cells, and lowers stress (8). The results
preventing chronic diseases (4).
from earlier studies indicated laughter therapy as a
Regular exercise is associated with improved
positive influence on both psychological and
sleep quality and mood. Aerobic exercise also benefits
physiological function, and it may be a useful
cardiovascular health by increasing cardiorespiratory
treatment to enhance the quality of life (QOL) of
fitness, which is associated with cognitive and mental
elderly adults whose daily living tasks and mental state
health (5).
have deteriorated due to depressive symptoms,
241
Received: 23/09/2022
Accepted: 21/11/2022
c:\work\Jor\vol901_37
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 248-254
Sexual Satisfaction; Prevalence, Cofactors and its Relation to
Mental Health of Egyptian Married Women
Reda Abdel Latif Ibrahem1, Shaimaa Sherif Soliman1, Wafaa Ahmed Shehata2, Ghadeer Maher Mohammad EL
Sheikh1*
1Public Health and Community Medicine Department, Faculty of Medicine, Menoufia University, Egypt.
2 Dermatology, Andrology and STDs Department, Faculty of Medicine, Menoufia University, Egypt.
*Corresponding author: Ghadeer Maher El Sheikh, Mobile:01004039259, Email: ghadeer_maher@yahoo.com
ABSTRACT
Background: Sexual satisfaction not only leads to one's marital satisfaction but also plays a crucial role in psychological
well-being and overall satisfaction with life of married individuals.
Objectives: The purpose of this study was to determine the prevalence and cofactors of sexual satisfaction, as well as its
relationship to mental health in Egyptian married women.
Participants and methods: An analytical cross-sectional study was carried out on 256 married females selected from
attendants of two healthcare centers in Menoufia governorate, Egypt. Sexual satisfaction among the participant women was
assessed using Married Women Sexual Satisfaction Questionnaire (MWSSQ) while their mental health was evaluated using
the 28-items General Health Questionnaire (GHQ-28).
Results: Using MWSSQ revealed that 9.8%, 82% and 8.2% of participants were sexually dissatisfied, moderately satisfied
and highly satisfied respectively. Regarding mental status of participants, GHQ-28 scale showed that 48% of them were of
good mental health, 38.3% were of poor mental health and 13.7% were of very poor mental health. There was a significant
relationship between worsening mental status and decreased sexual satisfaction (P<0.0001). Multivariate regression analysis
showed that husband age, women education and socioeconomic standard were independent risk factors for sexual
dissatisfaction.
Conclusion: Women's sexual satisfaction and their mental wellbeing are intimately related, so it is recommended to
implement effective and appropriate sexual education programs that will raise women's awareness and lessen the suffering
of those who are impacted.
Keywords: Sexual satisfaction, Married females, Mental health.
INTRODUCTION
satisfaction have been related to improved mental health
According to one definition, sexual satisfaction is
(6), it has also been established that women's sexual
"an effective response coming from one's subjective
satisfaction influences their emotions and plays an
appraisal of all aspects of one's sexuality within a
important part in preventing dangerous sexual practices,
relationship". So, it is considered as a reliable measure of
major mental illness, and eventually divorce (7).
sexual health and sexual well-being (1).
In many countries, sexual dissatisfaction is an
Sexual satisfaction has a strong association with
increasingly frequent issue, and it affects females more
marital contentment, which is necessary for long-term
than males. The main contributing factors include
stability and healthy family bonds (2).
incorrect beliefs held by women about sexual activity and
Female sexual satisfaction is influenced by a
cultural taboos surrounding it, in addition to parenting
variety of factors, including length of marriage, age at
approaches that do not recognize their role in the
marriage, age at the time of marriage, number of
appreciation of sexual functions and sexual demands. As
marriages, number of children, employment status, and
a result, they are impacted by a variety of psychological
educational background (3). It is also impacted by a variety
problems such as depression, emotional instability, and
of intrapersonal and interpersonal elements, such as the
personality consequences including hostility and violence
strength of relationships, one's religious beliefs, gender
(8).
power, stress, life quality, mental health issues, chronic
In Egypt, there is limited research on sexual
disease, age gap between couples, and child-rearing
function and relationship satisfaction among females. So,
methods (4).
this study focused on the prevalence of sexual satisfaction
The lack of sexual satisfaction is attributed to
in women and how it is linked to their mental health.
many factors, which may include marital issues, partner
performance during the sexual activity, sexual
PARTICIPANTS AND METHODS
dysfunctions, and lack of emotional satisfaction (5).
An analytical cross-sectional study on 256
Sexual satisfaction and mental wellness are
married females who were selected from the attendants of
intimately linked. While mental health greatly affects
two healthcare centers (Shebin-Elkom and Batanon
women's sexual desires, and higher levels of sexual
Health Centers) in Menoufia governorate, Egypt. At the
248
Received: 23/09/2022
Accepted: 30/11/2022
ABSTRACT
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 255-261
Impact of Direct Acting Antivirals Therapy on Novel Fibrosis Index for
Assessment of Hepatic Fibrosis in Comparison with AST to Platelet Ratio and
Fibrosis-4 (FIB-4) Indexes in Egyptian Patients with
Chronic Hepatitis C Infection in Correlation with Fibroscan
Ahmed S. Allam, Khaled Z. Elkarmouty, Hany H. Kaisar,
Mahmoud M. Arafah, Shaimaa H. Gadallah*
Department of Internal Medicine, Gastroenterology and Hepatology Unit, Ain Shams University, Egypt
*Corresponding author: Shaimaa Hussein GadAllah, Mobile: (+2) 01020911390, E-mail: shaimaahussen2022@gmail.com
ABSTRACT
Background: Scarring or progressive fibrosis and cirrhosis develop over time as a result of chronic viral infection,
which induces inflammation and tissue healing via deposition of extracellular matrix. There has been an increase in
the sustained virological response (SVR) and the rate of eradication of HCV because of the effectiveness of direct-
acting antiviral drugs (DAAs). Reduced hepatic fibrosis is associated with increased SVR rates. There are a variety of
non-invasive fibrosis imaging, scoring, and marker methods: transient elastography, aminotransferase platelet ratio
index (APRI), as well as fibrosis-4 (FIB-4) score.
Objective: The purpose of this research was comparing the novel fibrosis index to APRI, (FIB-4) score and fibroscan
in predicting the degree of hepatic fibrosis in Egyptian chronic HCV patients who were managed by DAAs.
Patients and methods: 100 Egyptians with chronic HCV infection participated in a our 3-month long prospective
Cohort research using the IFN-free DAA combination of Sofosbuvir and Daclatasvir ± Ribavirin.
Results: There was significant regression of fibrosis with DAAs treatment in all patients achieving SVR by fibroscan,
APRI and fib4. Novel fibrosis index is reliable and good tool in estimation of liver fibrosis in correlation to fibroscan,
with the cutoff value in prediction of hepatic fibrosis stage 4 was >3.1 and has sensitivity of 81.5% while the specificity
was 74.1%.
Conclusion Novel fibrosis index has been found to be good reliable marker for assessment of liver fibrosis with high
accuracy of predicting f4 fibrosis stage. There was significant marked reduction of fibrosis degree by fibroscan, APRI
and FIB4 after DAAs treatment.
Keywords: DAAs, SVR, NFI, liver fibrosis indexes.
INTRODUCTION
deciding when to commence antiviral therapy in
Hepatitis C virus (HCV) infection is a prominent
patients with chronic HCV infection (5).
cause of chronic liver disease globally, and in certain
Liver biopsy has mostly been superseded by less
cases has been linked to liver cancer (1). Management
invasive methods, such as fibrosis scores, imaging
lines for chronic hepatitis C virus (CHC) infection have
methods, and novel blood fibrosis markers (3). The
shifted from the use of peginterferon and ribavirin
aminotransferase (AST)/platelet ratio index (APRI) and
(PegIFN/RBV, PR) to that of direct antiviral medicines
fibrosis-4 (FIB-4) scores are two of the most common
(DAAs) (2).
methods used to assess liver damage in individuals with
High ratios of sustained virological response
viral hepatitis C, especially those with advanced fibrosis
(SVR) are accompanied by a minimizing risks of
and cirrhosis (6). Rapid and noninvasive, transient
hepatic fibrosis as well as decreasing risky
elastography (TE) has found widespread application in
consequences such hepatic failure and portal
clinical practice due to its excellent sensitivity and
hypertension (3).
specificity for detecting advanced fibrosis (7).
Studies have demonstrated that patients with
Since the results of the novel fibrosis index
CHC who are managed with IFN and achieve SVR had
correspond with the expected fibrosis stages, F3 and F4,
a lower risk of advancing hepatocellular carcinoma
go with the FibroScan® test and are highly confirmed
(HCC) and other liver-related problems, and an
by clinical data in patients with chronic HCV infection,
enhanced health-related quality of life (4).
it is a valuable and reliable tool for predicting fibrosis
Liver fibrosis stage is a well-established predictor
progression (8).
of disease severity and problems in chronic HCV
AIM OF OUR STUDY
infection; F4 fibrosis is most typically linked to ascites,
The purpose of this research was to compare the
hepatic encephalopathy, portal hypertension, and other
novel fibrosis index to APRI, (FIB-4) score and
implications. Proper staging of hepatic fibrosis in
fibroscan in predicting the degree of hepatic fibrosis in
chronic HCV infection is crucial for achieving timely
Egyptian chronic HCV patients who were managed by
treatment and optimal therapeutic outcomes. In
DAAs.
addition, in low and middle-income countries, where
complete eradication of virus in each instance is crucial,
PATIENTS AND METHODS
a correct diagnosis of fibrosis is especially vital in
255
Received: 15/07/2022
Accepted: 18/09/2022
c:\work\Jor\vol901_39
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 262-267
Human Leucocyte Antigen A Alleles in The Prediction of Post-Kidney Transplant
Lymphoproliferative Disorders, A Single-Center Study
Raghda W. Magar(1) Manal I. Fouda (2), Osama Salama(2), Mohamed Sabry (2), Ayman F. Refaie(1)
(1)Urology and Nephrology Center, and (2)Clinical Pathology Department,
Faculty of Medicine, Mansoura University, Mansoura, Egypt.
Corresponding author: Raghda W Magar, Mobile no; +201000595951,
Email: rwmagar@gmail.com/ raghda_magar_unc@mans.edu.eg, ORCID iD 0000-0002-8582-7474
ABSTRACT
Background: Post-transplant lymphoproliferative disorders (PTLPD) are frequently encountered after kidney
transplantation. Human leucocyte antigen (HLA)A alleles were shown to be a predictor of development of these disorders.
Objective: Study of prediction of human leucocyte antigen HLA-A alleles in the development of PTLPD.
Methods: This study included 50 Egyptian kidney transplant (KT) recipients who underwent live-donor kidney
transplantation, between 2010 to 2022. HLA-A alleles phenotyping was characterized by sequence specific oligonucleotide
probes (SSOP). Nondestructive form of PTLPD was diagnosed by presence of lymphocytosis followed by assessment of,
(CD45 and CD 19) mature B lymphocytes and blast cells (CD5 and CD10) with ratio of kappa/lambda by flow cytometry.
The association between the development of this form and different HLA-A alleles was studied.
Results: Out of fifty recipients, five patients developed a non-destructive form of PTLPD in the median duration of 30
months (ranged, 15-50 months) post transplantation. A significant association was found between the expression of HLA-
A01 (P=0.002, OR=1.020), CI (0.996-1.045) and HLA-A02 (P=0.042, OR=1.019), CI (1.001-1.037) and the development
of PTLPD. Furthermore, HLA-A02 alleles were found to be a significant corelate with onset of development PTLPD.
Conclusion: Among Egyptian kidney transplant recipients, HLA-A01 and A02 alleles are good predictors of development
of early non distractive form of PTLPD.
Keywords: Post-transplant lymphoproliferative disorders, Human leucocyte antigen A alleles, Kidney transplant.
INTRODUCTION
protection (1, 4-7). In this study, the role of HLA-A alleles
Human leucocyte antigens "HLA", which are
as predictive tool for development of non-distractive form
programmed in the major histocompatibility complex
of PTLPD among Egyptian live-donor kidney transplant
"MHC" on chromosome 6, influence the human immune
recipients was evaluated.
responses. HLA molecules are classified to class I and II.
HLA class I is heterodimer of polymorphic-polypeptide
PATIENTS AND METHODS
chain and B2-microglobulin, which deliver peptides from
A total of 50 kidney transplant recipients who received
an endogenous source to cytotoxic T-cells and expressed
their renal allografts from live-related kidney donors
in somatic cells. HLA class II is heterodimer of alfa and
between 2010-2022 were enrolled in this cross-sectional
beta polypeptide chains, that deliver extracellular
study. The inclusion criteria were first-time kidney
peptides and presented them to helper T-cells (1,2).
transplantation, and age between 5 60-year-old. While
T-cells recognize HLA molecules as pathogen and
exclusion criteria were patients with another organ
tumour peptides, which activate adaptive immune
transplantation, history of previous transplantation, or
responses. With most polymorphic human genes, HLA
previous malignancy. All recipients were maintained on
haplotypes are greatly implicated in the causes and
tacrolimus-based immunosuppression. Tacrolimus doses
outcomes of immune conditions and hematopoietic
were adjusted to achieve a whole blood trough level
malignancy (1,2). Since a correlation between HLA and
between 4-8 ng/ml (8).
Hodgkin's lymphoma "HL" was first described in 1967, a
Ethical approval:
lot of studies found links between HL risk with single
The required ethical approval for this study was
nucleotide polymorphisms (SNPs) and HLA allele
obtained from the Ethical Committee of the University
variants. Stratification of the population and the number
of Mansoura (IRB: MD. 20.5.328). The study was
and complexity of linkage disequilibrium in the MHC, on
performed according to Helsinki standards and
the other hand, have made it hard to pinpoint causal
approval consent was obtained from each adult
signals (3). The associations between certain HLA
patient and from the caregiver of each child patient.
phenotypes and the development of post-transplant
lymphoproliferative disorders (PTLPD) have been
Clinical evaluation:
reported in many studies. They showed that the role of
Recipients were thoroughly examined with special
HLA with tumour antigen presentation could be involved
attention to any lymph node enlargement or
as either a genetic risk factors, prediction, or the disease
splenomegaly.
262
Received: 13/09/2022
Accepted: 06/11 2022
c:\work\Jor\vol901_40
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 268-274
Dermatology Life Quality Index and Work Limitation among Psoriasis Patients
Nashwa Nabil*1, Nader Nasr2, Eman Mahmoud Shebl3
Departments of 1, 3Community, Environmental and Occupational Medicine, 2Dermatology and Andrology
and Faculty of Medicine, Benha University, Egypt
*Corresponding author: Nashwa Nabil, Mobile: (+20) 01125923049, E-Mail: nashwa.nabil@fmed.bu.edu.eg
ABSTRACT
Background: Psoriasis is a long lasting immune-mediated disease that has a significant ferocious effect on quality of
life (QOL). It is often accompanied with social stigmatization, physical disability and psychological disorders that
may reach to suicidal ideation. All these effects of psoriasis have a significant negative impact at patients' work
productivity. Nevertheless, the effects of psoriasis on work-related factors have not been extensively studied.
Objective: The aim of the current study is to assess the relationship between the severity of psoriasis, dermatology life
quality index and work limitation among employed psoriatic patients. Patients and methods: A cross-sectional study
was conducted at Benha University Hospital Dermatology Clinic from 1st August 2022 till the end of October 2022.
The study included 180 of psoriasis patients using an interview questionnaire incorporating the Dermatology Life
Quality Index (DLQI) and Work limitation questionnaire (WLQ). An assessment of the disease severity was carried
out using the Psoriasis Area Severity Index (PASI). Results: The majority of studied group were males (64.4%) with a
median (IQR) age 45 (40-52) years old. Their median (IQR) disease duration was 12 years. About 48.9% of the
studied patients have degree PASI score. DLQI and WLQ score significantly increased among studied patients have
severe PASI grade [median 26 (IQR 23-27) and median 65 (IQR 50-75), respectively]. There were highly significant
positive correlations between DLQI and WLQ score, age and disease duration among the studied patients.
Conclusion: Psoriasis has a great impact on the workers, the organization and the society as a whole. So measures for
good psoriasis management are recommended.
Keywords: Psoriasis, Work limitation, DLQI, WLQ, PASI.
INTRODUCTION
other chronic conditions as hypertension, congestive
Any area of the body can be affected by the
heart failure, type 2 diabetes, or depression. Patients
chronic inflammatory skin disease psoriasis, which has
may have severe physical discomfort and some
a pattern of remission or relapse (1). It happens when
handicap depending on the location and degree of
the immune system mistakenly perceives a healthy
outbreaks (9).
skin cell as a pathogen and sends out false signals that
Away from physical impact of itching, pain,
lead to an increase in the production of new skin
and scaling, the patients can also feel ashamed or
cells(2).
embarrassed because of their disease which affects
It affects 0.14-1.99% of persons worldwide,
their social life by avoiding social activities (10).
making it a very common condition (3). Psoriasis
Perceived discrimination, stigmatization and social
distresses 3 % of the American population, with
exclusion are psychologically devastating for
approximately 250,000 new cases every year (4). In
individuals suffering from psoriasis and their
Egypt, the prevalence of psoriasis ranges between
families(11).
0.19% and 3% of the Egyptian people (5).
As a result, psoriasis has a massive negative
The most prevalent type of psoriasis, plaque
impact on people's lives.
psoriasis (PSO), often produces raised, scaly, and
The severity of the illness and its stigma are
erythematous lesions to emerge on the skin (2). Nearly
related to a negative impact on productivity at work.
30% of individuals experience pain and swelling in
Both the sick and society must pay a high price for this
their joints along with other symptoms, which
lost output (12). The projected annual economic impact
indicates the onset of psoriatic arthritis (6). PSO can
in the United States is $35.2 billion, of which 32% is
manifest at any age, but the majority of instances
due to lost productivity at work (13). According to one
happen before the age of 35, and women are frequently
study, 49% of psoriasis patients who were working
identified earlier than men (7).
frequently missed work due to their condition, while
Although there are several therapies available
92% of those who were unemployed cited psoriasis as
to decrease the symptoms of the disease, psoriasis is
the main reason for their situation. Additionally,
not curable (8). The patient's age, general health,
presenteeism (decreased productivity despite being
comorbidities, and severity all factor into these
present at work or school) contributes to patient
treatments (9). Psoriasis can range from minor to
productivity loss in addition to absenteeism (decreased
severe. How much of the body is affected by psoriasis
productivity as a result of absence from work or
determines the severity. Additionally, consider how
school); additionally, presenteeism makes up a larger
psoriasis affects a person's daily life (2). It has been
portion
of
overall
productivity
loss
than
discovered that severe cases of psoriasis have an
absenteeism(14).
impact on health-related quality of life comparable to
268
Received: 25/10/2022
Accepted: 25/12/ 2022
c:\work\Jor\vol901_41
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90 , Page 275-281
Determination of miRNA -125b expression in Ankylosing Spondylitis
Hiba Haider Hashim1*, Reema Mohammed Abed2
1,2 Department of Biotechnology, College of Science, University of Baghdad, Baghdad, Iraq
*Corresponding author: Hiba Haider, Mobile phone: (+96) 47702622053, ORCID: 0000-0002-2550-645X,
Email: heba.haidar1206a@sc.uobaghdad.edu.iq
ABSTRACT
Background: The most prevalent kind of spondylo-arthropathies is ankylosing spondylitis (AS); >90% of those
who have it are HLA-B27 positive. AS may be influenced by non-HLA genes. MicroRNAs are 18-23 nucleotide
non-coding RNA molecules that gene expression control post-transcriptional.
Objective: The aim of the present study is to evaluate the expression profile of miRNA-125b and serum levels of
ESR, CRP in the control group and patients alike and find their association with disease progression in AS patients
and evaluate their significance as novel markers for AS.
Patients and methods: This case control study included 100 AS male patients and 100 healthy controls of matched
age with no history of infectious or autoimmune disorders. AS patients were recruited from the Hematology Clinic
in Medical City (Baghdad Hospital) and diagnosed with AS on the basis of complete blood picture (CBC), CRP,
along with MRI, and X-Ray. Clinical assessment, history of treatment administration, disease duration, and smoking
were taken into account for Disease Activity Indexes for AS patients. Disease was assessed using the Bath AS
Disease Activity Indicator (BASDAI), along with ESR (mm/h) and (CRP) (mg/l) to assess the mobility and
functional limitations. We investigate (miRNA-125b) expression in individuals with AS and in healthy individuals
by real-time quantitative polymerase chain reaction. Characteristic Receiver operating (ROC) in AS patients was
done to evaluate accuracy of diagnostic of miRNA-125b in patients with AS from control subjects.
Results: AS male patients had mean age of 40.56 (SD 10.19) and disease duration of 9.04 (SD 2.03) years. The age
of the male controls (38.78 ± 10.57 years) was not significantly different from that of AS patients (p=0.227). Both
AS Disease Activity Index (BASDAI) and AS Functional Index (BASFI) values were 3.45 (SD 2.03) and 3.84 (SD
2.62), respectively. It was observed that 57% of patients have HLA-B27positive and ESR and levels C-reactive
protein were 18.34 (SD 3.45) and 25.39 (SD 19.59) mm/h, respectively. Our results revealed a significant decrease
in (miRNA-125b) expression with fold change (0.133) in AS patients. The area under curve (AUC) was 0.962 and
cut off point was 8.94. Specificity and sensitivity of miRNA-125b were 92% and 91%, respectively.
Conclusion: Expression profile of miRNA-125b can be used as novel markers for AS.
Keywords: Non-coding sRNA, Disease duration, miRNA-125b, Disease activity, University of Baghdad.
INTRODUCTION
Ankylosing spondylitis is an inflammatory
RNAs having a length of 18 to 22 nt are known as
condition (AS), initially the spine joints and a
microRNAs (6).
characteristic backache. Permanent deterioration to the
Two-thirds of the human protein-coding genes
axial joints' structure and functionality gradually
seem to be under the control of miRNAs. Several
occurs as the disease progresses, causing a severe
findings claim that miRNAs play a crucial part in a
morbidity (1).
variety of physiological and pathological processes (7).
Despite the fact that there is no scientific test
Furthermore, miRNAs are highly stable, easy to
that can identify AS, 9095% of AS patients in Central
quantify, and present in a several clinical samples,
Europe and North America carry the HLA-B27 gene
which makes them excellent diagnosis as invasive-free
(2). However, it is still largely unknown what other
biomarkers for the primarily diagnosis or prognosis of
genetic changes associated with AS exist outside of
a number of human diseases, involving Cancer, cardiac
HLA-B27. The main criteria for diagnosing AS often
disease, rheumatic-related disease, mass cell
include HLA-B27, markers of inflammatory,
carcinoma, and cancer of the colon (8) .
subjective symptoms, and imaging testing. To
MiR-125b controls biological processes
decrease the time, it takes to diagnose AS, diagnostic
important for both lymphoma and RA, such as
indicators with high specificity and sensitivity are
inflammation, B-cell differentiation, TNF production,
urgently needed (3).
and apoptosis, as it is an evolutionarily conserved
ESR and CRP values are only high in 5070%
miRNA (9).
of patients with active illness (4). Studies have shown
The major regulators of innate immune and
that histone changes, DNA methylation, and
inflammatory reactions have been noted as miRNA-
microRNA are some of the epigenetic pathways that
125a and miRNA-125b. Nuclear factor Kappa b (NF-
support AS (miRNA) (5). Endogenous non-coding
KB) is activated by miRNA-125b in RA, which causes
inflammation (10).
275
Received: 15/7/2022
Accepted: 18/9/2022
c:\work\Jor\vol901_42
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90 , Page 282-293
N- Acetyl Cysteine Versus Hesperidin as a Prophylactic Agent for
Lambda - Cyhalothrin Induced Hepatotoxicity in Adult Male Albino
Rats: Histological and Immunohistochemical Study
Nehal Fahmy Shaheen, Mai Hassan Ibrahim*
Department of Anatomy and Embryology, Faculty of Medicine, Benha University, Egypt
*Corresponding Author: Mai Hassan Ibrahim, Mobile: (+20)01145779734,
Email: may.ibrahim@fmed.bu.edu.eg, ORCID: 0000-0001-5999-2612
ABSTRACT
Introduction: Lambda Cyhalothrin (LCT) is greatly used to manage a wide variety of pests present in farming and in
home procedures.
Aim: The current work was intended to demonstrate structural and functional alterations within the liver subsequent to
long-standing exposure to LCT. Protective effect of Hesperidin and N- acetylcysteine was also investigated.
Material and methods: 40 adult male albino rats were used in this experiment, and they were split into four equal
groups: control, LCT group, rats were received LCT at a dose 61.2mg/kg b. wt. per day by oral gavage for 28 days. LCT
+ Hesperidin group, rats were given the same dose of LCT with simultaneous oral dosage of HSP at a dose of 100mg/kg
b. wt., LCT + N-Acetyl cysteine group at which rats were received the same dose of LCT as the previous 2 groups with
simultaneous oral administration of N-acetyl cysteine 150 mg/kg b. wt. The liver underwent a number of biochemical,
histological, and immunohistochemical analysis.
Results: LCT induced oxidative stress which leads to liver damage (increases MDA / decreases GSH). LCT caused
degeneration of hepatocytes and increases inflammatory cells, this is followed by rise in liver markers (AST and ALT).
While concurrent administration of Hesperidin and N- Acetyl cysteine during LCT exposure period preserved the
architecture of the liver, prevents its damage, reduced oxidative stress and normalized liver function tests.
Conclusion: Administration of N Acetyl cysteine during exposure to the insecticide LCT has a protective effect on the
liver more than Hesperidin.
Keywords: Liver, Lambda- Cyhalothrin , N-Acetyl Cysteine, Hesperidin.
INTRODUCTION
MATERIAL AND METHODS
Lambda-cyhalothrin )LCT) is an artificial
Animals & experimental plan
pyrethroid which has wide-ranging insecticidal and
Forty male mature albino rats 2 months old and
acaricidal properties; it is usually used in applications
weighed 180 - 200 grams were used in this study. We
where it is able to control insects and pest invasions(1) .
get the rats from the laboratory animals' section of the
The liver is a crucial component of the body's
Veterinary Medicine Faculty at Zagazig University,
metabolic process, converting a variety of nutrients into
Egypt. Underneath environmental laboratory condition
proteins and secreting bile. It possess a chief purifying
at temperature 20± 2°C. Rats were retained in plastic
role by converting and removing toxins via hepatocyte-
cages to escape any metallic contact. Water and typical
facilitated enzymatic mechanisms (2).
diet were permitted. The rats were split into four equal
Metabolism of (LCT) occurs quickly in liver by
groups, each with ten rats after a week of lodging.
oxidative and cleavage of ester leading to production of
Group I (Control group): Three separate groups
ROS (3). Lipid peroxidation is a result of these ROS'
of ten rats were created:
direct interactions with cellular biomolecules leading to
Group Ia: four rats were given regular diet.
damage of DNA and protein oxidation (4).
Group Ib: three rats were oral gavaged with
Hesperidin (HSP) is an active flavonoid present
distilled water daily.
plentifully in citrus types as lemon, blood orange,
Group Ic : three rats were given 1%
orange and lime. It possesses antioxidant antiviral, anti-
carboxymethylcellulose (CMC) through oral
inflammatory, analgesic, and anticarcinogenic effect (5).
gavage daily.
The precursor of the amino acid L-cysteine is N-acetyl
Group II (Lambda-cyhalothrin treated rats)
cysteine (NAC). It is well recognised that L-cysteine is
(LCT): LCT was administered to the rats every day
essential for the production and replenishment of
at a dose 61.2mg/kg body weight (1/10 of LD50)
reduced-glutathione (GSH). As one of the most potent
through oral gavage after dilution with distilled
antioxidant molecules, GSH can guard tissues from the
water for 28 days (7).
damaging impacts of ROS under oxidative stress
Group III (LCT + Hesperidin ): Rats were given
situations (6).
LCT orally as in group II with simultaneous oral
The goal of the current study was to demonstrate the
administration of HSP for 28 days at a dose
potential safeguarding impact of Hesperidin and N-
100mg/kg b. wt. daily (8).
acetylcysteine against Lambda cyhalothrin effect on
Group IV (LCT + N-Acetylcysteine): Rats
liver.
were received 150mg/kg b. wt. of N-acetyl
282
Received: 27/10/2022
Accepted: 25/12/2022
c:\work\Jor\vol901_43
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 294-299
Effect of Blunt Extension of Myometrial Incision Versus Sharp
Extension during Cesarean Section on Isthmocele Development
Adel Atef 1, Mohamed Sayed 2, Akmal Nabil El-Mazny1, Hadeer Mashaal El Sayed 1
1 Department of Obstetrics and Gynecology, Faculty of Medicine, Cairo University, Kasr Alainy Street,
Cairo 11562, Egypt, 2 Obstetrics and Gynecology, Ministry of Health and population of Egypt, Giza, Egypt
Corresponding author: Adel Atef, Email: dr.adel90@cu.edu.eg, Telephone: 01115241250, ORCID: 0000-0002-5220-5302
ABSTRACT
Purpose: Isthmocele or cesarean scar defect/niche and its consequences are becoming more common worldwide, which
is unlikely to be because of improved diagnosis or rising cesarean rates.
Objective: This study aimed to see how the development of niche and maternal problems were affected by the method
of uterine incision extension.
Subjects and Methods: A total of 280 women from Kasr Alainy Teaching Hospital's Labor and Delivery section were
included in the study. Two groups were observed over 10 months: group A sharp extension group and group B blunt
extension group (1:1).
Results: There were no significant statistical differences between the two groups with respect to placental location,
presentation, amniotic fluid, incision extension, and the presence of niche 6 weeks or 3 months postoperatively by
transvaginal sonography. No significant differences were also found in scar thickness or surrounding myometrium
thickness between the two groups. However, there were statistically significant variations between the two groups with
respect to operational time, blood loss during closure, and uterine vascular damage.
Conclusion: There was no difference in the establishment of a cesarean scar niche or scar thickness between sharp and
blunt uterine incision extensions. Sharp incisions may be preferable to blunt incisions because they result in properly
aligned myometrial layers. More clinical trials with bigger sample sizes are needed to assess the impact of the technique
of extending the uterine incision on the establishment of cesarean niches.
Keywords: Cesarean scar, Defect, Niche, Blunt extension, Sharp extension.
INTRODUCTION
uterine incision during CS on the development of niche
The incidence of cesarean section (CS) is risen in
in comparison to sharp extension.
the Western world from an average of 14.5% to reach in
the last two decades to 27.2% (1). The rising prevalence
Methodology
of CS has sparked curiosity in the deeply rooted
Study design and setting
consequences on the scar of cesarean section, including
An observational cohort study was conducted using a
abnormal placentation, a uterine scar disruption or
convenience sample of pregnant women undergoing
rupture uterus. Two other durable less severe but more
primary elective CS from May 2021 to March 2022. The
common effects are gynecological problems and
study was conducted at Kasr Alainy Teaching
infertility (2).
Hospital's Labor and Delivery section, which is part of
The niche in the uterine cesarean scar is a relatively
the Obstetrics and Gynecology Department.
recent long-term sequelae. After one or more CSs, a scar
niche is described as "a depression of the anterior
Ethical considerations:
myometrium at the level of uterine isthmus where the
The study was carried out following the World
uterine cesarean scar was previously done with at least
Health Organization's ethical standards for human
2 mm depth on ultrasonography" and is found in 56%
studies and the Helsinki Declaration. The Research
84% of women (3).
Ethics Committee of Cairo University's Faculty of
The ways of performing CS and uterine closure
Medicine approved the study (IRB: MS-100-2021).
differ. Double-layer closure versus single-layer closure,
All potential participants signed informed written
unlocked sutures in contrast to locked sutures, and
consents after a thorough description of the study's
whole flap thickness in contrast to split thickness are
goal and potential advantages.
some of the differences (including or excluding the
decidual layer, respectively) (4).
Study population
Although a sharp scalpel is used to make the
All women who had their first CS were included in
incision, it can be expanded to either side with scissors
the study. Other requirements to be a part of the study
or by blunt dissection with hands (5). It was hypothesized
included a singleton pregnancy with a parity of fewer
that when a uterine incision is bluntly extended, the
than three, an age range of 1835 years, and signed
resulting edge may be uneven or ragged, and hence the
informed permission. Women with a previous CS,
myometrium healing may be poor, as opposed to sharp
previous myomectomy either open or laparoscopic,
extension, which produces unique edges. Our work
known causes of abnormal uterine bleeding (e.g.,
aimed at studying the impact of blunt extension of
uterine anomaly, cervical dysplasia, or hormonal
294
Received: 15/7/2022
Accepted: 18/9/2022
c:\work\Jor\vol901_44
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 300-307
`Evaluation of Connecting a Fourth Ventricular Catheter with Y Connector to a
Previous Ventriculoperitoneal Shunt, as a Treatment Option for Patients with
Symptomatic Trapped Fourth Ventricle
Mohammed Hammad Eltantawy*, Shawky A. Elmeleigy, Ahmad Arab
Department of Neurosurgery, Faculty of Medicine, Benha University, Egypt
*Corresponding author: Mohammed H. Eltantawy, Mobile: (+20)01000221379, Email: hammad_neurosurg@yahoo.com
ABSTRACT
Background: Trapped fourth ventricle (TFV) is a rare clinico-pathological syndrome, usually resulting from
inflammatory conditions (post-infective and post-hemorrhagic) that may present with serious brain stem compression
manifestations. Many treatment modalities have been described with varying degrees of success.
Objectives: To evaluate our results in managing the trapped 4th ventricle by inserting 4th ventricular catheter and
connecting it to the previously implanted ventriculoperitoneal (VP) shunt via Y connector.
Patients and Methods: A total number of 12 cases with TFV were diagnosed and treated surgically between 2014 and
2021 by a fourth ventricular catheter and connection to the pre-existing shunt via a Y- connector. Preoperative clinical
and radiological findings were reported. Postoperative improvement was evaluated during a mean follow-up of 4.3
years. Postoperative complications were reported
Results: 12 patients (6 males and 6 females), with a mean age of 3.3 years diagnosed with trapped fourth ventricles
were included. All patients had previous VP shunts. Headache, vomiting, abnormal movement, gait disturbance, and
nystagmus were the common symptoms. Trapped fourth ventricle was post-infectious in 6 (50%) patients, post-
hemorrhagic in 4 (33.3%) patients, and congenital in 2 (16.7%) patients. 6 (50%) patients had preoperative slit lateral
ventricles and 4 (33.3%) had multiloculated hydrocephalus. Postoperatively 10 (83.3%) patients had clinical
improvement while 2 (16.7%) remained as preoperative. All patients had a decrease in the 4th ventricular size.
Complications of surgery were minor.
Conclusion: Fourth ventricular shunting with a Y connector is a valuable and effective modality of treatment in TFV,
especially when other methods fail or in specific complex pathological situations, with fewer complications.
Keywords: Trapped fourth ventricle, Y-connector, Fourth ventricular shunt.
INTRODUCTION
approach
to
the
fourth
ventricle
by
Trapped fourth ventricle (TFV) is an uncommon
ventriculocisternostomy with excision of the arachnoid
clinico-pathological syndrome that occurs when the
villi and endoscopic approaches for aqueductoplasty,
fourth ventricle loses its proximal communication to the
aqueductal stenting (anterograde or retrograde), and
third ventricle through the cerebral aqueduct of sylvius
cysto-ventricular fenestration. Literature till now is still
and loses its distal outlet drainage to foramina of
lacking a standard consensus for the treatment of such
Magendie and Luschka, with the continuation of CSF
condition favoring one treatment modality over the
production by the choroid plexus from the wall of the
other, probably due to the wide diversity of etiologies
fourth ventricle; leading to progressive dilation of such
and pathological pictures this condition may have. The
closed space (1).
only agreement between authors is to follow
Trapped 4th ventricle usually occurs as a sequela of
conservatively the asymptomatic cases with no
intraventricular hemorrhage or infection and less
progression of the fourth ventricular size. The selection
commonly with congenital conditions like Dandy-
of the treatment plan must be guided by a case-specific
Walker malformation or neoplastic like carcinomatous
understanding of anatomic, radiographic, and
meningitis. In most cases, it occurs after a variable
pathophysiologic factors (4). However, shunting of the
period from supratentorial shunting (2).
fourth ventricle has been considered by many authors as
The clinical presentations of trapped fourth
the less invasive and the mainstay method of treatment
ventricle may range from mild nonspecific symptoms
(5).
such as headache, nausea, and vomiting up to cerebellar
In this study, we tried to evaluate our results in
or brainstem symptoms; ataxia, diplopia, lethargy,
managing trapped 4th ventricle, due to different
nystagmus or cranial nerve neuropathies and deficits.
etiologies, by adding a fourth ventricular catheter and
The cerebellar and brain stem compression due to the
connecting it to the previously placed supratentorial
mass effect of the progressively dilated fourth ventricle
ventricular shunt with a Y connector.
is responsible for these clinical conditions. Although
some patients may be detected incidentally (3).
PATIENTS AND METHODS
Multiple treatment options were suggested for the
A total number of 12 patients [six females, six
management of the trapped fourth ventricle, with
males] were diagnosed as symptomatic trapped fourth
variable success rates and with superiority to
ventricles due to variable etiologies with an average age
endoscopic procedures. Treatment modalities include
at the time of surgery ranging from six months to five
CSF diversionary procedures, direct microsurgical
years (mean 3.3 years).
300
Received: 22/10/2022
Accepted: 24/12/2022
c:\work\Jor\vol901_45
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 308-320
Therapeutic Role of Salivary Exosomes in Improving Histological and Biochemical
Changes Induced by Duct Ligation in the Submandibular Glands of Albino Rats
Nahla E. Ibrahem1, Noura H. Mekawy1, Samia Hussein*2, Heba M. Abdel-aziz1
Departments of 1Medical Histology and Cell Biology and 2Medical Biochemistry and
Molecular Biology, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Samia Hussein, Mobile: (+20) 01062725981, E-Mail: samiahussein82@hotmail.com
ABSTRACT
Background: Salivary gland diseases are induced by radiotherapy, autoimmune diseases, inflammation, trauma, and
obstructive lesions. They result in functional gland impairment which harms oral health and quality of life. Exosomes
are extracellular nanoparticles produced by a variety of cells including stem cells. Exosomes facilitate the paracrine
functions of the releasing cells, and they are easily absorbed and can integrate with target cells resulting in long-lasting
effects. Objective: To identify the therapeutic role of exosomes in the histological and biochemical changes in the
submandibular gland (SMG) of adult male albino rats after duct ligation.
Materials and methods: Forty adult male albino rats were included in this study. They were distributed in three main
groups: control, duct-ligated and treated groups. Exosomes were isolated from the saliva of healthy rats. The treated
group received salivary exosomes one week after duct ligation. At the end of the study, the SMG was removed from
all groups and two samples were obtained from each gland: one for antioxidant measurement and RNA extraction with
subsequent gene expression determination. The other was used for histopathological and immunohistochemical
analysis.
Results: The ligated group revealed degenerative histological changes including vacuolated cytoplasm, apoptotic
nuclei, congested blood vessels and cellular infiltrate. Increased area percentage of both collagen fibers and S100
immunoreactivity was detected. The treated group showed an amelioration in the histological and
immunohistochemical picture. After treatment with exosomes, a significant increase in all antioxidants was recorded.
This was accompanied by an increase in both c-kit and cytokeratin-5 gene expression.
Conclusion: There were improved histological, immunohistochemical and biochemical alterations after treatment
with salivary exosomes. So, salivary exosomes could be a possible modality in treating SMG diseases.
Keywords: Therapeutic Role of Salivary Exosomes, Duct Ligation in the Submandibular Glands, Albino Rats.
INTRODUCTION
contributing to organ crosstalk. Exosomes have been
Salivary glands have an important role in
used in clinical trials to diagnose or cure a variety of
maintaining the general health of the oral tissues by
disorders and understand their pathogenesis [5].
saliva. Saliva aids in digestion, enamel protection,
S100 protein family members are multifunctional
lubrication and pH buffering. Additionally, it has anti-
proteins that interact with several effector proteins in
inflammatory, anti-bacterial and anti-fungal properties.
the
cells.
They
control
secretion,
protein
About 60% of saliva is secreted by the second-largest
phosphorylation and synthesis, cell division, cell
salivary gland, the submandibular gland (SMG) [1].
growth and differentiation, transcription and protection
Radiotherapy, autoimmune disease, inflammation
from oxidative cell damage. S100 protein is mainly
and trauma to the salivary gland and obstruction of the
found in some neurons, glial and Schwann cells of
gland duct by calculi are all known to cause diseases
normal nervous tissues. Also, its expression was
of the salivary gland [2]. Duct ligation is a helpful
reported in oligodendrocytes and adipocytes.
experimental strategy for examining the mechanisms
Antibodies to the S100 protein are signs of salivary
behind salivary gland inflammation and regeneration
gland cellular damage [6]. Current treatments for
since the SMG can improve after inflammatory and
salivary gland diseases are palliative. Thus, how to
fibrotic changes caused by ligation [3].
effectively reverse atrophy and recover the function of
Exosomes are extracellular nanoparticles. They
the salivary gland is an urgent issue. So, this study was
have a lipid bilayer with a diameter range from 30 to
performed to clarify the therapeutic role of exosomes
150 nanometers, and they are secreted by several cells,
in the structural and biochemical alterations in the
including stem cells. Their composition reflects the
SMG of adult male albino rats following duct ligation.
composition of the parental cells and they facilitate the
paracrine functions of the releasing cells. They are
MATERIAL AND METHOD
stable and relatively difficult to degrade. Also, they are
Study design:
easily absorbed and can integrate with target cells
In our study, 40 healthy adult male albino rats of
resulting in long-lasting effects [4].
weight 150200g on average were included. Rats were
Exosomes are present in many body fluids
grown in sterile conditions (23±5° and 12 hours of
including saliva. They transport lipids, RNAs, and
darkness and light cycles). They were given a standard
proteins. They are also active carriers for target protein
pellet diet and an access to water. All rats received
delivery driving genetic and epigenetic changes and
human care in compliance with the guidelines of the
308
Received: 22/08/2022
Accepted: 23/10/2022
c:\work\Jor\vol901_46
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 321-327
Probiotic Characteristics of Enterococcus spp Bacteria Isolated from
Different Sources
Yaqeen Dheyaa Faris, Ahmed Khassaf Atya
College of Science, University of Thi-Qar, Thi-Qar, 64001, Iraq, Department of Biology
Corresponding authors: Yaqeen Dheyaa Faris, E-mail: yageen.far.bio@sci.utq.edu.iq
ABSTRACT
Background: Probiotics are "live bacteria that, when provided in suitable amounts, impose a health benefit on the
host," according to the World Health Organization. Objective: This study aims to assess the probiotic properties of
Enterococcus bacteria and the safety and effectiveness of it as a probiotic agent.
Methods: Lactic acid bacteria, were isolated, using MRS media. Through biochemical tests, and PCR and
sequencing methods the isolates appeared to be members of the Enterococcus species. So blood agar was used to
grow them as a safety test. The presence of bacteriocin was then verified in the bacteria using a partial purification
process. Its autoaggregation, hydrophobicity, biofilm formation, and other probiotic characteristics of the bacteria
were investigated.
Result: When cultivated on blood agar media, the lactic acid bacteria were not hemolytic. The probiotics'
characteristics included substantial capacity for auto aggregation, hydrophobicity, and biofilm formation, The
results showed that the Etetrococcus employed in this study had bacteriocin, a pectocin variant effective against a
variety of dangerous bacterial species.
Conclusion: Although it is not hemolytic when growing on blood agar medium, Enterococcus spp. isolated from
conventional cheese and waterfowl intestines, in this study are unsatisfactory because of this safety trait. One of the
properties of bacteria that makes them advantageous is that they produce bacteriocin and inhibit the growth of gram-
negative bacteria.
Keywords: Lactic acid bacteria, Probiotics, Enterococci, Bacteriocins, probiotic properties.
INTRODUCTION
According to science, probiotics are non-
MATERIALS AND METHODS
pathogenic bacteria that improve consumer health
16S rRNA sequencing for isolate identification
when consumed regularly and at recommended
samples was plated onto an MRS agar medium and
dosages. Probiotics mostly fall within the category of
cultivated for 48 hours at 37 °C to isolate the bacteria.
lactic acid bacteria (LAB). The probiotic strains from
DNA marker amplification for 16S rRNA and
the LAB category that are most widely used in food
representative isolates was found utilizing a primer
items include Bifidobacterium, Lactobacillus,
set and 16S rRNA sequencing on the isolates to be
Enterococcus, and Lactococcus(1).
identified on the countable plates (30-300
The member species of the genus Enterococci
CFU/plate). Amplicons were sequenced after being
are widespread and can be discovered in many
purified with a PCR purification kit. Using the
ecosystems, such as freshwater, soils, sediments, sea
BLAST algorithm, 16S rRNA sequences from
water, beach sand, and a variety of plants (2). The
isolates were compared.
typical gastrointestinal (GI) flora of both humans and
livestock frequently includes Enterococci species (3).
Probiotic properties
Despite being thought of as commensals in
1-Hemolytic Activity
humans, Enterococcus spp. is an important
Through inoculation on blood agar medium
opportunistic pathogen that can cause bacteremia,
containing 5% (w/v) human blood or sheep blood, 10
biliary and stomach infections, endocarditis, and
l of a 24-hour-old culture, the hemolytic activity of
urinary tract infections in addition to biofilms on
fresh cultures isolated from cheese and intestines of
catheters and implanted medical devices(4). The
ducks was examined. At 37 °C, the plates were
bacteriocins (enterocins) produced by the enterococci
incubated for 48 hours. Following this time, they
can increase the shelf life and safety of items by
were examined for hemolytic activity by looking for
acting as antibacterial peptides(5).
distinct haloes around the colonies.
The only food preservatives used nowadays are
bacteriocins produced by lactic acid bacteria, which
2-Biofilm Production through Micro titer Plate
offer significant advantages over chemically
Method (MTP)
produced food preservatives and antibiotics.
On a sterile 96-well microtiter plate, biofilm
Bacteriocin preparations such as propionicin,
development was carried out. Two ml of brain heart
acidocin, and nisin, as well as pure and mixed
infusion broth (BHIB) and a colony of each isolate
cultures of lactic acid-producing bacteria, are actively
were added to tubes, and the tubes were then
used as antibacterial agents against bacteria and
incubated at 37°C for 24 hours. 200 l of each broth
pathogens(6)
culture was put into microtiter plates and incubated at
321
Received: 22/08/2022
Accepted: 23/10/2022
c:\work\Jor\vol901_47
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 328- 334
Evaluation of the Quality of Life in Children with Haemophilia
Yasser Abdelrahman Ahmed1, Ahmed Mohammed Farid EL-Moazen1, Reham Adly Ahmed Abu-Rehab2*
1 Pediatrics and Neonatology Department, Faculty of Medicine, Al-Azhar University, Assiut, Egypt
2 Resident of Pediatrics and Neonatology, El-Helal Health Insurance Hospital, Sohag, Egypt
*Corresponding author: Reham Adly Ahmed Abu-Rehab, Mobile: (+20) 01066596517, Email: drreham606@gmail.com
ABSTRACT
Background: Congenital haemophilia primarily affects males. Haemophilia A or B is caused by mutation of clotting
factor genes on X chromosome.
Objective: The aim of the current study is to assess quality of life of children with haemophilia.
Patients and methods: A cross sectional comparative study was conducted at Hematology Clinic at El-Helal Hospital
and Sohag University Hospital on 50 children with haemophilia.
Results: Most patients had joint bleeding and most of them were satisfied about their quality of life (QoL). Most of
patients were able to do homework completely, work well and get around. Most of patients had difficulties annoyance
and difficulties effect on lifestyle. Most patients never had a depression due to the haemophilia. Most children like
school and had friends which made with future plans and never feared from the future. Most patients could perform
muscle activities but some of them felt upset going to hospital.
Conclusion: Haemophilia has effect on studied cases health-related quality of life (HRQOL). The severity of the
disease, bleeding frequency, rate of joint bleeding, financial burden, & therapy all have impact on haemophilia HRQoL.
Routine haemophilia care should contain psychological assessment & caregiver support, which should be measured
using result measures that account for both HRQoL and caregiver burden.
Keywords: Haemophilia, Quality of life, Children, Caregivers, Cross sectional study, Al-Azhar University.
INTRODUCTION
therapy & healthcare. According to studies,
Hemophilia
is congenital
disorder
that
hemophiliacs have a lower quality of life than healthy
impacts mostly men. It is caused by clotting factor gene
people (5).
mutation on X chromosome, which results in lack of
Soucie et al. discovered that hemophilia studied
factor VIII or -IX in haemophilia A or B (1).
cases of all years old have a lower quality of life because
Spontaneous bruising, mucosal and joint bleeding,
of arthropathy (6).
epistaxis, & severe bleeding events like intracranial
The goal of the QoL assessment is to identify
haemorrhage are all common symptoms (2). Repeated
children who are experiencing difficulties as a result of
joint bleeding results in severe joint damage and pain,
their hemophilia disease, estimate complications related
resulting in disability (3).
to hemophilia, & define comprehensive & satisfactory
The most common symptom of haemophilia is
therapy.
bleeding, which occurs after trauma or surgery, with
As a result, it is essential to investigate & analyze
severity correlated with degree of clotting factor
whether degree of bleeding, severity of hemophilia,
deficiency. Bleeding can happen in muscles, joints, or
years old of diagnosis, & years old at which treatment
soft tissue, as well as in neck, throat, chest,
is initiated affect QoL in children with hemophilia
gastrointestinal system, or intracranially in life-
The aim of the current study was to analyze QoL of
threatening cases (1).
children with hemophilia.
Primary therapy aim is to prevent or treat
bleeding; bleeding is usually treated by on-demand
PATIENTS AND METHODS
administration of specific factor concentrate to
A cross sectional comparative study was conducted
compensate for deficient clotting factor, and prevention
at Hematology Clinic at El-Helal Hospital and Sohag
has contained prophylaxis regimens of these factor-
University Hospital on 50 children with haemophilia.
replacement treatments, with non-replacement factors
becoming more widely available in recent years (4).
Inclusion Criteria:
Many studies have looked at the impact of
Patients diagnosed clinically and laboratory with
hemophilia on health-related quality of life (HRQOL).
hemophilia A, aged between 3-16 years, parents or
The disease is also linked to an increased risk of
caregivers (in case of children 4-8 years old) and
hepatitis, AIDS, anxiety, depression, & isolation, all of
children (8-16 years old) who can read, write and
which reduce patients' quality of life as they age.
understand all relevant aspects of research which will be
HRQoL is a multidimensional concept that describes an
explained and discussed with them, outpatients, aware,
individual's ability to function in terms of physical,
and have a good ability to fill out questionnaires and
psychological, and social health (2).
following up with Hematology Clinic at El-Helal
Quality of life (QoL) Evaluation is becoming
Hospital and Sohag University Hospital.
increasingly popular as guide to effective medical
328
Received: 13/7/2022
Accepted: 16/9/2022
c:\work\Jor\vol901_48
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 335-342
The Role of Absorbable Gelatin Sponge (Gel Foam) in Control of
Sternal Bleeding during Cardiac Surgery
Mohamed Elkhouly*, Ahmed Fouad
Department of Cardiothoracic Surgery, Faculty of Medicine, Cairo University, Egypt
*Corresponding authors: Mohamed Elkhouly, Mobile: (+20) 01115551412, E-mail: elkhoulymohamed98@gmail.com
ABSTRACT
Background: Topical hemostatic agents based on gelatin have been shown to be successful in stopping bleeding
throughout open heart surgery, in conjunction with traditional methods.
Objective: To study the efficacy of gel foam for controlling postoperative bleeding in cardiac surgery.
Patients and Methods: A prospective randomized study was performed in Cardiac Surgery Unit of Elkasr Elaini
Medical Center, Cardiovascular Surgery Department in Cairo University, Cairo, Egypt. A total of 120 cases went
through heart surgeries were allocated in 2 groups, 60 cases in each. In group A, gel foam wasn't used but used in group
B under sternum on closure. Study endpoints were the rate of total blood drainage, reopening for bleeding, use of blood
products, tamponade and mediastinitis.
Results: Statistically higher rates of reopening for bleeding, total blood drainage, blood transfusion and tamponade in
group A comparing to group B, (p=0.015, < 0.009, <0.001 and 0.006 respectively). Rate of mediastinitis did not
statistically vary between both groups, but were lower in group B.
Conclusion: Gel foam is effective in reducing postoperative hemorrhage in conjunction with traditional surgical
procedures. Its thoughtful use is linked to lower rate of reopening for bleeding after cardiac surgery.
Keywords: Gel foam, Hemostatic agent, Cardiac surgery, Sternal bleeding.
INTRODUCTION
visualization of the operational area and extends
Cardiac surgical procedure is closely correlated
operational processes (5). Excessive hemorrhage could
with perioperative hemorrhage and a serious potential
cause acidosis and hypothermia which could cause
of transfusion. Hemorrhagic complications in open
coagulopathy (lethal triad) (6).
heart surgery are linked to worse consequences and play
Blood products are used in approximately 21% of
a role to elevated total healthcare expenditure (1). The
all operational processes and 45.8% of cardiovascular
estimated incidence of all unselected patients
instances, but they are linked to a variety of
undergoing cardiac surgery is 5-9%, with limit values
complications and risks. Transfusions is also linked to
ranging from 0-16%(2). The requirement for
immunomodulation, bacterial infections and a lot of
intraoperative and postoperative blood transfusions is
non-infectious but significant health problems (7).
also linked to possible risks such as bad effects,
Systemic and local methods should be used to
transfusion-related harm, or pathogenic transmissions,
achieve hemostasis. The systemic treatment by blood
all of which are considerable morbidity or death
transfusions and pro-coagulant medication is critical,
attributes(1). Hemorrhage occurs as a consequence of
but it additionally carries significant potentials.
many components and steps in cardiac surgery,
Systemic medications, like anti-fibrinolytics and
including the placing of cardiovascular incision lines in
recombinant Factor VII, are commonly prescribed to
large vessels or cardiac chambers and the formation of
treat coagulation defects, but they are costly. Most
high-pressure anastomoses. Stainless steel wire used in
cardiac procedures do not have sufficient proof to
sternal closure is responsible for more than 20% of
support the administration of recombinant Factor VII(8).
causes of reopening (3).
Traditional strategies, such as suture applications
Massive microvascular hemorrhage upon heart
and vessel ligation, or electrocautery, were the initial
surgery can lead to re-exploration, which has been
local strategies of direct postoperative control of suture
linked to a number of adverse consequences, including
lines, anastomosis, and other topics of the operative
a three to four folds increase in operating room period,
area. There are numerous hemostatic manoeuvres,
blood and blood components transfusions, pulmonary
ranging from simple digital pressure management,
hypertension, renal failure, sepsis, atrial arrhythmias,
electrical tissue cauterization and wound irrigation with
long-lasting mechanical ventilation, extending duration
warm saline to topical administration of pro-coagulant
of stay, and causing death (4). Blood loss also impairs
substances (9) (Figure 1).
335
Received: 20/08/2022
Accepted: 21/10/2022
c:\work\Jor\vol901_49
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 343- 346
Retracted paper
1
Received: 02/9/2022
Accepted: 1/12/2022
c:\work\Jor\vol901_50
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 347-352
Could peripheral Eosinopenia be Used as a Prognostic Biomarker for
Chronic Spontaneous Urticaria?
. , . and .
1. Internal Medicine Department, Benha Faculty of Medicine, Benha University, Egypt
2. Dermatology and Venereal Diseases Department, Benha Faculty of Medicine, Benha University, Egypt
Corresponding author: Medhat M. Elamawy, Mobile Phone: 01024443810, Email: m.elamawy@fmed.bu.edu.eg
ABSTRACT
Background: Chronic spontaneous urticaria (CSU) is a chronic, sometimes debilitating skin disorder characterized by the
appearance of wheals, angioedema, or both for a period of more than 6 weeks. Many biomarkers were explored for severity
evaluation such as d dimer and C Reactive Protein.
Objectives: The aim of the current study is to assess the usefulness of peripheral eosinopenia as a valuable and an applicable
biomarker for CSU severity.
Patients and methods: A case control study was conducted on 60 CSU patients. Patients were divided into 30 patients
with mild UAS7 score <15 representing the controls and 30 patients with severe UAS7 score >28 representing the cases.
Eosinophils count and other variables were compared.
Results: Severe cases demonstrated significantly higher age (median 34 vs. 29 years, P =0.043), CRP (14 vs. 2 mg/L, P
<0.001) and positive ASST (56.7% vs. 23.3%, P =0.008). In contrast, severe cases demonstrated significantly lower
eosinophilic count (median 21 vs. 123 cell/mm3, P <0.001), basophilic count (median 5 vs. 25 cell/mm3, P <0.001), and
total IgE (median 93 vs. 221.5 IU/ml, P <0.001). The eosinophilic count showed a significant-excellent AUC of 0.954. The
best cutoff point was 70, at which sensitivity and specificity were 96.7% and 86.7%, respectively.
Conclusion: Peripheral eosinophils are significantly lower count in severe urticarial patients (P value <0.001) and this could
be used as a simple and accessible tool for monitoring urticaria activity.
Keywords: Eosinopenia, chronic spontaneous urticaria, biomarker, case control study, Benha University.
INTRODUCTION
Chronic spontaneous urticaria (CSU) is a chronic,
While eosinophils were considered a defense
sometimes debilitating skin disorder, characterized by the
against parasitic infection, they also had many other
appearance of wheals, angioedema, or both for a period
physiological and pathological properties as they regulate
more than 6 weeks (1).
body thermogenesis (11, 12) activate mast cells and share in
Although the advance in understanding the
allergic diseases development (13). Peripheral eosinopenia
pathophysiology
and
classification
of
chronic
is one of the important biomarkers that might be used as
spontaneous urticaria, there are still many patients who do
an applicable prognostic marker in chronic urticaria (14).
not respond efficiently to treatment, so their quality of life
The aim of the current study is to assess the
was greatly impaired (2).
usefulness of peripheral eosinopenia as a valuable and an
Many urticaria scores and questionnaires were
applicable biomarker for CSU severity.
developed to ensure optimum patient evaluation such as
Urticaria Activity Score (UAS7), Chronic Urticaria
PATIENTS AND METHODS
Quality of Life Questionnaire (CU - Q2 OL) and some of
A case control study was conducted at Benha
them with translated Arabic version (3-7).
University Hospitals, Qalyubia Governorate, Egypt.
Urticaria can be classified according to its duration
Patient was recruited from June 2022 to October 2022.
into acute urticaria which lasts less than 6 weeks and
A total of 60 CSU patients were selected; Patients
chronic urticaria that extends beyond 6 weeks duration.
were divided into 30 patients with mild UAS7 score <15
Thereafter chronic urticaria is subdivided by its triggering
representing the controls and 30 patients with severe
factors into chronic spontaneous and chronic inducible
UAS7 score >28 representing the cases.
one. With advance in urticaria pathophysiology
Inclusion criterion was recently diagnosed CSU and
understanding, different CSU subsets were known. Of
exclusion criteria were patients with malignancy, active
them CSU type IIb which have the higher activity score,
autoimmune disease, or recent steroid use.
autoimmune diseases associated, longer persistence and
For each patient's file, the following variables were
lower responsiveness to 2nd generation antihistamines (8,9).
fulfilled; detailed medical history including demographic
Many biomarkers were explored for severity
data such as age and gender, medication use, duration of
evaluation such as d dimer, C reactive Protein and ESR
illness atopic diseases or associated induced urticaria.
(10).
347
Received: 20/08/2022
Accepted: 21/10/2022
c:\work\Jor\vol901_51
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 353-363
Correlation of Some Apoptotic Markers with Chronic Myelogenous
Leukemia in Iraqi Patients
Raghda Raisan Al-Omairi, Maha Fakhry Al-taee
Department of Biotechnology, College of Science, Baghdad University, Baghdad, Iraq
Corresponding author: Raghda Raisan AL-Omairi, E. mail: raghdarayssan9216@gmail.com, Mobile: +9647714547679
ABSTRACT
Background: The BCR-ABL gene encodes an oncoprotein with abnormal tyrosine kinase activity affecting cellular
proliferation, survival, and apoptosis, is the cause of chronic myelogenous leukemia (CML). A type of programmed cell
death termed apoptosis works as a preventative measure against diseases like cancer.
Objective: This study aimed to assess four apoptotic players in CML patients as an attempt to provide new options for
targeted therapy, and to examine these proteins as potential predictors for the disease.
Methods: 140 participants were divided into two groups, healthy controls (CT) and people with chronic myeloid
leukemia. Healthy samples were 60, while 80 samples were taken from patients who had been diagnosed with CML in
the International Hematology Center, Baghdad, Iraq. Using ELISA approach, we measured serum levels of four critical
participants of apoptosis (TNFR1, BAX, CASP-9, and CYTO-C) in CML patients and controls.
Results: In comparison to patients, controls had higher median levels of BAX, CYTO-C, and CASP-9. While median
TNFR1 levels in patients were greater than in controls. Age-dependently, CT groups had significantly higher levels of
BAX, CYTO-C, and CASP-9 than CML groups in the age categories of < 40 years and 4050 years, in contrast to
TNFR1 which was markedly down regulated in CT. According to gender, CT groups had significantly greater levels of
BAX, CYTO-C, and CASP-9 than CML, while TNFR1 was significantly higher in CML than CT groups in both
genders. BAX, CYTO-C, TNFR1, and CASP-9 are effective predictors in differentiating between CML patients and CT
groups according to the results obtained from receiver operating characteristic analysis. Correlation coefficient analysis
test revealed that BAX correlated with CYTO-C and CASP-9 in a positive-significant manner. While BAX had a
positive, although insignificant correlation with TNFR1. TNFR1 and CASP-9 had a non-significant positive correlation
with CYTO-C. Finally, TNFR1 and CASP-9 showed positive but non-significant correlation.
Conclusions: BAX, CYTO-C, TNFR1, and CASP-9, provide potential targets for diagnosis, prognosis, and treatment.
As they turned to be excellent predictors in CML.
Keywords: CYTO-C (cytochrome-c), TNFR1 (tumor necrosis factor receptor 1), CML (chronic myeloid leukemia),
CASP-9 (Caspase 9).
INTRODUCTION
A translocation between the ABL (Abelson Murine
involves apoptosis. Either the intrinsic or the extrinsic
Leukemia) gene on chromosome 9 and the BCR
routes of apoptosis are triggered depending on the
(breakpoint cluster region) gene on chromosome 22
source of the apoptotic stimuli. A distinct intrinsic
results in the creation of the Philadelphia chromosome,
apoptotic mechanism dependent on mitochondria was
which is the main cause of chronic myeloid leukemia
identified by APAF1, the outer membrane of the
(CML), a myeloproliferative disease. In contrast to
mitochondria becomes permeable as a result of
ABL1, which encodes a non-receptor tyrosine kinase,
mitochondrial disruption, and several molecules are
BCR is a breakpoint cluster region. The 210-kDa
released, including cytochrome C. When APAF1
oncoprotein p210 BCR-ABL1 is translated and works
detects cytosolic cytochrome C (CASP 9) the intrinsic
as a faulty tyrosine kinase that is constitutively
apoptotic pathway's initiating caspase, and other
generated, influencing pathways including PI3K/AKT,
proteins come together to form the apoptosome (3).
JAK/STAT, and RAS/MEK and biological processes
This apoptosome splits CASP 9 into its mature form
like cell proliferation and apoptosis (1).
via an ATP hydrolysis-related mechanism. Mature
The majority of individuals have CML in its chronic
CASP 9 can activate effector caspases like CASP 3 that
phase, which is characterized by symptoms most
are downstream, several BCL-2 family proteins control
frequently related with anemia and splenomegaly as
the permeability of the mitochondria, which permits
fatigue and malaise, can have a cumulative effect that
cytochrome C discharge. (4).
results in pain or early satiety, thrombocytopenia or
The activation of the death-inducing receptors Fas
platelet dysfunction that can also be brought on by
and TNFR starts extrinsic apoptosis, through homotypic
CML. As CML enters the rapid or blast phase,
connections between their death effector domains
symptoms like headache, bone pain, fever, infection,
(DED), FADD engages the DD of the receptor and
bleeding, and lymphadenopathy become more prevalent
recruits CASP 8. When CASP 8 is activated, it cleaves
(2). Apoptosis is a methodical kind of energy-dependent
and activates CASP 3 and CASP 7 (5). One form of
cell demise that eliminates surplus cells. The
planned cell death is apoptosis (PCD) that acts as a
pathophysiology of numerous diseases, including
preventative measure inhibiting the growth of cancer. In
cancer, AIDS, and other immunological disorders
353
Received: 20/08/2022
Accepted: 21/10/2022
c:\work\Jor\vol901_52
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 364-371
Safety and Efficacy of Di-Peptidyl Peptidase-4 Inhibitors in The
Management of Inpatient Elderly with Type 2 Diabetes
Hossam Arafa Ghazi*, Ali H. Hegazy, Amira S. Nowara
Department of Internal Medicine, Faculty of Medicine, Mansoura University, Egypt
*Corresponding Author: Hossam Arafa Ghazi, Mobile: (+20) 01006408074, Email: hossamghazi7@gmail.com
ABSTRACT
Background: Hyperglycaemia in hospitalized elderlies with Type 2 Diabetes (T2D) is frequently seen and
increases rates of hospital stay, morbidity and mortality. Basal Bolus Regimen (BBR) is the corner stone in
management of hyperglycaemia among non-critically ill hospitalized patients. However, it is complex regimen
and associated with increased episodes of hypoglycaemia.
Objective: This study was conducted to explore the efficacy and safety of Di-Peptidyl Peptidase -4 inhibitors
(DPP-4i) with or without basal insulin for management of T2D among inpatient hospitalized elderly.
Patients and methods: We included 90 patients with T2D, both males and females, aged 60 years or more.
Participants were divided into 3 subgroups; Group 1 on BBR using glargine U100 and regular insulin, Group
2 on basal oral regimen using glargine U100 and vildagliptin, and Group 3 on vildagliptin only.
Results: Of all participants, 68 patients were females, and the mean age of the patients was 68.98 (SD 6.7)
years. Mean pre-hospital glycated haemoglobin was 8.09 (SD 1.04) gm%. Documented and severe
hypoglycaemia and hospital stay were significantly lower among groups 2 and 3. No serious adverse events
reported among all participants.
Conclusion: Using DPP-4i with or without basal insulin is safe, effective, less complex regimen associated
with lower episodes of documented and severe hypoglycaemia and hospital stay among elderly patients with
T2D.
Keywords: Elderly, Type 2 Diabetes, Inpatient, DPP-4 inhibitors.
INTRODUCTION
population. Three other categories each resulted in
Hyperglycaemia among non-critically ill
3-5% of all hospital stays in the elderly:
hospitalized patients was reported to be about 22%-
genitourinary disorders, endocrine disorders, and
46% [1]. Moreover, many cross-sectional studies
infections [6].
have reported an estimated prevalence of diabetes
Plenty of professional societies have
in elderly aged (6575 years) and above 80 years
recommended insulin therapy as the cornerstone
about 20% and 40% respectively [2,3]. Hospitalized
for the inpatient management of hyperglycaemia
elderlies when compared to individuals less than 65
[8]. Nevertheless, insulin regimens -mainly multiple
years of age, hospital discharge rates related to
daily injections or Basal Bolus regimen (BBR)
diabetes among them are about 2 folds higher [1].
were associated with increased risk of
With increased age, with or without presence of
hypoglycaemia and complexity of the regimen for
diabetes, rates of hospitalization 3.1 times higher
health care providers [9].
among patients with diabetes compared to those
So, simple regimens with similar glycaemic
who has no history of diabetes [4].
efficacy to BBR and less episodes of
Several clinical trials have been conducted in
hypoglycaemia are needed to improve the care for
critically ill patients and have reported that
non-critically ill patients with diabetes. Data from
improved glycaemic control reduces length of
some Randomized Controlled Trials (RCT)
hospital stay, risk of multi-organ failure and
conducted among non-critically ill patients with
systemic infections. In addition, short term and
diabetes have reported that treatment with a Di-
long-term mortality rates were also decreased
Peptidyl Peptidase-4 inhibitors (DPP-4i) alone or
among patients with diabetes if blood sugar is well
in combination with basal insulin results in similar
controlled [5-7].
glycaemic control with less risk of hypoglycaemia
The commonest cause of hospitalization in
than BBR [6,10].
elderly was related to circulatory disorders, it was
DPP-4i are attractive drugs to be used as they
estimated that they represent about 28.4% of all
act by stimulating insulin and inhibiting glucagon -
hospital stays for elderly. Respiratory disorders
in a glucose dependent manner- with low risk to
were the second most common cause, representing
develop attacks of hypoglycaemia. Furthermore,
about 14.9%. Musculoskeletal and digestive
they are weight neutral and don't produce
disorders about 10.8% and 10.7%, respectively.
hemodynamic changes like Sodium Glucose Co-
Patients with nervous system disorders accounted
Transporter 2 inhibitors (SGLT2i) and they have
for 8% of all hospitalizations within this
no risk to develop euglycemic ketosis [11].
364
Received: 20/7/2022
Accepted: 22/9/2022
c:\work\Jor\vol901_53
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 372-378
Bone Mineral Density and Bone Markers in Juvenile Idiopathic Arthritis Patients
Samar G. Soliman1, Alaa A. Labeeb1, Reham S. El Zaiat2, Dalia A. Nofal*1, Dina S. Fotoh 1
Departments of 1Physical Medicine, Rheumatology and Rehabilitation and
2Clinical Pathology, Faculty of Medicine, Menoufia University, Egypt
*Corresponding author: Dalia Ahmed Nofal, Mobile: (+20)1007981362,
E-mail: doctor.dalia988@yahoo.co.uk, ORCID: 0000-0001-5673-2831
ABSTRACT
Introduction: One of the most prevalent adolescent chronic inflammatory illnesses, juvenile idiopathic arthritis (JIA),
is linked to decreased bone mineral density (BMD) and an increased risk of osteopenia and osteoporosis, which raises
the risk of fractures.
Objective: The aim of the current work was to determine the relationship between disease activity and BMD and bone
turnover markers (serum osteocalcin for bone production and C terminal telopeptide of type 1 collagen (CTX) for bone
resorption) in patients with juvenile idiopathic arthritis.
Materials and Methods: This study included 50 patients with JIA (female: male 20:30). These patients were diagnosed
with JIA according to the criteria of classification of the International League of Associations for Rheumatology [ILAR].
BMD was measured by Dual-energy X-ray absorptiometry (DEXA) of the lumbar spine using the Z-score. The results
were correlated with juvenile arthritis disease duration, disease activity, serum level of bone turnover markers, and
serum level of vitamin D. Clinical disease activity was evaluated by juvenile arthritis disease activity score (JADAS-
27).
Results: There was a significant negative correlation between BMD (DEXA Z-score) and disease activity (P-value
<0.001), bone turnover markers (P-value <0.001), and duration of JIA (P-value <0.05). There was a significant
difference between vitamin D level and DEXA Z-score; DEXA Z-score was lower in vitamin D deficient patients.
Conclusions: Patients with JIA who have a more active condition are more likely to develop osteopenia and
osteoporosis. Osteoporosis incidence may be decreased, and bone health may be improved with timely and effective
JIA treatment and disease activity control.
Keywords: BMD, Bone turnover markers, Osteoporosis, Juvenile idiopathic arthritis.
INTRODUCTION
A child's formative years are crucial for
The most accurate way to quantify BMD in
developing a robust musculoskeletal system. Genetic
children is using dual-energy X-ray absorptiometry
predisposition, organ function, chronic systemic
(DEXA) of the lumbar spine using the Z-score. As bone
illnesses, drug use, muscle abnormalities, and metabolic
density fluctuates with age, Z-score rather than T-score,
disorders are all known to affect bone structure and
which is often utilized in adults, is employed in the
quality [1]. One of the most prevalent chronic
pediatric population, and a Z score of -2 SD is
inflammatory illnesses affecting children and teenagers
considered osteoporosis [7]. Bone remodeling processes
under the age of 16 is juvenile idiopathic arthritis (JIA)
in terms of bone production and resorption can be
[2]. Both direct and indirect processes may prevent bone
detected using bone turnover markers [7]. The aim of the
accretion in JIA patients, as they do in other kids with
current work was to determine the relationship between
chronic disorders [3]. Reduced BMD in JIA patients is
disease activity and BMD and bone turnover markers
caused by the disease itself as well as a number of other
(serum osteocalcin for bone production and C terminal
variables, including limited physical activity, impaired
telopeptide of type 1 collagen (CTX) for bone
joint motility [4], delayed pubertal development,
resorption) in patients with juvenile idiopathic arthritis.
malnutrition, early onset of JIA, and JIA medications [5].
Reduced BMD is linked to a higher risk of osteopenia
PATIENTS AND METHODS
and osteoporosis, both of which raise the possibility of
This observational cross-sectional study included 50
fracture [6].
patients diagnosed and assessed clinically as JIA. They
According to the WHO [7], osteoporosis develops
were randomly recruited from the Internal Medicine,
when the amount of bone resorbed exceeds the amount
Physical Medicine, Rheumatology, and Rehabilitation
of newly generated bone, resulting in a net loss of bone
Clinics, Menoufia University Hospitals during the years
mass.
2020-2022.
Increasing awareness among pediatricians to
Patients were diagnosed with JIA according to the
identify risk factors and the clinical conditions or
criteria of classification of the International League of
diseases that could lead to the development of
Associations for Rheumatology [ILAR] [8], with a
osteoporosis made their screen for the possibility of
disease duration of more than one year, all patients are
asymptomatic
osteoporosis
in
children
with
under medical treatment for JIA.
rheumatological disease [7].
372
Received: 7/10/2022
Accepted: 7/12/2022
c:\work\Jor\vol901_54
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 379-385
Effects of Nano-Lipid Prostaglandin F2 on Synchronization
Buthina A. Abdullaha1 , Mohanad A. Al-Bayati2
1,2 Physiology and Pharmacology Department / Veterinary Medicine Collage, University of Baghdad/ Iraq.
Corresponding author: Buthina A.Abdullaha, Mobile: 09647701715129, E-Mail: buthinahameed@tu.edu.iq
ABSTRACT
Background: By modulating the estrous cycle, numerous oestrus-inducing or synchronising therapeutic hormones and
medicines are accessible for pharmacological use, allowing for rapid onset of estrus in the majority of animals.
Objective: The purpose of this research is to evaluate the efficacy of Nano-Lipid containing prostaglandin F2
nanotechnology in synchronising the estrous cycle.
Material and Methods: The strategy to induce and synchronise estrus75 in 4- to 8-week-old female mice was tested in an
animal investigation to establish its efficacy across three treatment groups: control, conventional, and SNLPGF2. The first
group received a saline injection as a control, the second group received conventional hormone injections at 5, 10, 15, 20,
and 25 IU g/kg body weight (I.P. ), and the third group received SNL PGF2 hormone injections at 5, 10, 15, 20, and 25 IU
g/kg body weight I.M.
Results: Nano-lipid Size The PGF2 ranged in length from 50 to 166.6 nm. whereas SNL PgF2 trapping efficiency is 84.11
(SD 5.55). As expected, autolysis and a rise in the estrus phase and an increase in the amount of estrogen were responsible
for the greatest degree of synchronisation in the group that received large doses of nano-treatment.
Conclusion: results of this research demonstrate that Prostaglandin F2 f Nano-lipid has a high efficiency for synchronising
the estrous cycle..
Keywords: Synchronization, Estrus cycle, Nano-Lipid, Prostaglandin F2.
INTRODUCTION
The cycle of estrous indicates the cycle of
(9,8). SLNs are solid lipids (e.g) triglycerides, complex
reproductive. Similar to the reproductive cycle in humans,
mixtures of glycerides or waxes) and stabilized by
the estrous cycle consists of four phases, namely,
surfactants (10).
proestrus, estrus, mesentery, and remission, and lasts for
The study was aimed at the reformulation and
4 to 5 days (1). both LH and FSH govern the estrous cycle
optimization of PGF2 based on the Nanostructured lipid
(2). There are two distinct times in a menstrual cycle: the
carriers' improved protocol of the estrous cycle
luteal and the follicular phases. (3).
synchronization
The luteal phase is the period following ovulation
when the corpus luteum (CL), while the follicular phase
MATERIAL AND METHODS
is the period following the demise of the corpus luteum
Preparation of Nano-Lipid PGF2
until ovulation (often further designated as pro-oestrus
Nano lipid was prepared by solvent diffusion method;
and oestrus), luteolysis by PGF2 (4). PGF2 is the
the formulation consisted.
treatment of choice to induce estrus by analyzing lutein
body profile (5). The use of PGF2 is one of the protocol
The lipid phase was comprised of two forms:
methods for synchronizing estrus by shortening the luteal
Lipid form: The lipid status formed by Stearic acid
phase (6).
100 mg dissolved by glycerine monostearate 100 mg
The synchronization of estrus allows the
and dispersing 800 rpm with Castor oil 2 ml to form
offspring to be increased, due to its inhibitory effect on
lipid dispersion by vortex 1500 rpm for 30 minutes.
the reproductive cycle and without dependence on the
season. It also unifies the estrus period. Hormonal
Dissolving form: At 800 rpm for 30 minutes, we
products are used in the synchronization of estrus for
loaded and disseminated the necessary quantity of
natural mating or artificial insemination, which further
hormones into the developing lipid phase and then
improves the reproductive performance of animals.
dissolved it in 100 mg of phosphatic acid. After
The use of prostaglandins is an alternative
adding the dissolved form to the lipid form and
method for controlling reproduction, which eliminates
mixing at 800 rpm for 1 hour, the mixture is chilled
corpus lutum and leads to a later follicular phase with
overnight at 8 °C before being utilised. You should
ovulation (7). Nanotechnology is a drug delivery system
stir for 30 minutes at 800 rpm before using (11). After
that can increase drug permeability by increasing their
collecting the supernatant, it was filtered via
solubility. As well as increasing issues of premature
membrane filters measuring 0.2 m. UV-Absorbance
removal associated with small particles, regenerative
spectrophotometer readings of supernatants and SNL
medicine will play a major role in treatment in the future
were used to detect the hormone.
379
Received: 20/7/2022
Accepted: 22/9/2022
c:\work\Jor\vol901_55
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 386-392
Serum Sphingosine 1-Phosphate as a Biomarker for
Post-Stroke Cognitive Impairment
Aya Shokry1, Ghada Saed Abdel Azim2, Sarah Younes Abozaid3, Marwa Abdellah Osman*2
Department of 1Neurology, Stroke Unit, Shebin El Koum Teaching Hospital,
General Organization for Teaching Hospitals and Institutes, Egypt
Departments of 2Neurology and 3Clinical Pathology, Faculty of Medicine for Girls, Al-Azhar University, Egypt
*Corresponding Author: Marwa Abdellah Osman, Mobile: (+20)01000726854, Email: drmarwaosman@gmail.com
ABSTRACT
Background: Stroke is a main cause of disability. Impaired cognition is an important aspect for stroke survivors. The
discovery of laboratory biomarkers for post stroke cognitive impairment (PSCI) may help identification of those who
are at risk of cognitive impairment and application of suitable therapeutic regimens.
Objective: This study aimed to measure S1P serum levels in a group of patients with severe ischemic stroke at admission
and to determine if they are associated with post stroke cognitive state.
Patients and Methods: The study has been applied on sixty patients who had acute ischemic stroke in addition to 40
apparently healthy. The mean of age and gender in subjects and controls were matched. Serum sphingosine -1 phosphate
(S1P) levels were analyzed by ELISA technique for all patients within 72 hours of admission and for healthy controls.
The severity of the stroke has been evaluated based on the scale of the National Institute of Health Stroke (NIHSS).
Patients also underwent cognitive assessment using Montreal Cognitive Assessment (MoCA) at admission and after 3
months.
Results: The level of serum S1P was apparently reduced in acute stroke patients by comparing with the healthy controls
(p< 0.001). Furthermore, the decreased levels of the S1P serum were obviously with more disease severity as measured
by high NIHSS score at admission and with more post stroke cognitive impairment as assessed by MoCA scale three
months later after stroke onset.
Conclusions: The study came up with key findings that reported a clear step-down in the levels of serum S1P in the
patients with acute stroke as compared to the healthy control and the same obvious reduction in S1P levels in cognitive
impairment patients as compared to those with non-cognitive impairment.
Keywords: Post-stroke cognitive impairment, Sphingosine-1-phosphate, Montreal cognitive assessment scale.
INTRODUCTION
give us better understanding of the pathophysiological
PSCI is common among stroke survivors.
mechanisms of the disease (4).
Previous studies identified that prevalence of PSCI is
Sphingosine 1- phosphate (S1P) is a lipid
53.4% within 1.5 years of stroke (1). Many cognitive
metabolite that mediates several physiological
domains are affected in PSCI; of these, impaired
processes, of which vascular endothelial cell function,
functions like attention appear to be the most prevalent.
coagulation thrombosis, angiogenesis and inflammation
Cognitive deterioration is usually obvious immediately
(4). S1P is a pleiotropic lipid mediator. Several studies
after stroke but most of these deficits resolve during the
demonstrated that endothelial cells, thrombocytes,
former recovery period. Nevertheless, longitudinal
neutrophils, macrophages and erythrocytes are the main
studies have demonstrated that long term-prevalence of
sources of S1P in blood (5).
impaired cognitive after stroke may be as high as 30-
About 50% of S1P in plasma is bound to high-
50% at 5 years (2). Cognitive impairment results in poor
density lipoprotein cholesterol (HDL-C), while about
long-term consequences on the daily activities and
40% is associated with albumin. S1P is a ligand of five
quality of life (QOL) and is associated with remote
G protein coupled cell surface receptors, S1PR1
morbidity and disability. Therefore, finding a way to
S1PR5. These receptors are represented in different
help in former detection and effective treatment for
systems
involving
the
immune,
respiratory,
PSCI has become one of the priorities of modern
cardiovascular, hepatic, and neurological systems (6). By
neurological rehabilitation (3).
binding with different receptor subtypes, S1P regulates
Detection of post stroke cognitive impairment
many physiological and pathological functions, such as
depends basically on clinical manifestations,
blood flow, blood pressure, heart rate, vascular
neuropsychological
testing
and
neuroimaging.
endothelial
function,
atherosclerosis,
However, these methods depend on the cooperation of
coagulation/thrombosis, and inflammatory responses,
patients and are not accurate enough for former
all of which play important roles in the pathogenesis and
diagnosis of post stroke cognitive impairment.
progression of stroke (4). In addition, S1P is shown to
Therefore, the identification of objective former
execute various functions in the cells of the central
biomarkers for PSCI would be of significant clinical
nervous system, such as differentiation, survival and
value in supporting the ability of physicians to tailor
excitability of neurons, activation of astrocyte-mediated
treatment regimens and improve outcome of PSCI, and
neuroinflammation, and processing of amyloid
precursor protein (7). Recently, serum S1P was found to
386
Received: 29/9/2022
Accepted: 1/12/2022
TF_Template_Word_Windows_2016
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 393-400
Pediatric COVID-19 Vaccine Refusal among Egyptian Parents:
An Online Survey Study
Hend Magdy Mohamed Gomaa* & Shymaa Mamdouh Mohamed Abdu
Public health and Community medicine department, Faculty of medicine, Mansoura University, Mansoura, Egypt
Corresponding Author: Hend Magdy Mohamed Gomaa, Email: hendmagdy86@hotmail.com,
Mobile:00201009780105
ABSTRACT
Background: Because COVID-19 pandemic is still ongoing, it is critical to immunize the majority of people, including
children, in order to achieve herd immunity.
Objective: The study aimed to estimate prevalence of pediatric COVID-19 vaccine refusal among parents and to explore
factors affecting it.
Methods: An online cross-sectional survey of 189 parents was conducted. Data were collected using a pre-structured
questionnaire about parents' socio-demographic characteristics, COVID-19 knowledge, level of concern about
reinfection, parents' willingness to vaccinate their children, and the importance of vaccine to their own and community
health. To identify predictors of vaccine refusal, binary logistic regression was used.
Results: The majority of parents (61.9%) refused the pediatric COVID-19 vaccine. Binary logistic regression analysis
showed that male parents (AOR= 10.18,95), those tested negative (AOR=26.27), those not worried from reinfection
(AOR= 15.23), those felt anxious more than half the days (AOR=10.64), nearly every day (AOR= 15) and those who
thought that the vaccine was not important for their own health (AOR=11.93) and for protecting health of other people
(AOR=4.05) were significantly more likely to refuse the pediatric COVID-19 vaccine. 73.5% and 63.2% of parents had
fear of vaccine side effects and thought that vaccine isn't effective, respectively.
Conclusion: Pediatric COVID-19 vaccines are opposed by two-thirds of parents. Fear of vaccine side effects and belief
that the vaccine is not effective are the most common reasons for vaccine rejection. As a result, health education for
those parents and future longitudinal studies exploring the factors influencing parents' refusal of the COVID-19 vaccine
are recommended.
Keywords: COVID-19 vaccines, Children, parents.
INTRODUCTION
spread via social media channels (9), that is exacerbated
On March 11, 2020, the World Health
by widespread vaccine misinformation, which is
Organization (WHO) declared COVID-19 a pandemic
already very high (10).
and declared a global health emergency (1). The quick
The difficulty for a COVID-19 vaccine is that its
licensing of COVID-19 vaccinations serves as an
fast development contributed to the perception that the
essential preventative step against the pandemic with
vaccine hasn't been thoroughly vetted for safety and
unabated increase in new cases, achieve herd immunity,
efficacy, which is why the WHO now considers it to be
and avoid hospitalization and death. (2, 3). COVID-19
a severe global health hazard (11). Mild symptoms, few
vaccine trials illustrated encouraging results as regards
hospitalizations, and lower mortality rates among
safety and production of a good immune response and
children than adults may all contribute to hesitation in
shows effectiveness in disease control (4, 5). To combat
administering vaccines to younger individuals (12). As a
the pandemic, good awareness of vaccination needs to
result, 33.3% of Egyptians had received all
be done. The COVAX initiative was implemented
recommended vaccinations as of May 28, 2022(6).
among lower-income countries to make faster and more
Despite the Egyptian government's approval of Pfizer's
equitable distribution of the vaccines with the following
Covid-19 vaccination for youngsters aged 12 to 15,
achievements; 65.8% of the world population had
many families were still reluctant to vaccinate both
received at least one dose of a COVID-19 vaccine, of
themselves and their children (13). There are few studies
them 16.2% of people in low-income countries (6).
looking at how well the COVID-19 vaccine is received
With rates of uptake among the community
by children, particularly in low- and middle-income
enhancing the success of the immunization campaign,
countries (LMICs), despite the fact that there is a
more worry has been created over the expansion of
significant amount of research on adults' uptake of the
COVID-19 vaccination to youngsters. (7) . Some people
COVID-19 immunization (14, 15). The first study to use
are less confident in national safety monitoring systems
an online survey to highlight this crucial subject comes
due to possible side effects of vaccination, which cause
from Egypt.
them to put off getting vaccinated, delay getting
vaccinated, and strongly oppose vaccination. Younger
SUBJECTS AND METHODS
adults provide a challenge since they are less clinically
A descriptive cross-sectional study with analytical
impacted and may believe that receiving the COVID-19
components that was carried out through online survey
vaccine has less utility (8). Additionally, false
on accessible parents through year 2022.
information about the COVID-19 vaccine has been
393
Received: 20/9/2022
Accepted: 22/12/2022
c:\work\Jor\vol901_57
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 401-406
The Correlation Study between Rheumatoid Arthritis and
Obesity in Babylon Province
Karrar Salih Mahdi1, Duha Mahdi Hussein1, Mohammed A. Dabbi2, Mustafa Jawad Al-Imari1,
Raghad Obead AbdulAL-Abass2, Rusul Hamed Obaid4, Mohammed Hayder Hamad1,
Saafa Abaas Abd.Al-Kahdum1, Sarah Kamil Abbood1 and Hadi Sajid Abdulabbas3
1Medical Laboratories Techniques Department and 2Nursing Department, Al-Mustaqbal University College,
Babylon, Iraq, 3Continuous Education Department, Faculty of Dentistry, University of Al-Ameed, Karbala,
Iraq, 4No affilation
Corresponding author: Karrar a
S lih Mahdi, Karrar.salih@uomus.edu.iq / https://orcid.org/0000-0002 4
- 717-615 ,
6
Moblile : 009647807208910
ABSTRACT
Background: The prevalence of obesity has risen dramatically in recent years. History of obesity is a significant risk
factor for the development of rheumatoid arthritis (RA).
Objective: This study aimed to survy about obesity as a major threat for public health and attachment with other disease
such as RA, and because several research refer to association to each other in differnet patients around the world.
Subjects and Methods: It included 64 serum samples, classified as 16 from obese patients, 16 from rheumatoid patients,
16 from patients with both rheumatoid arthritis and obesity, and 16 from healthy individuals. All of these were recruited
between October 2021 and August 2022, from different government hospital laboratory and private labs in Babylon
City.
Results: The results revealed significant differences (P>0.05) between control group and group of patients who had
rheumatoid and obesity regarding the level of rheumatoid factor (RF), also showed positive correlation between body
mass BMI and rheumatoid factor in the group of patients who had rheumatoid and obesity, but it revealed negative
correlation between body mass index and rheumatoid factor in the group of patients who had obesity.
Conclusion: Rehumatoid factor (RF) doesn't make important role in the obesity, and there is no association between
rehumatoid arthritis and body mass index.
Keywords: Rheumatoid arthritis, Obesity, BMI.
INTRODUCTION
overweight is strongly linked to developing rheumatoid
The prevalence of obesity is quickly increasing,
arthritis (RA), perhaps because of the central role
making it a significant public health concern in many
obesity plays in the obesity of autoimmune and
nations throughout the world(1). Obesity and excess
inflammation conditions(1) .
weight significantly increases the danger of developing
Inflammation and hyperplasia of the synovial
several serious ailments, including diabetes, heart
membrane are the hallmarks of the chronic, generalized
disease, and cancer. They have recently begun to affect
autoimmune illness known as rheumatoid arthritis
emerging nations due to shifting dietary and physical
(RA). The degree of inflammation is connected with the
activity norms and rising fast food demand(2).
progression of structural disruption, which results in
The WHO (World Health Organization) defines
disability, musculoskeletal deformity, and a decrease in
overweight and obesity as abnormal or excessive fat
life expectancy(6).
accumulation that might have negative health
Obesity may start and maintain a low-grade systemic
consequences. When a child's body mass index (BMI)
inflammatory milieu that can exacerbate autoimmune
is more than one standard deviation over the recognized
diseases and the comorbidities that go along with them.
median in child development patterns, the youngster is
Autoimmunity has been observed to be aggravated by
considered overweight. In contrast, obesity is defined as
metabolic alterations and inflammatory substances
more than two standard deviations above the median.
generated by adipose tissue, which predisposes the
The intricacy of obesity stems from its "multi-systemic
patient to cardiovascular disease (CVD) and metabolic
character," which makes it challenging to treat(3). The
comorbidities(7).
prevalence of overweight-obesity (BMI > 25 kg/m2)
Cutoff points for body mass index (BMI) show
was 39% in 2016 across adults aged 18 and older, while
substantial variation in the prevalence of obesity in RA.
the prevalence of obesity (BMI > 30 kg/m2) was 13%
Increased inflammatory activity, as measured by the
(4).
number of tenders and swollen joints, was linked to
The risk of hypertension, hyperlipidemia, and diabetes
being overweight or obese. Most measures of body fats
mellitus was shown to be higher in individuals with both
mass were found to be positively correlated with the
central obesity and compound obesity, as reported by
degree to which joints were swollen. Routine treatment
Zhang et al.(5). Another research found that being
for RA patients must involve assessing and working to
401
Received: 5/9/2022
Accepted: 1/12/2022
Liver Abscess
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 407-411
Gastric Staple Line Leaks After Laparoscopic Sleeve Gastrectomy,
Endoscopic Stent Insertion Versus Surgical Intervention Treatment
Yasser Baz1, Mohamed Abdelaal Mohamed2*, Mohammed M. Ezzat1
1 Department of General Surgery, Faculty of Medicine, Helwan University, Egypt
2 Department of General Surgery, Faculty of Medicine, 6th October University, Egypt
*Corresponding author: Mohamed Abdelaal Mohamed, Mobile: (+20) 01284500500,
E-Mail: Mohamed01284500500@gmail.com
ABSTRACT
Background: Endoscopic stenting (ES) provides comfortable management of Gastric staple line leaks (GSLL); it is less
invasive than conventional surgery. Objective: The aim of the current study is to assess the efficacy of endoscopic
stenting versus surgical intervention in treating gastric stable line leakage following laparoscopic sleeve gastrectomy
(LSG). Patients and methods: In Helwan University Hospitals, 40 patients had GSLL post LSG between January 2018
and August 2022. We proceeded our management to either: ES placement (Group A) or surgical management (SM)
(Group B), 2o in each group.
Results: Regarding postoperative complications, there is a significant statistical difference regarding wound infection,
but no significant difference regarding chest infection, DVT, subphrenic abscess, severe vomiting, GERD, failure of
Roux-en-Y, stent migration, or stricture. There is a non-significant association between the type of participant
management and the outcomes of the intervention. However, there was a statistically significant association between
the type of participant management and the interval period between GSLL closure and its control (P value <0.001) and
patients' hospital stay (P= 0.001), as participants who underwent ES spent less time in the hospital. Conclusion:
Management of post-LSG leakage with ES is advocated as it is a minimally invasive technique that effectively manages
GSLL and has a comparable control success rate to definitive surgical treatment with a shorter hospital stay, early return
of function, fewer complications, and a well-tolerable safety profile. In stable patients, ES should be recommended as
first-line therapy.
Keywords: Gastric staple line leaks, Endoscopic stent insertion, Laparoscopic sleeve gastrectomy.
INTRODUCTION
However, the outcome reports of ES are incomplete,
Obesity is a growing cause of death and has been
and the procedural aspects are not clearly defined (6).
linked to at least sixty chronic noncommunicable
Successful GSLL management requires rapid
diseases, including heart disease, hypertension,
leakage identification and effective source control.
cerebrovascular stroke, type 2 diabetes mellitus, sleep
Nevertheless, several treatment strategies have been
apnea, cancer, and chronic renal disease (1,2).
proposed but no definitive management regimen has
Since its initial description in 1988, laparoscopic
been recognized, a stepwise management escalation
sleeve gastrectomy (LSG) has gained popularity and is
approach is essential to improve patients outcomes (12-
now the most commonly performed bariatric surgery in
14). The lack of well-designed studies that included
the world because it is faster, easier, and more effective
heterogeneous
patient
cohorts
and
lacked
at addressing comorbidities and promoting weight loss
standardization is a noteworthy obstacle to
(3-11). However, the operation is not without
determining the best treatment for GSLL. Because of
complications. In reality, the most common and
this, there is no solid data basis that can be relied upon
dangerous complication after LSG, gastric staple line
to definitively determine the optimal course of
leak (GSLL), occurs in up to 5% of patients, causing
treatment to take in order to achieve the best
significant morbidity, mortality, and additional
management results (8,15).
hospitalization, outpatient therapy, and follow-up costs
The study's objective was to assess the efficacy
(4, 8, 11).
of endoscopic stenting versus surgical intervention in
The following treatment challenges for GSLL that
treating gastric stable line leakage following LSG.
are influenced by the patient's clinical condition
include; Initial conservative management followed by
PATIENTS AND METHODS
conventional surgical treatment of GSLL entails prompt
In Helwan University Hospitals, 40 patients had
reintervention to patch or close the site of the defect, but
GSLL post LSG between January 2018 and August
these procedures are accompanied by high patient
2022. We proceeded our management to either: ES
mortality and morbidity (5,6).
placement (Group A) or surgical management (SM)
Endoscopic stenting (ES) provides comfortable
(Group B), 20 in each group.
management of GSLL; it is less invasive than
Inclusion criteria: The study involved patients
conventional surgery, aiming to cover or exclude the
operated with LSG and had a radiologically proven
leak site to divert gastric contents, allowing patients
GSLL.
early enteral nutrition, and allowing a temporary return
Exclusion criteria: Patient's not fit for general
to home if the patient's clinical condition is appropriate.
anesthesia or unwilling to participate in the study.
407
Received: 01/09/2022
Accepted: 02/11/2022
c:\work\Jor\vol901_59
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 412-420
Production and Characterization of Nanostructured -Lipid Carriers as
Hormones PGF2and PMSG
Buthina A. Abdullaha1, Mohanad A. Al-Bayati2
1,2 Physiology and Pharmacology Department, Veterinary Medicine Collage, University of Baghdad, Iraq.
Corresponding author: Buthina A.Abdullaha, Mobile: 09647701715129, E-Mail: buthinahameed@tu.edu.iq
ABSTRACT
Background: PGF2-PMSG is one of the hormones used to increase production and reproduction, but there are some side
effects regarding its use and the length of its effect. Thus, improvement of the action of hormones and reduction of their
side effects by reformulation and optimization of PGF2-PMSG based on the nano-lipid delivery system became the target.
Objective: This study aimed to reformulate and improve PGF2-PMSG based on the nano-lipid delivery system.
Materials and methods: In this study, Nano-Lipid Carriers (NLCs) contained fatty acids to obtain nanoparticles with small
particle sizes. The hormone Nano lipid was prepared by solvent diffusion method, and has the characters and properties of
Nano-lipid.
The results: The results were optimized nanoparticle has a size of Nano-lipid Carrying PGF2 range between 50-166.6
nm and Nano-lipid Carrying PMSG 85.7-300 nm. The entrapment efficiency of hormone SNL PMSG was 79.04 ± 4.96
and SNL PgF2 was 84.11 ± 5.55. The results of characterization for the SLNs under transmission electron microscopy
were generally round and uniform in shape. FTIR and XRD analyzers indicate that the hormone is properly laden within
the amorphous nanostructure. It also proved that Nano-lipid formula has high stability at pH and Osmo-tolerance. The Nano-
Lipid structure PGF2 and PMSG formulas were represented max 450 nm in UV-visible.
Conclusion: The present study showed that the Nanostructured -Lipid Carriers had the ability in producing high-efficiency
of PGF2 and PMSG hormones.
Keywords: Nano-lipid preparation, PGF2, PMSG.
INTRODUCTION
also increased the ability to incorporate drugs into Nano-
Nanotechnology is the branch of technology that is
carriers for rapid drug delivery that can be used in a wide
used in practical application (1). Nano-materials differ
variety of therapeutic goals (9).
from bulk materials in a number of ways, including their
Structure Nano-Lipid (SNL) has good chemical
high surface energy, extremely large surface area, and
stability, this is what the researchers confirm. It has
ability to customize their functions for varied applications
developed broad prospects for its use, and features of the
(2). Nano-delivery systems have the potency for
NLC structure that allow the inclusion of natural bioactive
simultaneous objective and diagnostic and therapeutic
lipids into the matrix of NLC that help creation of high-
action through nanotechnology-based delivery systems
performance drug carriers. Many drugs are available for
that have the potential to drug permeability, solubility,
stimulating as well as for superovulation such as
and early elimination issues associated with small
hormones and medicinal and pharmaceuticals for
molecules and biological materials (3, 4).
pharmacological use (10).
So targeted delivery systems and regenerative
The aim of the study was to reformulate and improve
medicine supported by nanotechnology have the
PGF2-PMSG based on the nano-lipid delivery system.
possibility to play a central role in future therapy (5, 6).
Nano-particles are classified according to their size,
MATERIAL AND METHOD
shape, and physical and chemical properties. There are
Preparation and standardization of Nano-Lipid
carbon nanoparticles, metallic nano-particles, ceramic
PGF2-PMSG
nano-particles, polymeric nanoparticles, and lipid
Nano lipid was prepared by solvent diffusion
nanoparticles (7). Lipid nanoparticles are generally
method (11). The lipid phase comprised of two forms:
spherical, with a diameter of 10 to 100 nm. It contains
lipophilic and soluble particles. Its structure consists of a
1-Lipid form: The lipid status formed by stearic acid 100
solid core made of lipids matrix, and by means of
mg dissolved by glycerin monostearate 100 mg and
surfactants and emulsifiers the outer core is stabilized (8).
dispersing 800 rpm with castor oil (2 ml) to form lipid
The rapid development of science regarding the ability to
dispersion by vortex 1500 rpm for 30 minutes.
produce nanoparticles of uniform shape, structure, and
size has revolutionized pharmaceutical science.
2-Dissolving form: The forming lipid phase was
With their size-dependent properties, nanoparticles will
dissolved in phosphatidic acid 100 mg and the amount of
offer the potential for new and advanced treatments. It
loaded and dispersed hormone requirements was 800 rpm
412
Received: 20/07/2022
Accepted: 22/09/2022
c:\work\Jor\vol901_60
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 421-432
Detection of Important Compounds from The Aerial Part of
Callistemon viminalis Plant Cultivated in Iraq
Anas Yasir Asaad1
1 Bc.S. Pharmacy, Department of Pharmacognosy, College of Pharmacy, University of Baghdad, Baghdad, Iraq
*Corresponding author: Anas Yasir Asaad, E-mail addresses: onos.yaser1200m@copharm.uobaghdad.edu.iq
Tel. no.: mobile; +9647730115700
ABSTRACT
Background: Medicinal plants are a generous source of our drugs and remedies, coming from their fabulous secondary
metabolites, which involve different classes such as alkaloids, glycosides, essential oils, phenolic compounds, and
steroids. Callistemon viminalis is a small tree cultivated in Iraq, that owns very interesting bioactive compounds
especially, essential oils, phenolic derivatives, and terpenoids.
Objective: To investigate the bioactive compounds from the aerial part of the Iraqi Callistemon viminalis plant.
Material and methods: The plant was extracted by Soxhlet apparatus and fractionated with solvents that differ in
polarity, the n-butanol and ethyl acetate fractions were applied to Liquid Chromatography-Tandem mass spectrometer,
while the hexane defatting extract was applied to Gas Chromatography-Mass spectrometer analysis to discover to
components of the plant.
Results: The results show the presence of many glycosides, flavonoids, terpenoids, and alkaloids like Kaempferol,
Astragalin, Quercitrin, Scutellarin alpha-Phellandrene, 3-Carene, (-)-Spathulenol and, Dihydroepinatalensine.
Conclusion: Callistemon viminalis aerial part involves diverse types of important that own important medical activity,
they are mostly flavonoids, phenolic derivatives, terpenoids, terpenes, and glycosides. Also, the study supports the
presence of powerful anti-inflammatory flavonoids and terpenoids that are involved in the traditional use of the plant in
the relief of tissue inflammations.
Keywords: medicinal plants, phenolic compounds, flavonoids, liquid chromatography.
INTRODUCTION
primarily involves essential oils as well as phenolic
Natural surround is always a very attractive
acids, phloroglucinol derivatives, tannins, flavonoids,
field to explore new treatments and remedies. The
and triterpenoids. Active molecules in plant extraction
plants are mostly revealed as the premier source for our
show exceptional applications in nanoparticle drug
drug discoveries. Deeply, when we take a look at the
manufacturing, medical solutions, and cosmetic
plant, we see the primary and the secondary
concepts (8,9).
metabolites, the primary metabolites are proteins,
Plant phenolic compounds are a very broad
sugars, fatty acids, and whatever plants need to grow,
class of secondary metabolites, which obtain more
they also act as a food source for both humans and
deliberation in the last years due to their high
animals. Secondary metabolites are what plants use to
occurrence in the plant kingdom in addition to their
survive in their environment, just like protection from
powerful antioxidant activity. Natural roles may be
insects; they are also considered to have the role of
diverse from securing the plant from predators to
appreciable pharmaceutical activity (1). Secondary
sensorial, structural, and reproductive functions.
metabolites are versatile in their structure and activity.
Chemically, plant phenolics involve an aromatic ring
Also, many biosynthetic pathways give rise to different
bonded with at least one hydroxyl group that is
natural products. Alkaloids, glycosides, terpenes,
generally derived from the shikimic acid pathway and
essential oils, and phenolics are some examples of these
acetate coenzyme A or its active forms. With their
hopeful bioactive compounds (1,2).
obvious radical scavenging ability, they play an
Ancient history reveals many medicinal plants
important role in protection from degenerative diseases
that were used by people, the oldest evidence was a
as well as the strong ability to suppress tumor formation
Sumerian clay slab found in Nagpur about 5000 years
and inflammatory response (10).
in old. It involved 12 preparations from 250 different
plants which include poppy and henbane alkaloids (3).
MATERIAL AND METHODS
Also, Indian Vedas holy books have mentioned
Ethical approval: The study was approved by the
numerous treatments from plants that grow in nature (4).
Ethics Board of Baghdad University.
Even in this time we use treatments with plant parts like
ginseng and camphor written in "Pen T'Sao", the
Plant material:
Chinese book on roots and grasses, that listed 365 drugs
Callistemon viminalis aerial part was collected
from plants and belonged to 2500 BC (5,6).
from Baghdad city on separate periods extended from
Medicinal plant products not only can treat and
the end of October 2021 AD to February 2022 AD. The
prevent diseases but also give template structures that
plant was identified and authenticated by the
can be modified and developed as active molecules
Department of Biology / College of the Science /
against existing illnesses (7). Callistemon viminalis
University of Baghdad. The plant component was
421
Received: 04/09/2022
Accepted: 01/12/2022
c:\work\Jor\vol901_61
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 433-445
Protective Effects of Alfa Lipoic Acid on Amiodarone Induced
Hypothyroidism in Adult Male Albino Rats
(A Biochemical, Histopathological and Immunohistochemical Study)
Amal Mahmoud Elshazly1*,Bodour Baiomy1,Yasmeen Mohammed Ismail El Sayed2 ,
Asmaa Y.A. Hussein 3*, Neama Mahmoud Taha 4, and Ali Mohamed Ali 1.
1Department of Anatomy and Embryology,2Department of Clinical Pharmacology,
3Department of Forensic Medicine & Clinical Toxicology, Faculty of Medicine, Benha University, Egypt
4 Physiology Department, Umm Al-Qura University, KSA.
Corresponding author: Amal Elshazly, Mobile:(+20)1222924128, Email: amal.elshazly79@yahoo.com
https://orcid.org/0000-00031051-7241
ABSTRACT
Background: Amiodarone (AMD) is a highly effective antiarrhythmic agent. Its utilization is associated with toxic
effects on thyroid gland. The aim of this research to evaluate the AMD chronic administration potential toxic impact on
the thyroid gland and evaluate Alfa lipoic acid ( LA) possible protective impact.
Materials and methods: 40 adult male albino rats were equally separated into 4 groups, group I (control) given 1ml
distilled water for 12 wks., group II (AMD tested group) received a single dose of 40 mg/kg /day AMD for 12 wks.
Group III (AMD+ -LA), where AMD was given as group II and a dose of 100 mg/kg of -LA for 12 weeks, group IV
received AMD in doses similar to group II, then the drug was withdrawn and the rats took no treatment for additional 4
weeks. All groups were sacrificed after 12 weeks except group IV after 16 weeks from the beginning of the experiment.
Results: In AMD treated group; the T3, T4 and catalase [CAT] serum levels were significantly reduced along with
significant elevation in TSH, IL6 and malondialdehyde [MDA] level, light microscopic examination of AMD group
showed cellular degeneration of follicles and colloid peripheral vacuolation along with strong positive immune reaction
for Ki-67 declared in AMD group as compared to those of other groups. Additionally, electron microscopic studies
supported these results. Conclusion: Chronic administration of AMD induced thyroid damage which could be improved
by Co-supplementation of -LA.
Keywords: Amiodarone, Alfa Lipoic Acid, thyroid gland, hypothyroidism.
INTRODUCTION
these factors include age, sex, the dose and duration of
Being a benzofuran derivative, amiodarone
AMD therapy, absence or existence of underlying
(AMD) is a class III effective antiarrhythmic agent with
thyroid disease and the level of body iodine. However,
non-competitive - and adrenergic blocker and
most studies attributed the potential ability of AMD
multichannel blocker properties. Due to its little
problems to the high iodine content of the drug; as every
negative inotropic impact, it is frequently utilized, even
AMD molecule contains 2 atoms of iodine making it
in heart failure cases (1,2).
closely similar to the structure of thyroid hormones (6,8).
The long-term administration of AMD may be
An adaptive blockade of additional thyroidal
accompanied with direct and/or indirect organ
iodide uptake and subsequent production of thyroid
toxicities,
including
hepatotoxicity,
thyroid
hormone, known as the effect Wolff-Chaikoff occurs
dysfunction, corneal microdeposits and lung toxicity
during AMD therapy, due to the significant amount of
(3,4). AMD has numerous impacts on physiology of the
iodide liberated from its metabolism. Although the
thyroid and peripheral metabolism of thyroid hormones.
effect is noticeable through the first 2 wks. of treatment,
In fact, greater than 50% of patients receiving prolonged
normal thyroid hormone production is restored due to
treatment of AMD have abnormal thyroid function test
continued exposure to iodine. As a result of failure of
results. The pathogenesis of AMD is multifactorial, and
thyroid to escape the Wolff-Chaikoff effect,
may be related to its lipophilic nature, presence of 2
amiodarone-induced hypothyroidism (AIH) is induced.
iodine atoms, a high propensity for deposition in various
Because of the prolonged blockage of intrathyroidal
tissues, high bio-distribution potential, and long half-
iodine organification, thyroid hormone production is
life in plasma (1330 days) (5).
hindered (9).
Several clinical and experimental studies
Characteristic destructive thyroiditis associated
revealed many thyroidal disturbances associated with
with AMD chronic administrations occurs due to its
AMD therapy such as hypothyroidism, thyroiditis,
direct toxic effect with its iodide content that induced
follicular cell hyperplasia & follicular cell tumors. Long
oxidative stress, characterized by generation of reactive
term administration of AMD is highly affecting thyroid
oxygen species (ROS) and a significant rise in the levels
hormones metabolism and causes direct toxic effect on
of lipid peroxide on normal thyroid cells and follicles
the thyroid (6,7).
with subsequent thyroid gland degeneration. Also,
Varying degrees of thyroid gland abnormalities
AMD was found to be concentrated in the thyroid, and
were detected in response to AMD treatment related to
when its concentration exceed certain limit, damage and
certain factors in each specific case. Some examples of
destruction occurs in thyroid cells. This results in the
433
Received: 05/09/2022
Accepted: 06/12/2022
c:\work\Jor\vol901_62
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 446-452
Study of Erythroferone Hormone in Children with Beta Thalassemia Major
Hend T. Elmazain1*, Rasha A. Elkholy1, Abd El-rahman M. Elmashad2, Sahar A. Hammodah1
Clinical Pathology Department1, Pediatrics and Neonates Department2,
Faculty of Medicine, Tanta University, Egypt
*Corresponding author: Hend Tawfik Elmazain, Mobile: 01115311874, E-mail: hendtawfik52@gmail.com
ABSTRACT
Background: Iron overload is a principal reason for morbidity and death in transfusion-dependent beta-thalassemia
cases. Erythroferrone hormone (ERFE), a member of tumor necrosis family- alpha (TNF-) superfamily produced by
erythroblasts and stimulated by endogenous or exogenous erythropoietin (EPO), Under these conditions, ERFE inhibits
the formation of hepcidin, restoring the functionality of ferro-portin, that is accountable for enhancing intestinal iron
absorption and mobilizing iron reserves. Objective: The aim of the currents study is to analyze the role of ERFE in
children suffering from beta thalassemia major.
Patients and methods: A prospective case-control study was conducted at Tanta University Hospital during the period
from March 2021 to November 2021. The study included 40 children previously diagnosed with beta thalassemia major,
and 40 healthy children matched in sex and age as a control group. Serum ERFE was calculated utilizing enzyme linked
immunosorbent assay (ELISA) technique. Results: Serum ERFE level was significant increase in the beta thalassemia
patients' group than control group. In the patients group, serum ERFE was higher in non spleenectomized patients, and
in patients receiving blood transfusion more than once/ month, also, ERFE was higher in those with serum ferritin >1000
ng/ml. There is significant positive correlation between ERFE level and serum levels of ferritin and transferrin saturation
(T.SAT %). Receiver Operating Characteristic (ROC) curve analysis demonstrated that ERFE level above 1.6 ng/ml is
the cutoff value indicating iron overload with high diagnostic efficacy. Conclusion: ERFE is a possible diagnostic tool
in predicting iron overload with sensitivity 95%, specificity 62 %, and accuracy 78%.
Keywords: Beta thalassemia major, Erythroferrone, Iron overload, case control study, Tanta University.
INTRODUCTION
Thalassemia is a heterogeneous hereditary
completely standardized, and because inter-laboratory
hemoglobinopathy
defined
by
globin
chain
variation is significant, the publicly available T.SAT
abnormalities and autosomal recessive inheritance.
percent is frequently used to infer the likelihood of
Homozygous or compound heterozygous formulae
higher concentrations of these two iron-toxic chemicals.
have a disturbance in the formation of - and non-globin
T.SAT percentage values should be interpreted with
chains, leading to inefficient erythropoiesis and a
caution during chelation therapy or inflammations (6).
decrease in normal hemoglobin A production (1).
Erythroferrone (ERFE) was suggested to be an
Iron overload is the primary cause for morbidity
erythroid hormone that FAM132B encodes a protein
and mortality in transfusion-dependent -thalassemia
that regulates iron metabolism in humans. It is the most
cases. As the body doesn't have action for excreting
important negative mechanism of hepcidin under
extra iron, iron accumulation leads to organ
stressing condition or inadequate erythropoiesis, being
malfunction, especially in the heart, liver, and the
formed by erythroid precursors in the bone marrow and
endocrinal system, if left untreated (2).
spleen under the control of renal erythropoietin (EPO)
The role of laboratory investigations in expecting
(7). Under these conditions, ERFE inhibits the formation
the incidence of tissue iron accumulation, as determined
of hepcidin, restoring the role of ferro-portin, that is
by measurement of hepatic iron content using biopsy or
accountable for enhancing the absorption of iron in the
noninvasive imaging techniques, was exhaustively
intestines and mobilising iron reserves. In settings
investigated. Some investigations have identified serum
needing an increase in erythropoietic activity, ERFE
ferritin as an acceptable prediction factor of the severity
could be reasonably seen as playing a crucial function
of iron overload, and its predictive value has been
in enhancing iron accessibility for haemoglobin
demonstrated in thalassemia and is connected with
production (8).
cardiac-related death (3). However, its ability to forecast
There are two components to the raised ERFE
iron accumulation has been deemed inadequate by other
synthesis because of anemia: as erythropoietic cells are
researchers. Moreover, its benefit was reduced because
activated by the effect of EPO, the number of erythroid
of being an acute phase reactant increasing in some
precursor cells increases. Second, each individual cell
concomitant conditions like inflammatory states,
in this population produces more ERFE. In anemias
hepatic disorder, rapid cell turnover, and deficiency in
accompanied by inefficient erythropoiesis, EPO
vitamin C (4,5).
dramatically expands and stimulates the erythroid
Transferrin saturation (T.SAT %), labile plasma
precursor population, but the majority of these cells do
iron (LPI), and non-transferrin-bound iron (NTBI) are
not produce mature erythrocytes. These deadend
shown indicators of iron toxicity risk. Though, since
erythroid precursors secrete elevated quantities of
NTBI and LPI assays aren't generally accessible or
ERFE, which persistently suppresses hepcidin and
446
Received: 05/09/2022
Accepted: 06/12/2022
c:\work\Jor\vol901_63
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 453-458
The X-Ray Repair Cross Complementing 1(XRCC1) Rs25487 Variation and
Susceptibility to Cirrhosis in Patients with Chronic Hepatitis C Virus
Dalia Hamed1, Badawy El Kholy1, Hadeel Gamal El Deen2,
Samar Mahmoud Mohammed Momen1, Nora Mahmoud Selim1*
Clinical & Chemical Pathology1Endemic Medicine2, Faculty of Medicine, Cairo University
Corresponding author: Nora Mahmoud Selim, Tel: 01100227772, Email: nora.selim@hotmail.com
ABSTRACT
Background: Around 130170 million individuals are thought to be affected with the hepatitis C virus (HCV), which
is a viral pandemic and the leading cause of persistent liver illness. The frequency of HCV infections is greatest in
Egypt, where more than 10% of the general population is affected. Objective: The purpose of the current study was to
confirm any potential associations between cirrhosis and the XRCC1 rs25487 variant in chronic HCV patients.
Patients and methods: A fibroscan was conducted on 80 HCV +ve patients and 40 control participants for a total of
120 people to determine the extent of hepatic fibrosis. Real-time PCR was used to examine the SNP genotyping in the
XRCC1 gene (rs25487). Results: There were no substantial variation in the prevalence of different genotypes in XRCC1
A > G (GG and AG) between non cirrhotic and cirrhotic in chronic HCV Egyptian patients. Conclusion: By comparing
the incidence of the various genotypes (AA, AG, and GG) in the analyzed groups, no clear pattern of relationship could
be seen (p=0.225). (P = 0.410) There was no distinguishable pattern of connection between the AA genotype and the
other genotypes (GG and AG). Comparing the frequencies of the two alleles (A and G alleles) in the three groups under
study revealed no evidence of a connection.
Keywords: X-ray repair, rs25487 Variation, cirrhosis, chronic hepatitis C virus, case control study, Cairo University.
INTRODUCTION
PATIENTS AND METHODS
The hepatitis C virus is acknowledged as posing
Between August 2016 and November 2016, a case
a serious risk to public health worldwide. As per to the
control study including HCV patients at the Cairo
most current estimates of disease burden, seropositivity
University Center for Hepatic Fibrosis, Endemic
has climbed to 2.8% during the last 15 years, translating
Medicine Department, Kasr Al-Ainy Hospital, and age-
to more over 185 million infections globally (1).
and sex-matched healthy participants was conducted.
In 2008, Egypt had the largest proportion of HCV
A total 120 participants were recruited in the
infections in the world, with 10% of the population
present research, who were split into two groups; Group
having a chronic infection and 90% of patients having
I (Control Group) had 40
genotype 4 infections (2). With an overall projected 30%
healthy, age and sex matched controls with normal
fall in HCV occurrence in Egypt between 2008 and
liver biochemical profile, HCV Ab -ve and HBs Ag -ve.
2015, the seropositivity of HCV infection in that
Group II (Patient Group) had 80 HCV patients.
country has reduced to 6.3% among the population
Patient Group was split into groups depending on
under study in 2015 (3).
the degree of hepatic fibrosis found by fibroscan; Group
Hepatocellular carcinoma (HCC) and cirrhosis
IIa included 40 chronic HCV non cirrhotic patients (f0-
are two conditions that are mostly brought on by HCV
f2), and Group IIb included 40 chronic HCV cirrhotic
infection. HCC is more likely to occur in people with
patients (f3-f4).
liver cirrhosis than in those with less severe fibrosis (4).
A multi-protein complex called XRRC1, one of
Patient's Inclusion criteria:
: Patients diagnosed
the most important molecules in base excision
with chronic HCV (HCV Ab +ve > 6 months, male or
restoration,
joins
DNA
ligase
III,
DNA
female, and subsequently validated by PCR testing for
polymerase and poly (ADP-ribose) polymerase to fix
the existence of HCV RNA in blood) must be between
the single strand break brought on by the cleaving of the
the ages of 18 and 65.
DNA backbone at a basic site, which occurred in an
initial phase of the DNA restoration technique (5).
Patient's exclusion criteria: Combined HCV and
An A to G transition at codon 399 (exon 10) of
HBV (HBs Ag positive) and other causes of liver
the XRCC1 gene causes a shift from the amino acid
cirrhosis.
arginine (Arg) to the amino acid glycine (Gln) in the
XRCC1 protein (XRCC1 rs25487). The addition of Gln
Patients underwent the following:
may change the protein's function, making DNA repair
- History taking including, medical history and
less successful (6).
possible routes of acquiring HCV infection, as blood
The study's objective was to determine if there
transfusion, surgeries, dental care, needle pricks and
was any connection between the dispersion of the
tattoos.
XRCC1 rs25487 A > G variant in chronic HCV patients
- Clinical assessment including general examinations
from Egypt and hepatic cirrhosis.
especially jaundice, lower limb edema, and local
453
Received: 10/10/2022
Accepted: 10/12/2022
c:\work\Jor\vol901_64
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 459-464
Linear Analysis of ECG Data Variability to Assess The
Autonomic Nervous System in Two Different Body Positions
Amr Farhan1,2,3*, Aissam Lyazidi1,2, Said Elkettani4, Badreddine Labakoum1,2,
Mourad Rattal1,2, Azeddine Mouhsen1
1Hassan First University of Settat, Radiation-Matter Instrumentation Laboratory (RMI), Settat, Morocco.
2Hassan First University of Settat, Higher Institute of Health Sciences (ISSS), Laboratory of Health Sciences and
Technologies, Settat, Morocco.3Authority of Al-Thawra Hospital Taiz, Yemen
4Médecine Interne Libérale, Settat. Maroc
Corresponding author: Amr Farhan, Mobile: +212633280045, ORCID: 0000-0003-1492-3837, E-mail: a.farhan@uhp.ac.ma
ABSTRACT
Background: Heart rate variability (HRV), generated from an electrocardiogram (ECG), can be used to evaluate the
autonomic nervous system (ANS). Heart rate changes during different physical activities are due to changing
involuntary regulation. Objective: The main aim of the current study is to explore the ANS by analyzing linear HRV
parameters, so that clinicians can preliminarily explore ANS function using ECG analysis with their patients.
Patients and methods: A total of 15 student volunteers were recorded. Data was collected for 5 minutes for each
supine and standing position. The R-peak obtained from an ECG is used to assess the RR-peak, which is also required
for HRV analysis. Linear HRV parameters with different time-domain indices and frequency-domain indices are
interpreted in 2 body positions.
Results: We discovered that the RR interval is longer in the supine position than in the standing position (952.8±181.6
vs. 771.9±164, respectively; P<0.05), and that in comparison to supine position, when standing as opposed to when
lying down, the heart rate is higher (81.7±10.2 vs. 65.8±9.1, respectively; P<0.05), where the body is more relaxed.
This affects ANS, and stress index values, which are low before increasing in the standing position, starting in the
supine position (5.7±2.4 vs. 9.5±2.7, respectively; P<0.05).
Conclusion: We conclude that there is a relationship between HRV and the sympathetic system in different positions,
where when moving from supine to standing, the values of HRV changes (increases) and, therefore, the stress index
changes (increase) and, from this, we note the change (value increase) in ANS.
Keywords: Autonome Nervous System, Heart Rate Variability, Electrocardiogram, Heart Rate, Case series,
Morocco.
(5). External heart rate regulation regulates the RR
INTRODUCTION
intervals, which are the
Electrocardiogram (ECG) signals can be acquired
intervals between successive heartbeats (HR). HRV
by putting disposable electrodes on legs, arms, and
exhibits the heart's capacity to adapt to changing
chest skin surfaces (1). Electrical impulses from various
circumstances by quickly detecting and reacting to
areas of the heart are detected by these electrodes. The
stimuli (6). Additionally, HRV measurements enable the
heart's rhythm and heart rate are displayed on the ECG,
evaluation of nonlinear dynamic processes in the ANS
which might be irregular or constant (2).
and neurocardiac function brought on by interactions
Each participant's ECG signal pattern may change
between the heart and brain (7). There are several
over time as a result of body posture and physical
parameters used for RR interval time series analysis,
activity. By measuring heart rate variability (HRV), the
including time domain and frequency domain as the
variation in heart rate or period may indicate the
standard analysis for HRV by the European Society of
function of the autonomic nervous system (3).
Cardiology Parameters Task Force (8,9).
The parasympathetic nervous system (PNS),
In recent years, numerous studies have used HRV
generally known as the relaxation response, and the
as a suitable ANS modulation biomarker (10). Examine
sympathetic nervous system (SNS), sometimes referred
the ANS in different positions: supine, sitting, and then
to as the fight-or-flight reaction, respectively, make up
standing, Also, (6) supine and standing positions were
the autonomic nervous system (ANS). In response to a
used to investigate the ANS. The ANS regulates
stressful situation, such as the fight-or-flight response,
heartbeats through its SNS and PNS divisions. An
the body experiences physiological changes known as
increase in SNS activity or a decrease in PNS activity
stress. The hypothalamic-pituitary-adrenal axis is
causes heart acceleration. Conversely, slowed heartbeat
stimulated by the SNS mechanisms that generate stress
is a result of both high PNS activity and low SNS activity
and anxiety, and this increases the hypothalamic release
(11).
of corticotropin-releasing hormone. The adrenal gland
As stated by (12,13), the variability function of the
tissue is where corticotropin-releasing hormone enters
heartbeat enables an organism to adapt efficiently to both
to trigger the release of cortisol, the main hormone
internal and external demands. Additionally, a variety of
associated with stress (4). HRV is the term used to
elements, including genetic, environmental, and clinical
describe the variation in heartbeat frequency over time
circumstances, may affect an organism's patterns of
459
Received: 10/10/2022
Accepted: 10/12/2022
c:\work\Jor\vol901_65
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 465-470
Neck Masses as The First Presentation of Occult Papillary Thyroid Carcinoma: Case Series
Mohammed Salih Abedulla Ali 1, Layth Alharbawi 2*, Ziyad Ahmed Abed 3, Nazar M.T. Jawhar3
1. Dijlah University College of Medicine, Iraq. 2. Al Kitab University, Iraq.
3. Department of Pathology, Ninevah Medical College, Iraq.
*Corresponding author: Layth Al harbawi, Mobile: (+964)7722020117, Email: Laythqassid@yahoo.com,
Background: Papillary Thyroid Carcinoma (PTC) is the most common thyroid cancer. It can be found incidentally
during thyroidectomy or can present as an enlarged cervical lymph node which is difficult to be diagnosed unless
confirmed by ultrasonography and fine needle aspiration cytology (FNAC).
Objective: The aim of the current study is to report our experience in diagnosing Occult PTC (OPTC) presenting as a
cervical mass without any evident thyroid enlargement.
Patients and methods: Retrospective reviews of reports of all patients presented to our hospital complaining of a mass
in the neck were enrolled in this study. Data regarding their history, investigations, ultrasound and Fine Needle
Aspiration Cytology (FNAC) were reviewed. Cases investigated and diagnosed initially as OPTC were included.
Diagnosis was confirmed by histopathological examination of the resected specimens.
Results: Eleven out of 62 (17.7%) cases with cervical masses were diagnosed as OPTC based on ultrasound and FNAC
findings later confirmed by histological examination of their specimens. Six of them were females and 5 were males
with a mean age of 36.9 years. The mean duration of these masses was 2.3 months. Hemithyroidectomy was done for 2
patients for unilateral small masses in the thyroid with the remainder undergone a total thyroidectomy with modified
lymph node dissection.
Conclusion: OPTC can present for the first time as a neck mass without clinically apparent thyroid enlargement.
Physicians should keep the possibility of OPTC in the differential diagnosis of all adult neck masses in order to avoid
any delay in diagnosis and to achieve the proper management plan.
Keywords: Cervical mass, FNAC, Ultrasound, Papillary thyroid carcinoma, Retrospective reviews, Case series, Dijlah
University.
ultrasound of the soft tissues of the neck7. Thick and
INTRODUCTION
irregular lining of a cyst are the ultrasound features
Neck masses commonly present to general
highly suggestive of metastasis. The origin of these cysts
practitioners (GPs) and could be the single presenting
is still controversial; some researchers proposed that it
complaint in a patient with head and neck malignancy
could represent a malignant change of ectopic thyroid
notably for those over 40 years of age 1. There are often
tissue. Others believe that it signifies metastasis from
no associated symptoms other than the recognition of a
an occult thyroid lesion to the LN which in turn, suffered
new lump noted incidentally on palpation or noticed by
central liquefaction and cystic generation8,9.
another individual. Evaluation of the neck mass can be
Fine Needle Aspiration Cytology (FNAC) is a safe
difficult because of the wide differential diagnosis
and cost-effective investigation with an overall accuracy
ranging from infection to malignancy. Therefore,
of 93.1% (73.398.0%), henceforth, it is considered as a
thorough history and physical examination are essential
first-line diagnostic test for patients at increased risk of
to decide the proper management.
malignancy10,11. Other modalities like contrast-enhanced
Papillary thyroid carcinoma (PTC) is an epithelial
CT or Magnetic Resonance Imaging (MRI) are
malignant tumor of the thyroid gland and accounts for
extremely valuable for the management of patients with
almost 80% of thyroid cancers2,3. About 21.5% of PTCs
cystic neck lesions, especially where the diagnosis
present with lymph node (LN) metastasis at the time of
remains uncertain after standard investigations have
diagnosis4, however, even with LN metastasis, PTC has
been performed12,13.
the best prognosis5,6. Occult papillary thyroid carcinoma
The aim of the current study is to report our
(OPTC) that is less than 1.5 cm size is difficult to be
experience in diagnosing OPTC presenting as a cervical
diagnosed by only palpating the LN unless assisted by
mass without any evident thyroid enlargement.
465
Received: 10/09/2022
Accepted: 01/12/2022
c:\work\Jor\vol901_66
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 471-474
Evaluation of Students- Instructor Relationship in Nursing
Education at the University of Baghdad, Iraq
Qahtan Q. Mohammed
Psychiatric and Mental Health Nursing Department, College of Nursing, University of Baghdad, Iraq
*Corresponding author: Qahtan Q. Mohammed, Mobile phone: +9647713745870,
ORCID ID. 0000-0002-0251-2064, E-mail: qahtan@conursing.uobaghdad.edu.iq
ABSTRACT
Background: The student-instructor relationship as well as effective learning strategies is an important component of
an academic program that magnifies the feeling of trust and respect between the students and instructor. Therefore,
evaluation of the student-instructor relationship provides crucial understanding to reach a good academic environment.
Objective: The study aims at assessing the students - instructor relationship within the educational environment and
evaluating the emotional perception toward relationships among nursing students and their instructors.
Subjects and Methods: The study was conducted on Nursing Collegians of Morning and Evening Studies at the
Nursing Faculty, at Baghdad University. The assessment approach was used over six months (from January 2018 to
June 2018) to achieve the study objectives. A sample of 200 Nursing Collegians was recruited. Student-Instructor
Scale was adopted and used for the current study. The scale consisted of 36 items. The scale defines two domains
regarding instructor relationships; the first domain is regarding the connectedness with an instructor, and the second
domain of the scale is concerned with instructor anxiety.
Results: The students show higher scores of instructor connectedness and anxiety (89% and 83%) which means they
perceive a strong feeling of connectedness with an instructor and show generalized anxiety regarding this relationship
at the same time.
Conclusions: There is a strong positive relationship between students and instructors in nursing education, and this
positive relationship is an important moderator for improving the student's academic performance.
Keywords: Student-Instructor, Relationship, Nursing Education, Student-Instructor Scale, University of Baghdad.
INTRODUCTION
The efficacy of the student-instructor relationship
five components for understanding the student-
can be a contributing factor to students' achievements
instructor relationship which is "providing information,
and resilience. As reported by previous studies factors
instructing, facilitating, guided participation and
concerning the protection of students such as "caring
mentoring" (11).
relationships, higher expectations and opportunities"
Developing effective learning practices requiring
have an influence on the improvement of students'
focusing on the student-instructor relationship. Creating
achievement and performance (1,2).
a positive supportive environment based on building
The identification of learning strategies and
trust and respect between the student and instructor has
learning assignments has been devoted to various
been shown essential for a relationship as maintaining
theories and research as affecting factors to students'
the sense of caring in that relationship and learning
academic achievement and orientation (3,4). And also
environment to be understood. The instructors should
there is a study that examines the effect of student-
exhibit positive perspectives, convictions, and
instructor association on learning outcomes. The
anticipations for the students as learners. An academic
nursing collegians who show a positive connectedness
setting aims to improve the student's abilities related to
with the instructor have higher achievement levels (3,5).
social, ethical, and intellectual aspects by creating a
The most ineffective instructor does not link the
supportive relationship between the student and
student's background to the nature of the educational
instructor (12).
and academic program, so students feel that the
Griffith and Bakanauskas (1983) studied the
instructor is unfaithful and untrustworthy. They show
student-instructor relationship in nursing education,
characteristics of cultural destruction and inability that
they stated that the instructor is significant in facilitating
seek to diminish the student's cultural values and
the role of students by helping them to learn and develop
scientific background (6,7). The student-instructor
personal and professional competencies. They see that
relationship as well as effective learning strategies is an
in terms of power, female instructors may show power
important component of an academic program that
over the students causing them to feel more threatened
magnifies the feeling of trust and respect between the
and incompetent. It has found a positive correlation
students and instructor (8).
A study conducted in
between self-concept and academic performance based
2016 reported that the three important components of
on the instructor showing open communication to
the student-instructor relationship: are "the teaching-
facilitate positive self-concepts (13).
learning environment, exchange of information, and
The study aims at assessing the student-instructor
mentor-peer association" (9,10). Beutel also categorizes
relationship within the educational environment and
471
Received: 10/09/2022
Accepted: 01/12/2022
c:\work\Jor\vol901_67
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 475-482
Colistin Susceptibility among Carbapenem Resistant Klebsiella pneumoniae
Isolated from Menoufia University Hospitals
Shymaa A. Elaskary1*, Hanem Mohamed Badawy2
1Medical Microbiology and Immunology Department, Faculty of Medicine, Menoufia University, Egypt.
2Clinical pathology, Faculty of Medicine, Menoufia University, Egypt.
Corresponding author: Shymaa A. Elaskary, ORCID: 0000-0003-0588-9761, Email: dr.shaimaaelaskary@yahoo.com
ABSTRACT
Background: Infections by CRKp represents a major health problem. Carbapenemases have been frequently reported
in CRKp. Limited antimicrobials are still effective for CRKp like tigecycline, ceftazidime/avibactam, as well,
polymyxins including colistin. With the increased use of colistin, Col R k. pneumoniae carbapenemase (KpC)-
producing isolates are documented worldwide.
Objectives: The aim of the current study is to investigate carbapenemases and to determine colistin susceptibility and
mcr genes among CRKp.
Material and methods: k. pneumoniae were identified by conventional methods and API20E. Carbapenem and colistin
resistance were screened by disc diffusion method. Confirmatory combined mCIM/eCIM testing was used for
carbapenemases detection. BMD and CBDE tests were used for colistin susceptibility detection. Multiplex PCRs were
done for carbapenemases genes (blaNDM-1, blaOXA48, blaIMP blaVIM, blaKPC) and colistin resistance genes (mcr1, 2, 3, 4
and 5 genes) detection.
Results: Out of CRKp, 68.9% were positive carbapenemases by mCIM/eCIM testing, 33.3% of them were MBLs and
66.7% were serine carbapenemases. the most frequent carbapenemases genes were blaKPC and blaOXA-48. About 16.3%
of CRKp were colistin resistant by BMD test. There was fair agreement of CBDE test in relation to BMD for colistin
susceptibility detection. The mcr1 gene was detected in 9.1% of CRKp.
Conclusions: The increase detection of carbapenemases and colistin resistance among k. pneumoniae isolates obligate
us for efficient use of prevention and control protocols to decrease the multidrug resistance in hospital and community
environments.
Keywords: Carbapenemases, Colistin, BMD, CBDE and MCR, Experimental study, Menoufia University.
INTRODUCTION
colistin with other antibiotics including tigecycline,
Infections by carbapenem-resistant Klebsiella
meropenem, gentamicin, or fosfomycin can manage
pneumoniae (CRKp) that usually shows multidrug
them properly8. With the increased use of colistin,
resistance pattern to all -lactams, fluoroquinolones,
colistin-resistant
Klebsiella
pneumoniae
and aminoglycosides stay a major health threat
carbapenemase (KpC)- producing isolates are
globally1,2.
documented worldwide8. Which were initially
The carbapenem resistance is mainly due to
considered to be chromosomally mediated only until
reduced expression and/or mutation of porins that allow
Liu et al., 20169 stated the development of the first
carbapenem entry into the bacterial cells3. Moreover,
plasmid-mediated polymyxin resistance mechanism,
the presence of carbapenemase genes on conjugative
mcr-1 in enterobacteriaceae2. The occurrence of
plasmids is correlated with the high incidence of
colistin-resistance (ColR) in CRKp generates a warning
carbapenem resistance4.
alarm for both clinicians and patients to return them to
Carbapenemases are either non-metallo--
the pre-antibiotic era8.
lactamases (serine carbapenemases, classes A and D)
This
study
has
aimed
to
investigate
and metallo--lactamases (MBL, class B)3. MBL genes
carbapenemases and determine colistin susceptibility
such as blaNDM, blaIMP, blaVIM, and non-metallo-
and mcr genes among carbapenem resistant Klebsiella
carbapenemase genes like blaOXA (class D) and blaKPC
pneumoniae isolated from Menoufia University
(class A), have been frequently reported in carbapenem-
Hospitals.
resistant Klebsiella pneumoniae (CRKp)5.
Some limited antimicrobials are still effective for
MATERIAL AND METHODS
CRKp like tigecycline, and the newly approved
Collection of Samples:
ceftazidime/avibactam6. As well, polymyxins including
Out of 984 patients admitted to different wards of
colistin are a valuable therapeutic choice that can bind
Menoufia University Hospitals during the period of
lipopolysaccharides and disrupt the outer membrane2,6.
February 2021 to July 2022, 334 (33.9%) Klebsiella
Although in 1970s, polymixins were largely
pneumoniae C.I.s were isolated as one isolate per
neglected because of their toxicity. These cationic
patient in the Medical Microbiology and Immunology
antimicrobial peptides have come back as a "final-
Department, Faculty of Medicine, Menoufia University.
resort" alternative therapy for numerous multidrug-
resistant organisms7. In critical cases caused by CRKp,
475
Received: 01/10/2022
Accepted: 15/12/2022
c:\work\Jor\vol901_68
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 483-490
Sirtuin-1 in Rheumatoid Arthritis Patients, Relation to Disease
Activity and Interleukin-17A
Rasha I Noreldina, Heba A Esailyb, Samar M Kamal Eldina
Departments of a Clinical Pathology and b Physical Medicine, Rheumatology and Rehabilitation,
Faculty of Medicine, Menoufia University, Menofia Governorate, Egypt
Corresponding author: Heba A. Esaily, MD, Mobile: +20 109 272 2125, ORCID: 0000-0002-8660-6817,
E-mail: hebaesaily@yahoo.com
ABSTRACT
Background: A systemic condition with a very complex pathophysiology is rheumatoid arthritis. It has been discovered
that IL-17A has strong pro-inflammatory characteristics. Sirtuin-1 contributes to chronic inflammation, and its levels in
chronic inflammatory illnesses are still under investigations. Up to our Knowledge, the relation between such two markers
not yet studied in rheumatoid arthritis patients.
Objectives: The aim of the current study is to evaluate sirtuin-1 in rheumatoid arthritis patients and analyze the potential
association between sirtuin-1 level and serum IL-17A levels and their relations to disease activity.
Patients and methods: A cross-sectional study was conducted on 60 Rheumatoid Arthritis (RA) patients and 30 healthy
volunteers. Every participant was subjected to history taking, clinical examination, and laboratory evaluation.
Results: both IL-17A and sirtuin-1 were substantially more in RA patients and significantly correlated to most of measured
variables. IL-17A and sirtuin-1can be diagnostic indicator of RA with sensitivity (96.67% and 96.67%, respectively) and
specificity (96.67% and 86.67%, respectively) and can be indicators of high disease activity with sensitivity (90% and 80%,
respectively) and specificity (94% and 94%, respectively), while combined sirtuin-1 and IL-17A diagnostic performance
adds much to specificity to discriminate those with high active disease; Sirtuin-1 (Coefficient B= 0.249, P<0.006) and IL-
17A (Coefficient B= 0.043, P<0.012) were independent predictors of disease activity.
Conclusion: Compared to healthy individuals, RA patients had considerably greater levels of IL-17A and sirtuin-1. IL-17A
has better sensitivity and specificity than situin-1 in discriminating patients, remission and high disease activity states.
Sirtuin-1 combined with IL-17 is beneficial in improving the discriminative power for high disease activity, therefore, both
might be thought of as potential biomarkers for RA disease activity.
Keywords: IL-17A; Sirtuin-1; disease activity; rheumatoid arthritis, case control study.
INTRODUCTION
Retinoic acid receptor-related orphan receptor t (RORt),
One of the most prevalent autoimmune illnesses,
a key transcription factor, is required for Th17 cell
rheumatoid arthritis (RA), affects about 1% of people
development (7).
worldwide. Systemic loss of self-tolerance and immune-
A histone deacetylase known as Sirtuin1 is
mediated inflammation are its defining characteristics (1).
involved in a variety of physiological processes, including
Inflammatory
proliferation
of
fibroblast-like
oxidative stress, glucose metabolism, DNA integrity,
synoviocytes (FLSs) is the pathogenic aspect of RA; they
aging, and cancer. Sirtuin1 is nicotinamide-adenine
form invasive synovial pannus, emit a number of pro-
dinucleotide (NAD)+-dependent (8). The sirtuin family of
inflammatory cytokines, and make proteases that damage
proteins includes sirtuin-1, which has the greatest
bone and cartilage (2).
molecular mass (120 kDa). SIRT-1, which has 8 introns
Macrophages, mast cells, dendritic cells (DCs), T
and 11 exons, is found on chromosome 10q21.3 (9).
cells, B cells, and fibroblast-like synoviocytes (FLSs) are
Sirtuin-1 suppression lowers the expansion of Th1,
only a few of the cell types implicated with RA (FLSs) (3).
Th17, and dendritic cells as well as the production of
Helper T cells are the most crucial immune cells in
inflammatory cytokines, matrix metalloproteinase, and
adaptive immunity and are often referred to as the "master
RORt (10). Sirtuin-1 contributes to chronic inflammation,
of immunity" since they are essential for practically all
and its protein levels in numerous chronic inflammatory
immunological responses, including those that control the
illnesses including RA are still under investigations.
actions of other lymphocytes and a large portion of the
Therefore, the aim of the current study is to evaluate
innate immune response (4).
sirtuin-1 in rheumatoid arthritis patients and analyze the
T cells are the primary source of IL-17A. IL-17, IL-
potential association between sirtuin-1 level and serum
22, and other cytokines are released by TH17. When
IL-17A levels and their relations to disease activity.
TGF-, IL-6, and IL-l are present, antigen stimulates their
differentiation from TH0, which is then blocked by IFN-
PATIENTS AND METHODS
or IL-4 (5). A novel subclass of cytokines with strong pro-
The 60 rheumatoid arthritis patients who addressed the
inflammatory characteristics was founded by IL-17 (6).
outpatient
clinics
of
the
Physical
Medicine,
483
Received: 01/10/2022
Accepted: 12/12/2022
c:\work\Jor\vol901_69
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 491-497
Red Blood Cell Distribution Width Association with Resistance to
Erythropoietin Stimulating Agents in Hemodialysis Patients
Islam Elshazly*1, Ayman Seddik1, Ahmed Samir Abo Halima2, AbdelRahman Khedr1
Departments of 1Internal Medicine and Nephrology and 2Internal Medicine and Gastroenterology,
Faculty of Medicine Ain Shams University, Egypt
*Corresponding author: Islam Omar Elshazly, Mobile: (+20)01142497699,
Email: Islam.Omar@med.asu.edu.eg, Islamomarelshazly@gmail.com
ABSTRACT
Background: Red blood cell distribution width (RDW) is a quantitative marker of heterogeneity of circulating
erythrocytes size and a marker of malnutrition, inflammation and mortality. Erythropoietin resistance index (ERI) is
considered as an effective way to check erythropoietin resistance. ERI is related to all-causes of morbidity & mortality
in hemodialysis patients. Association with aging and gender have also confirmed progressive increase in RDW with
aging and in female gender.
Objective: this study aimed to check the relation between RDW & ERI in iron replete hemodialysis patients.
Patients and methods: 89 patients matched inclusion criteria followed up for 12 months and data analyzed including
age, gender, diabetic status, serum iron, serum ferritin, red blood cell width, Erythropoietin dose per week per kg body
weight.
Results: Patients included were 36 (40.5%) females and 53(59.5%) males with mean age of 42.7 ± 15.2 years old.
Diabetic patients were 51 (57.3%) and non-diabetic were 38 (42.7%). All patients were iron replete as per inclusion
criteria with serum ferritin 200-800 ug/dl and transferrin saturation 20-40%. Hemoglobin, RDW & ERI were repeated
at 4 checkpoints during the 12-months follow-up period. The average of all (4) readings then processed for Pearson
correlation logistic regression to identify the relation between RDW and ERI and we found linear correlation between
RDW and ERI. R-square 0.158, P-value < 0.001, this relation was independent of age, gender, hemoglobin level,
erythropoietin dose and diabetic status.
Conclusion: Our results confirmed the independent relation between RDW and resistance to erythropoietin in iron
replete hemodialysis patients.
Keywords: Red blood cell distribution width, Erythropoietin resistance index, Anemia, Hemodialysis.
INTRODUCTION
causes of morbidity & mortality in maintenance
RDW is a quantitative marker of heterogeneity
hemodialysis patients (11).
of circulating erythrocytes size. It is routinely reported
Although RDW has been shown to closely
in a complete blood count and does not require an
correlate with kidney function (12-13). There is a limited
additional cost. It is measured by dividing the volume
data about RDW and other lab parameters in
of red blood cell to mean corpuscular volume (MCV)
maintenance hemodialysis patients. In this study we
and the result given as a percentage. It was used to
hypothesized a relation between RDW and ERI in
narrow the differential diagnosis of nutritional anemia
maintenance hemodialysis patients. Aim of the study
(iron, vitamin B12 and folate) in combination with
was to determine relation between RDW and ERI in
MCV (1-3).
iron replete hemodialysis patients.
RDW has been implicated as a marker of
malnutrition and inflammation. It has also been found to
PATIENTS AND METHODS
be an important marker for mortality independent of
Inclusion criteria:
anemia across general population and in several
Patients undergoing hemodialysis in Ain Shams
conditions as heart failure, pulmonary embolism,
University Hospitals Outpatient dialysis facility for at
pancreatitis, sepsis, acute kidney injury and renal
least 3 months prior to study starting and having iron
transplantation but the association remains unexplained
profile within target as per KDIGO anemia management
(4-8). Association with aging and gender have also
guidelines serum Ferritin 200-800 ng/dl and transferrin
confirmed progressive increase in RDW with aging and
saturation 25-50% .
in female gender (9).
Anemia is a common complication in patients
Exclusion criteria: Patient not matching eligibility
on maintenance hemodialysis and usually it is managed
criteria.
by erythropoietin (EPO) injection with good response in
most of the patients. Some do not respond well to EPO
Study design:
or need higher than average doses and this is defined as
89 patients were included as per inclusion criteria,
EPO resistance. ERI has been considered as an effective
data collected including gender, age, duration on
way to check EPO resistance (10). ERI is related to all-
dialysis, dialysis modality, iron profile (serum ferritin,
491
Received: 16/09/2022
Accepted: 18/11/2022
c:\work\Jor\vol901_70
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 498-506
Erector Spinae Plane Block: An Analgesic Technique as an Alternative to
Transversus Abdominis Plane Block in Abdominoplasty Surgery
Tamer Elmetwally Abdallah Farahat, Ayat Ebrahim Eid*, Mona Hasheesh, Hanaa M. El Bendary
Department of Anesthesia and Surgical Intensive Care, Faculty of Medicine, Mansoura University, Egypt
*Corresponding author: Ayat Ebrahim Eid, Mobile: (+20) 01064451903, E-Mail: ayatebrahimeid@gmail.com
ABSTRACT
Background: Managing post abdominoplasty pain can be quite challenging. Multimodal analgesia strategies have been
used to provide maximum benefit with less side effects. Combining regional anaesthetic techniques with multiple non
opioid analgesics can provide efficient postoperative analgesia. Objective: This study aimed at comparing the analgesic
efficacy of ultrasound guided erector spinae plane block (ESPB) and ultrasound guided transversus abdominis plane
block (TAPB) in abdominoplasty surgery when given as a part of multimodal analgesic strategy.
Patients and methods: A total of 69 females ASA I & II physical status patients aged between 25 and 65 years who
were scheduled for abdominoplasty surgery under general anaesthesia were included in this study. Patients were
allocated to three groups; Control group received only standard general anaesthesia, TAPB group received standard
general anaesthesia in addition to TAPB, while ESPB group received standard general anaesthesia and ESPB. We
recorded total opioid consumption, time of first analgesic request, visual analogue score and hemodynamic changes in
first 24h postoperatively. Results: ESPB and TAPB reduced postoperative opioid consumption and prolonged time till
analgesic request than the control group. ESPB prolonged duration of analgesia and reduced postoperative heart rate,
while TAPB block was relatively easier and less time consuming.
Conclusion: ESPB and TAPB can provide considerable postoperative analgesia following abdominoplasty surgery
when being incorporated in a multimodal analgesia regimen. Therefore, we recommend using either technique to lessen
pain in patients subjected to abdominoplasty surgery.
Keywords: Erector Spinae plane block, Analgesic technique, Transversus Abdominis plane block, Abdominoplasty
surgery.
INTRODUCTION
Abdominoplasty is a popular body reshaping
Patients excluded from this clinical trial are those who
surgery that often results in great amount of pain. Post
have contraindications for regional anaesthesia in
abdominoplasty pain usually originates from the long
general such as patient's refusal, local skin infection at
incision and facial plication meaning it is a somatic pain
the puncture site, hematological diseases, bleeding, or
component (1). Improperly managed postoperative pain
coagulation abnormality, also patients who have
can delay patient recovery increase incidence of
psychiatric disorders and allergy to the local anesthetics
complications and delay ambulation which carries the
used.
risk of venous thromboembolism (2).w Opioids have
Sample size calculation:
been the go-to drugs for decades, but nowadays its use
The primary outcome was the mean amount of opioids
is being devalued in consequence of its multiple side
consumed on the first postoperative day, and the sample
effects (3). Regional anaesthetic techniques is a valuable
size was calculated using the Power Analysis and
alterative that has proven its efficacy in preventing
Sample Size software programme (PASS) version
nociception following Abdominoplasty surgery (4).
15.0.5 for Windows (2017) based on earlier findings (12,
An effective face plane block known as the
13). To attain 90% power, sample sizes of 23 patients in
erector spinae plane block (ESPB) has been
each group are required (1- ).
demonstrated to do so after a variety of procedures (5).
For somatic analgesia during abdominal
Randomization:
procedures, the transversus abdominis plane block
Eligible 69 patients were randomly allocated by closed
(TAPB) is a well-known abdominal wall block (6).
envelop method according to the anesthetic technique
This study aimed at comparing the analgesic
used into 3 equal groups:
efficacy of ESPB and TAPB in abdominoplasty surgery
Control group (Control) (N= 23): Which received
when given as a part of multimodal analgesic strategy.
only standard general anesthesia.
Transversus abdominis plane block group (TAPB)
PATIENTS AND METHODS
(N= 23): which underwent bilateral transversus
This prospective randomized controlled clinical trial
abdominis plane blockade; the total volume of local
was conducted in Mansoura University Hospitals
anaesthetic utilised was 25 ml on each side; 15 ml
(MUH) for patients subjected to abdominoplasty
of 0.5% + 5 ml of 2% lidocaine HCL plus 5 ml of
surgery. A total of 69 ASA I & II physical status
saline.
patients aged between 25 and 65 years of either sex who
Erector spinae plane block group (ESPB) (N= 23):
were scheduled for abdominoplasty surgery under
It underwent bilateral erector spinae plane blockade
general anaesthesia were included in this study.
and got a total amount of 25 ml of local anesthetic
498
Received: 21/09/2022
Accepted: 22/11/2022
c:\work\Jor\vol901_71
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 507- 517
Comparative Protective Effects of L-Ascorbic Acid and Crude Honeybee Extract
Supplements Against Toxic Effects Induced by Sodium Nitrate in Male Rats
Eman Mohamed Kamel*1, Hany Salah. Mahmoud2, Heba Nageh Gad EL-Hak3,
Heba M.A. Abdelrazek4, Noha E. Shebl5, Yousra Reda Arafa Mohamed6,
Ghada Mohamed Gad Abd Elghany3, Ranwa Ahmed Abdou Elrayess3
1Anatomy and Embryology Department, Faculty of Medicine, Suez Canal University, Egypt
2Center of Scientific Foundation for Experimental Studies and Research, Ismailia, Egypt
3Zoology Department, Faculty of Sciences, Suez Canal University, Egypt
4Physiology, 5Pathology and 6Forensic Medicine and Toxicology Departments,
Faculty of Veterinary Medicine, Suez Canal University, Ismailia, Egypt
*Corresponding author: Eman Mohamed Kamel, Mobile: (+20) 01017209608, E-Mail: emanalshareef79@gmail.com
ABSTRACT
Background: Sodium nitrate has been used extensively as a meat additive to keep meat products fresh. Several
strategies have been implemented in counteracting such toxicity.
Objective: The goal of the current investigation was to determine if ascorbic acid and crude honey extract can protect
male rats from the harmful biochemical and histopathological effects of sodium nitrate.
Materials and methods: 36 male Albino rats were alienated into 6 groups; control was given saline, honey group was
given (2.5g/kg/day honey, ascorbic group was given (200mg/kg /day) L-ascorbic acid, NaNO3 group was given
200mg/kg/day, honey/ NaNO3 group rats given honey and nitrate with the former doses, and Ascorbic/ NaNO3 group
was given L-ascorbic acid and NaNO3 with the former doses. Organs' relative weight, liver and kidney blood
biochemical determinants, serum tumor necrosis factor alpha (TNF-) and interleukin 6 (IL-6), histology and
histochemistry were determined.
Results: The sodium nitrate had significantly increased liver, kidney and spleen relative weights while decreased thymus
weight. Higher levels of AST, ALT, urea, creatinine, IL-6 and TNF- were observed in NaNO3 treated group. Liver,
kidney, and spleen of rats treated with NaNO3 revealed histological and histochemical alterations. The treatment with
L-ascorbic acid and crude honeybee improved the later dysfunctions with more palliative effect for L-ascorbic acid.
Conclusions: We can conclude that sodium nitrate has to be limited in use. L-ascorbic acid was therefore recommended
to be used in reducing the harmful metabolic alterations induced by sodium nitrate better than the honeybee.
Keywords: Ascorbic acid, Honey, Kidney, Liver, Sodium nitrite, Spleen.
INTRODUCTION
recently been discovered to be effective antioxidants[6].
Sodium nitrate and sodium nitrite are
Ascorbic acid and honeybee are considered potent
preservatives found in treated meats like sausage,
antioxidants, they play a vital role in diminishing
bacon, and ham, as well as some cheeses [1]. Nitrate can
oxidative stress through reactions with different free
be transformed to nitrite in the food byproducts, as well
radicals and inhibition of lipid peroxides formation [7].
as in the gastrointestinal tract or mouth, both nitrate and
Ascorbic acid can enter mitochondria through
nitrite must be taken into consideration when evaluating
facilitated glucose diffusion via transporter and
any potential hazard [2].
deliberates mitochondrial shield in contradiction of
Adding nitrite and nitrate to food byproducts is
oxidative injury. Ascorbate has been concerned in
just one of the various sources of nitrogenous
various biological processes. It is considered a cofactor
compounds to which human beings are exposed.
for various enzymatic phases in the monoamines',
Smoked foods and salt-preserved fish are other sources
collagen, peptide hormones, amino acids, and carnitine
of nitrogenous compounds in the human diet[3]. It is
synthesis. Moreover, it plays a significant role in the
believed that low levels of Na nitrate consumption for
antioxidative defense at several stages [8].
long period are associated with several health problems
The honeybee is a nutrient used for centuries as
with many harmful side effects like carcinogenicity,
a disease fighter and health improver[9]. Honey consists
histopathologic tissue alterations, nitrative tissue injury,
of a mixture of carbohydrates, minerals, proteins, and
and hepatic as well as renal lipid peroxidation, as well
water [10]. It has been reported that honey has antioxidant
as encouraging chromosomal aberrations [4]. The liver,
properties as it can decrease lipid peroxidation [11]. This
kidney and spleen are one of the potential targets of
goes back to its component of flavonoids and
toxicity after exposure to Na nitrate, through induction
antioxidant trace elements [12].
of oxidative stress [5].
Ascorbic acid and Honeybee exert benefits
Animals' ability to withstand the toxic
against liver, kidney and spleen injury in experimental
influences of environmental toxicants is reliant on their
impairment by exerting anti-inflammatory and
detoxifying capability and antioxidant schemes.
antioxidant influences. Therefore, this study intended to
Vitamins, amino acids and their byproducts,
estimate the possible positive effects of ascorbic acid
trace elements, plant phenolics and fatty acids have
and honey against Na nitrate-induced liver, kidney and
507
Received: 22/7/2022
Accepted: 24/9/2022
c:\work\Jor\vol901_72
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 518-521
Epidemiological Study on Toxoplasmosis in Cat, Healthy and
Contact Human in Al-Anbar Governorate
Salaah Aldeen M. Sadeq Alkubaisi1*, Ibrahim Abdul-Hussein Swear Al-Zubaidy2
1,2College of Veterinary Medicine, Department of Public Health, Zoonotic Diseases Unite, University of Baghdad, Iraq
*Corresponding author: Salaah Aldeen M. Sadeq Alkubaisi. Mobile (+964)7707592904,
Email: salahaldeen.mohammed1204@covm.uobaghdad.edu.iq
ABSTRACT
Introduction: One of the most typical illnesses in women is toxoplasmosis, and considered a transmissible disease between
humans and animals. Cats show a major part in contributing to the spread of toxoplasma, so they stay the final host, which
shed their eggs with feces to the environment, which leads to contamination of water and food. Objective: The purpose of
the current research is to determine if keeping cats at home contributes to the spread of toxoplasmosis or not, and what is
the difference between stray and pet cats in the spread of the disease. Patients and Methods: An epidemiology research on
toxoplasmosis was undertaken in Anbar province. A total 120 human blood samples were collected from people attending
veterinary clinics in Anbar Governorate and 62 fecal samples of cats, from November 2021 to April 2022. Human's samples
were tested by Latex agglutination, while cat's samples were tested by direct detection of oocyst.
Results: The result showed that 33 of 120 (27.5%) blood sample of female human were positive by (latex test IgM, IgG)
and 87 of 120 (72.5%) were negative. These samples were divided into woman having cat (51.67%) and woman don't have
cat (48.33%). The result of cats showed oocyst (9.67%) positive result fecal samples of cats, using feces flotation method.
Conclusion: Toxoplasmosis infection does not only occur in people who own cats, because many infected people did not
have direct contact with cats, but may be infection by undercooked meat or by the soil that holds the eggs.
Keywords: Toxoplasmosis, Epidemiological Study, Human, Cats, Cross sectional study, University of Baghdad.
INTRODUCTION
blood transfusions and organ replacements in
Toxoplasmosis is composed of intracellular obligate
immunocompetent
individuals who
were 90%
protozoan organism Toxoplasma gondii (T.gondii), that
asymptomatic when they contracted toxoplasmosis (10).
able to infected people and other warm blood animals.
Symptomatic diseases commonly cause few mark fever,
Toxoplasmosis had a world-wide propagation with almost
headache, malaise, cervical Lymphadenopathy. Severe
one third of the world-wide people expected to have
and pneumonia are rare but can complicate severe (10),
infection with that organism (1). Toxoplasmosis is an
lead to death in immunocompromised patient (11).
expanded infectious disease caused by T.gondii. Human,
Diagnosis of toxoplasmosis infectivity may be recognized
veterinary, and environmental health all have economic
by serologic checks, molecular techniques, histological
value (2). Toxoplasmosis is a cause of fetus dead
validation of the parasite, a toxoplasmin skin experiment
because T.gondii can be transferred to the fetus across the
and by isolation of the parasite (12,13). Molecular
placenta (trans-placental) from an infested mother or at
techniques trust on PCR for the exclusive detection or
vaginal liberation (3).
examination of T. gondii DNA. From humans and animals
Recently, Asal revealed the highest infection rate
(14, 15). Real-time PCR remains to amplify DNA of
reported among younger animals while it was the lowest
T.gondii B1 gene (16). Real-time PCR utilizes the 59-
in older animals (4). However, Bisson et al. concluded that
nuclease activity of Taq DNA polymers (17).
health then ingesting of infected milk and meat can enable
zoonotic diffusion of toxoplasmosis has a large variation
PATIENTS AND METHODS:
of hosts (5), as approximately each warm-blooded
Sampling: Samples were collected from 120 female
domestic animal can be infested. Sexual reproduction of
human blood from different areas in Al-Anbar
parasite that cause by only happening cat and Felids (final
governorate (52) in Ramadi city center of Al-Anbar and
host), while asexual reproduction occurs in together final
(43) Jazert Alramadi, Falluja (19) and (6) from Heet.
and intermediate host (6,7). Oocyst remain transit in the
Serological test: The sample of all cases survived
fecal of cats and be transmissible within 21 days of
examined for the existence of exclusive IgG, IgM anti-
actuality shed. Tachyzoites escape and reproduce only in
Toxoplasma antibodies. The kit was used concurring to
an intracellular site but tissue cysts having many nor do
the company's orders but can briefly illustrated by adding
limited bradyzoites take place in the tissues of infested
50l of Toxo-latex substance was additional to 50l of
animals during a week of infectivity (8). Consumption of
blood samples on slid, mixed and revolved on involuntary
tissue cysts in infested meat or oocyst from water, food,
rotator (100 rpm) for 5 min. After mark of agglutination
or soil infective by feline feces are the two main ways of
showed mean positive sensitive. Positive and negative
diffusion (9). Rarely, T.gondii transmission occurs after
controls were involved.
518
Received: 02/10/2022
Accepted: 02/12/2022
INTRODUCTION
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 522-527
Role of 17- Estradiol and Ramipril in OPG/RANKL Pathway in a
Rat Model of Post-Menopausal Osteoporosis
Hemmat Mohamed Khloussy1, Ahmed Desouky Badawy2,
Yara Sayed Ibrahim Eldesouki Mohamed2, Muhammad Maher 1
1 Medical Physiology, Faculty of Medicine, Cairo University
2 Medical Physiology, Faculty of Medicine, October 6 University
Corresponding authors: Yara Sayed Ibrahim Eldesouki Mohamed, Mobile: (+20) 01065275241,
Email: Yara.Sayed@o6u.edu.eg
ABSTRACT
Background: Primary osteoporosis and other metabolic bone disorders have been linked to the proteins osteoprotegerin
(OPG) and receptor activator of nuclear factor-kappa B ligand (RANKL).
Aim and objectives: Our study's goal was to examine the effects of co-administering estradiol (E2) and ramipril (ACEI)
on bone markers in ovariectomized rats and to assess the potential interactions between these medications in order to
address the function of the OPG/RANKL system as a potential mechanism of action.
Materials and methods: 40 female rats, randomly divided into 5 groups, each group included 8 rats. Group 1: Control
group (sham operated). Group 2: Ovariectomized rats (OVX). Group 3: Ovariectomized rats (OVX)+E2. Group 4:
Ovariectomized rats (OVX)+ACEI. Group 5: Ovariectomized rats (OVX)+E2+ACEI.
Results: OVX rats showed a significant decrease in serum Ca2+ and OPG levels with significant increase in serum
RANKL, osteocalcin, alkaline phosphatase activity and urinary hydroxyproline levels compared to control group.
Treatment with ramipril as well as E2 led to a significant improvement in bone markers levels with a significant increase
in serum OPG level with a significant reduction in serum RANKL level compared to OVX group.
Conclusion: Ramipril as ACEI had more significant effect on decreasing serum bone markers level than 17- estradiol
in ovariectomized rats. So, we can draw the conclusion that altering OPG/RANKL signalling may be a possible
mechanism by which E2 and ACEI prevent osteoporosis.
Keywords: 17- Estradiol; Ramipril; OPG/RANKL; Rat Model; Post-Menopausal Osteoporosis.
INTRODUCTION
formation (5). One accurate measure of the differentiation
Osteoporosis, a systemic skeletal disorder
status of the osteoblast and osteoclast is the
characterised by decreasing bone mass, is one of the
OPG/RANKL ratio, and the RANKL/RANK/OPG
most significant issues impacting postmenopausal
system has been related to a range of skeletal and immune-
women, deteriorated bone tissue, and increased fragility
mediated illnesses, including numerous types of
and fracture susceptibility (1).
osteoporosis, which are characterised by accelerated bone
Bone is a dynamic tissue that undergoes ongoing
resorption and bone loss (postmenopausal, glucocorticoid-
remodelling as a way to integrate external chemical,
induced, and senile osteoporosis (6).
hormonal, and biomechanical cues as well as its own
In order to assess the potential effects of ramipril
internal mechanism for self-regeneration. At the cellular
(ACEI) and estradiol on bone markers in oestrogen
level, bone remodelling occurs in a series of recurrent
deficiency-induced bone loss in ovariectomized rats,
cycles of bone production by osteoblasts, which are
our study set out to compare the two drugs, to discuss
descended from pluripotent mesenchymal stem cells,
the role of OPG/RANKL system as a possible
and bone resorption by osteoclasts, which are derived
mechanism of action, also to compare the effect of co-
from the monocytic/macrophagic lineage (2).
administration of estradiol and ramipril on bone
The majority of metabolic bone illnesses are
markers in ovariectomized rat.
brought on by disturbances in osteoclast quantity or
activity, which lead to abnormally high levels of bone
MATERIALS AND METHODS
resorption that are greater than osteoblasts' ability for
The goal of the current investigation was to assess the
compensation (3). The most common option for
potential effects of ramipril (ACEI) and estradiol on
simulating some of the most crucial clinical aspects of
bone markers in rats with estrogen deficiency-induced
postmenopausal bone loss is the ovariectomized (OVX)
bone loss as well as to discuss the potential relevance of
rat model (4).
the OPG/RANKL ratio as a mechanism of action.
It's well known that the estrogen exerts a direct
protective effect on the bone through its receptors; it
Ethical consideration:
decreases the rate of production of osteoclasts, their
The experimental techniques and animal care were
activity and their survival and exerts an anabolic effect
approved by Institutional Review Boards (IRB) at
on osteoblasts. Additionally, oestrogen is known to
Faculty of Medicine's Research Ethics Committee,
control the development and activity of various pro-
Cairo University. Code: MD- 252-2020. Rats were
inflammatory cytokines, including RANKL, which has
handled according to National Institutes of Health
been shown to increase bone resorption and limit bone
(NIH) guidelines for animal experimentation. This work
522
Received: 19/07/2022
Accepted: 21/10/2022
c:\work\Jor\vol901_74
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 89 (2), Page 528-535
Quality of Life in Rheumatoid Arthritis: Influence of Personality Traits and
Disease Related Variables. An Egyptian Study
Abeer Allam a, Heba A Esaily b, Eman G. Saleh a
Departments of a Neuropsychiatry, and b Physical Medicine, Rheumatology and Rehabilitation,
Faculty of Medicine, Menoufia University, Menofia Governorate, Egypt
Corresponding author: Heba A. Esaily, MD, e-mail: hebaesaily@yahoo.com
Mobile: +20 109 272 2125, ORCID ID: https://orcid.org/0000-0002-8660-6817
ABSTRACT
Background: Quality of life (QoL) in rheumatoid arthritis patients may be greatly affected by their personality, which
shape their perception of illness, their attitude, and behavior. Up to our knowledge, none has discussed personality traits
in Egyptian RA patients.
Objectives: To study personality traits in Egyptian RA patients and its impact on health-related quality of life together
with its relation to severity of illness.
Methods: A cross-sectional study was conducted on 150 Rheumatoid arthritis female patients and 50 healthy
voluntaries. All participants completed the following: socio-demographics, SF-36, Eysenck personality questionnaire,
hospital anxiety and depression scale, DAS-28, Pain VAS, and laboratory investigations.
Results: Neuroticism traits were substantially more in RA patients and significantly correlated to most of measured
variables. QoL deteriorated in RA patients. Pain severity (coefficient B= -0.31, p 0.002) and depression severity
(coefficient B= -0.25, p 0.01) were an independent negative predictor of life quality related to physical health, followed
by higher disease activity (coefficient B= -0.20, p 0.02), disease span (coefficient B= -0.19, p 0.02). Depression was an
independent negative predictor of quality of life related to mental health (coefficient B=-0.42, p< 0.001) followed by
anxiety (coefficient B=-0.38, p< 0.001), then disease span (coefficient B=-0.17, p 0.03) and Pain severity (coefficient
B=-0.34, p0.04)
Conclusion: Personality traits specially neuroticism was significantly correlated with most of measured variables and
affect QoL in Egyptian RA patients, indirectly.
Keywords: Anxiety, Depression, Personality traits, Quality of life, Rheumatoid arthritis.
INTRODUCTION
impact on health-related quality of life together with its
The autoimmune disorder rheumatoid
relation to severity of illness.
arthritis (RA), is one of the most prevalent conditions.
Prevalence of RA ranges from 0.6 to 1.3 % based on
MATERIALS AND METHODS
data of World Health Organization (WHO) records. It
The study enrolled 150 patients in a cross-
causes severe limitations in patients' life despite many
sectional design (both sexes, ages from 20 to 50 years).
advances in its treatment. Higher rates of disability were
They were diagnosed with RA using the 2010
found to be related to older age, female sex and higher
ACR/EULAR indicators of classification (8). Patients
disease activity variables (1). Impairments in HR-QoL in
were
drawn
from
the
Physical
Medicine,
RA have been reported (2). QoL greatly influenced by
Rheumatology, and Rehabilitation department's
personality traits as evaluation of HR-QoL items
Outpatient Clinic at Menoufia University Hospital
depends on subjective assessment of its items (3).
between July 2019 and February 2020. As a control
Neuroticism subtype of personality traits in RA patients
group, 50 healthy volunteers with similar ages were
was found to contribute to their psychological distress
enrolled.
even to their disease adjustment (4).
Depression rates in RA ranges from 13% to
Exclusion criteria: Patients who were uncooperative
20% and even above. Studies that used self-report
for psychiatric evaluation, or with positive history of
measurement gives higher rates of depression despite
psychiatric disorders or receiving psychotropic
symptomatology levels is subclinical (5). In a
medication. Also, patients with any other physical
longitudinal study, depression risk in RA was found to
illness, or with extra-articular manifestations were
be 40% over 9 years. Depression occurrence in RA
excluded.
patients found to be related to pain, fatigue, more
disease activity, greater use of health services, more
Socio-demographic information were gathered.
work disability even to higher suicidal risk and
The Disease Activity Score (DAS-28) was employed
mortality (6). Higher levels of anxiety (21% to 70%)
to evaluate the illness severity. It included the first hour
were also reported in previous studies (7). Up to our
Erythrocyte Sedimentation Rate (ESR), joint swelling
Knowledge, none has discussed personality traits in
and tender counts, and personal evaluation of patients
Egyptian RA patients. Thus, the aim of this work was to
on a visual analogue scale. The total DAS-28 score was
study personality traits in Egyptian RA patients and its
computed using the standard method. RF titre was
obtained using the latex agglutination method (RF
528
Received: 25/09/2022
Accepted: 10/12/2022
c:\work\Jor\vol901_75
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 536-541
Prevalence of Covid-19 Vaccine Hesitancy among Chronically-ill
Egyptian Patients in Tertiary Care Centers
*Hend A Elsheimy1, Ahmed Yamany Ali1, Rajia A Tawfik2, Farah M Ezzat2, Abeer Attia3, Shereen Esmat3
1 Internal Medicine Department, 2House Officers, 3 Public Health and Community Medicine Department, Faculty of
Medicine, Cairo University, Cairo, Egypt
*Corresponding author: Hend A Elsheimy, Email: hendaelshemy@gmail.com,
Mobile: +201091648680, https://orcid.org/0000-0001-8790-9804
ABSTRACT
Background: COVID-19 caused a high level of morbidity and mortality. All age groups are at risk to acquire infection,
especially chronically-ill patients; however, there is a hesitancy toward vaccines among them.
Aim of the work: The study aims to assess the prevalence of Covid-19 vaccine hesitancy and to identify the underlying
factors among chronically-ill patients. Methods: An analytical cross-sectional study was conducted at the outpatient
clinics of the Internal Medicine Department at Kasr Al-Ainy Medical school. A self-administered Arabic questionnaire
was distributed by the researchers to the patients surveying the acceptance rate of vaccination.
Results: A total of 587 participants ruled in the study, and their response rate was 78.2 %. The prevalence of COVID-
19 Vaccine hesitancy was 29.8%, and the main underlying causes of vaccine hesitancy were fear of the complications
of vaccination and fear of the deterioration of chronic diseases (36.4% & 25.5 %) respectively. A statistical significance
was detected between vaccine hesitancy and many factors such as (gender, educational level, smoking status, type of
chronic disease, and attitude toward the safety of vaccine) P 0.001. Multiple logistic regression models yielded that
significant predictors for vaccine hesitancy were females (OR 2.119), Illiterate (OR 1.73), not working in medical field
(OR 2.311), using sources of knowledge other than Ministry of Health Website (OR 3.716), non Hypertensive (OR
1.45), having autoimmune diseases (OR1.68).
Conclusions: Relatively significant Covid-19 vaccine hesitancy among chronically-ill patients is influenced by gender,
educational level, smoking status, attitude toward safety of vaccine, and source of knowledge regarding the vaccine.
Keywords: COVID-19, Vaccine hesitancy, Chronically-ill, Morbidity, Mortality
INTRODUCTION
influenced by the perceived threat of this pandemic,
The COVID-19 pandemic has been a major public
perceived benefits, barriers to vaccination, presence of
health problem all over the world since 2020 as it causes
comorbidities, and low educational level (18,19,20).
high-risk morbidities and mortalities (1,2,3). All age
It was also reported that chronic patients have a high
groups are at risk for infection, however, chronically ill
hesitancy regarding the vaccine in lower-income
patients are five times more likely to acquire infection
countries which may be related to a lack of
and develop more serious complications (4,5).
communication and false information regarding the
vaccine (21,22).
Since the emergence of the pandemic, no definite
treatment has been identified (6), which mandated that
There is a paucity of studies that assess vaccine
global health organizations find a way to prevent and
hesitancy among chronically ill patients in Egypt. So the
protect from such a disease. In this context, many
study aims to identify the acceptance degree towards
vaccines have been developed (7).
COVID-19 vaccination and underlying factors for
vaccine hesitancy among chronically ill patients.
Vaccination is considered one of the best preventive
measures to control infectious diseases (8), also
MATERIALS AND METHODS:
vaccination reduces the transmission of infection among
Study design and allocation:
people. So, it was declared that vaccination plays a role
The study is an analytical cross-sectional study that
in controlling the spread of the disease (9,10,11). Many
was implemented among chronically ill patients
types of vaccines against (SARS-CoV-2) have been
attending outpatient clinics and /or admitted to the
developed and distributed to reduce the risk of infection
Internal Medicine wards, of Kasr Al Aini Hospital,
with COVID-19 (12,13 ).
Cairo, Egypt.
All patients suffering from chronic illness such as
The acceptance rate of vaccination against COVID-19
diabetes mellitus, hypertension, chronic kidney, chronic
is variable from one country to another. Whilst most
rheumatic, autoimmune, or respiratory diseases, and
developed countries have an impacted response to the
also those who have concurrent malignancy whether
vaccination (14,15), in Egypt, there is still a lack of
catching COVID-19 infection or not, were included in
accomplishment of across-country vaccination.
the study.
Overall the acceptance rate of vaccination has been
Those who refused participation were ruled out.
estimated to be very low in Africa. (16,17) This might be
attributed to the individual's behavior which is
536
Received: 08/08/2022
Accepted: 09/12/2022
c:\work\Jor\vol901_76
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 542-546
Laparoscopic Cholecystectomy within 24 Hours Following Endoscopic Retrograde
Cholangiography as a Good Option for the Treatment of Cholecysto-Choledocholithiasis
Ibrahim Sabry Bakr 1*, Ahmed Alwaseif 2, Alshimaa Alaboudy 3, and Yasser Hussein Metwally 1
1. Assistant Professor of General Surgery, Faculty of Medicine, Al-Azhar University, Egypt
2. Consultant of Gastroenterology, Sultan Qaboos University Hospital, Muscat, Oman
3. Lecturer of Tropical Medicine and Gastroenterology, Sohag University, Sohag, Egypt
Corresponding author: Ibrahim Sabry Bakr, Mobile: +966566454748,
ORCID: 0000-0001-7226-3684, Email: Isb11117777@gmail.com
ABSTRACT
Background: Endoscopic retrograde cholangiopancreatography (ERCP) followed by laparoscopic cholecystectomy (LC)
is a preferred treatment option for combined cholelithiasis and choledocholithiasis. Numerous studies have investigated the
optimal timing of LC after ERCP, which can be early (within 72 hours) or delayed for 6 to 8 weeks.
Objective: The aim of the current study is to evaluate the laparoscopic cholecystectomy within 24 hours following ERCP,
as an option for the treatment of cholecysto-choledocholithiasis.
Patients and methods: A total of 200 consecutive patients with combined cholelithiasis and choledocholithiasis, diagnosed
by abdominal ultrasonography and magnetic resonance cholangiopancreatography, were included in our study. All patients
underwent therapeutic ERCP, with sphincterotomy and stone extraction, followed by LC within 24 hours. The post-ERCP
complications, the operative time, intraoperative blood loss, intraoperative severity of gall bladder adhesion, postoperative
complications, and hospital stay were recorded and studied.
Results: Among the 200 patients included, their mean age was 34 years. Of them 120 (60%) were females. Only 60 (30%)
patients originally presented with biliary pancreatitis. Post-ERCP pancreatitis was recorded in 20 (10%) patients. The mean
duration of laparoscopic cholecystectomy was 40 minutes (range 30-60) with minimal blood loss. Moderate to severe gall
bladder adhesion was detected in 60 (30%) patients. In addition, intraoperative moderate to severe cholecystitis was
detected in 80 (40%) patients. The post-cholecystectomy complications included ileus (N=10; 5%) and superficial wound
sepsis (N=8; 4%). The mean hospital stay was 4 days (range 3-5).
Conclusion: ERCP followed within 24 hours by laparoscopic cholecystectomy appears to be an effective choice for treating
cholecysto-choledocholithiasis.
Keywords: ERCP, CBD stone, Laparoscopic cholecystectomy, Choledocholithiasis, Cholecystolithiasis, Case series, Al-
Azhar University.
INTRODUCTION
early LC after ERCP, can reduce recurrent biliary
Gallbladder stone is one of the most common diseases
complications and post-LC complications [6].
worldwide. It is commonly seen in middle-aged females.
The timing between the ERCP and LC, as well as the
It is the main cause of at least one million hospitalizations
order in which the two procedures should be performed,
[1]. Despite the low mortality rate (0.6%) associated with
is debatable. Liu et al. advocated that ERCP should be
this disease, there are a variety of complications that may
followed immediately by LC. The majority of biliary
arise from it. Concomitant bile duct stone occurs in 10
occurrences in the interval following ERCP may be
18% of patients with gallbladder stones and varies
avoided by early LC, according to their findings and early
according to age. About 55% of patients are symptomatic,
LC appears to be generally safe [7]. Yet, other studies
and half of those experience complications [2]. Many
favor delayed LC [8].
treatment options are currently available for combined
In the current study, we aimed to evaluate the LC within
cholelithiasis and Choledocholithiasis. This included
24
hours
following
endoscopic
retrograde
endoscopic
retrograde
cholangiopancreatography
cholangiopancreatography (ERCP), as a treatment option
(ERCP) followed by laparoscopic cholecystectomy (LC),
for cholecysto-choledocholithiasis.
LC with intraoperative ERCP, laparoscopic common bile
duct exploration, and open common bile duct exploration.
PATIENTS AND METHODS
Among those treatment options, ERCP followed by LC
A total 250 consecutive patients with combined
appears to be the safest and the least invasive [3,4].
cholelithiasis and choledocholithiasis were studied. This
Manes et al. mentioned that there is a 4% to 24% risk of
study was conducted at Al-Dar Private Hospital in Saudi
biliary complications following ERCP if the LC is not
Arabia, from January 2013 to January 2020. All patients
performed early after the surgery. Additionally, they
underwent full clinical assessment, full laboratory
noted that LC difficulties and the rate at which
investigations, and abdominal ultrasonography. In
laparoscopic cholecystectomies are converted to open
patients with doubtful etiology of CBD dilatation CT
procedures both increased after a 6- to 8-week post-ERCP
and/or MRCP were done mainly to roll out malignancy.
interval [5]. On the other hand, it had been advocated that
542
Received: 20/09/2022
Accepted: 20/10/2022
c:\work\Jor\vol901_77
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 547-554
Silent Brain Changes in Children with Sickle Cell Disease
Al Shaimaa Mahfouz Abdel Rahman1, Tamer Elzaeem Ismail1,
Mohamed Hashim2, Ebtihal Mokhtar2, Mohammad Fouad Abdel-Baki Allam1
Departments of 1Diagnostic Radiology and 2Pediatric, Faculty of Medicine, Minia University, Egypt
*Corresponding author: Mohammad Fouad Abdel-Baki Allam, Mobile: (+20) 201005695624, E-Mail: mfallam@mu.edu.eg
ABSTRACT
Background: Cerebrovascular steno-occlusive disease constitutes one of the most dangerous complications of sickle cell
disease (SCD). It could result in overt or silent cerebral infarctions (SCI).
Objective: The aim of this study was to demonstrate silent parenchymal and vascular brain changes that are incidentally
observed in neurologically free SCD children using screening MRI and MRA.
Patients and methods: This prospective cross-sectional study was conducted on 78 children diagnosed with SCD who
were neurologically free. Magnetic resonance imaging (MRI) and Magnetic Resonance Angiography (MRA) were done to
all the participant children. Results: Thirty (38.4%) of our children demonstrated pathologic parenchymal features on their
MRI. There were 29 (37.17%) patients had pathologic changes in MRA; 6 of them had isolated vascular abnormality,
whereas the remaining patients had concurrent parenchymal abnormalities. There was significant high positive correlation
between low hemoglobin and presence of silent cerebral infarction (SCI). Moya-moya vasculopathy showed significant
positive correlation with arterial occlusion and old SCI. HB SS phenotype was significantly correlated with moya-moya
vasculopathy, arterial occlusion and old SCI. Conclusions: Silent cerebral and cerebrovascular changes in SCD children
are frequent abnormalities requiring utilization of MRI and MRA to find out their exact prevalence and their risk factors.
Keywords: Sickle cell disease, Silent brain infarction, Moya-moya vasculopathy, Screening MRI, Screening MRA.
INTRODUCTION
Sickle cell disease (SCD) is an inherited
incidentally or through screening magnetic resonance
haemoglobinopathy, which is a severe monogenic
imaging (MRI). Furthermore, cerebrovascular steno-
condition that affects millions of people worldwide, and
occlusive disease could result in moya-moya
characterized by formation of abnormal hemoglobin
vasculopathy, which could be considered as another
called Hb S, repeated cycles of sickling and unsickling,
silent change developed when the arterial narrowing
multiple episodes of vascular obstruction, and hemolytic
occurs over a long period of time allowing for formation
anemia (1). During sickling process, interaction between
of collateral pathways (6, 9). The aim of our study was to
the rigid sickle cells and the vascular wall leads to,
screen silent parenchymal and vascular brain changes in
intravascular thrombosis and subsequent end-organ
neurologically free children diagnosed with SCD using
ischemia (1, 2). Stroke caused by vaso-occlusion is a
MRI and MRA.
major complication of SCD. Its risk is greatest early in
PATIENTS AND METHODS
childhood during the first decade and is most significant
This was a prospective cross-sectional study
at the age of two to five years. Children with sickling are
that was conducted from May 2022 to November 2022
more susceptible to have stroke 250 times than for those
after being ethically approved by the institution
without SCD (3). Silent cerebral infarction (SCI) could be
committee (Approval no: 512/2022).
seen in some cases, which often go unnoticed but may
cause significant neurological damage and disability up
Study participants
to 17% to 25% of SCD patients (4).
Seventy-eight children diagnosed with SCD
Silent stroke is much more common than
were included in the study, all of them had regular
manifested one, which has declined in the last decade
follow ups in the Pediatric Hematology Outpatient's
with the use of chronic transfusion therapy and
Clinic, Minia University Children Hospital, Egypt. All
transcranial Doppler (TCD) ultrasonography (5, 6). It is
patients underwent thorough medical history tacking,
believed that SCI may increase the risk of overt stroke.
complete clinical and neurologic examination as well as
In brief, the major hypothesis is that prophylactic blood
laboratory tests including CBC, differential white blood
transfusion therapy in children with SCD with silent
cell count, serum ferritin, and renal function tests. MRI
cerebral infarcts will result in at least 86% reduction in
and MRA were done to all the participant children.
the rate of subsequent overt strokes or new or enlarging
Informed written consent was obtained from the parents
cerebral infarcts as defined by MRI of the brain (6-8).
of each patient prior to participating in the study.
By definition, SCIs are clinically silent, they
Inclusion criteria: SCD children below 18 years who
have normal neurologic examination and, in some cases,
were neurologically free with no history of neurological
normal TCD study, subsequently. SCI are identified
dieses.
547
Received: 21/07/2022
Accepted: 23/09/2022
c:\work\Jor\vol901_78
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 555-560
Correlation of Retinal Sensitivity in Psoriasis and Psoriatic Arthritis with
Tumour Necrosis Factor Alpha and Pigmented Epithelium Derived Factor
Ghada A. Abd El-Aziz1, Sawsan A. Shalaby2, Amal A. Morsy3, Naglaa A. Ahmed 4,
Marwa S. Mahmoud5, Eman M. El Mahdy6, Jihan A. Mohamed7*
1,4.5,6 Department of Dermatology, 2,7 Department of Ophthalmology,
3Department of clinical Pathology, Faculty of Medicine for Girls, Al-Azhar University, Cairo, Egypt
* Corresponding author: Jihan A. Mohamed, Mobile: (+20)1005282408, E-mail: Jihan.Abdallah@azhar.edu.eg
ABSTRACT
Background: Early recognition is crucial because the natural course of psoriasis (Ps) may result in vision loss. Psoriatic
arthritis (PsA) patients with ophthalmological manifestations of psoriasis (Ps) account for 30% of cases. Assessment of
visual functions and correlation with blood levels of tumour necrosis factor-alpha (TNF- ) and pigmented epithelium
derived factor (PEDF) were the study's main goals in Ps and PsA patients.
Objectives: to assess visual functions in Ps and PsA patients and correlate them with serum levels of tumour necrosis
factor-alpha (TNF-) and Pigmented Epithelium Derived Factor (PEDF).
Subjects &Methods: This case-control study involved 60 Ps patients, 30 of whom had Ps without arthritis and 30 of
whom had PsA, 30 age and sex-matched healthy individuals were included, representing the control group. Serum levels
of both TNF- and PEDF were measured by enzyme-linked immune sorbent assay and complete ophthalmological
examination of the anterior and posterior segment by slit-lamp Biomicroscopy, best corrected visual acuity, intraocular
pressure, and visual field using automated perimetry.
Results: Visual affection in PsA patients was affected more than psoriatic patients with positive correlation with serum
TNF- level and negative correlation with PDF. High statistically significant increase in serum TNF- level with the
severity of both Ps and PsA P= 0.000. Also, high statistically significant increase in mean deviation (MD) and increase
the negativity of PSD. High statistically significant increase in TNF and decrease in PEDF levels were found between
patients and control (p = 0.001) with a higher significant difference (p =0.000) in PsA patients
Conclusion: To prevent vision impairment, patients with Ps and PsA should receive routine ophthalmological tests to
evaluate their visual functions and spot potential ocular involvement.
Keywords: Visual affection, Ps Vulgaris, Psoriatic Arthritis, TNF-, PEDF.
INTRODUCTION
PATIENTS AND METHODS
In particular, ocular manifestations of psoriasis,
This case-control study included 60 patients (30
which is an immune-mediated, chronic inflammatory
patients with Ps Vulgaris) and the patient group (which
disease with genetic underpinnings, have been noted.
included 30 people with psoriatic arthropathy) was
These manifestations include reduced retinal
chosen. A control group of 30 healthy people who were
sensitivity, retinal disorders, blepharitis, dry eye,
matched for age and sex was also included. The study
conjunctivitis, keratitis, uveitis, and birdshot
was conducted between January 2020 and January
chorioretinopathy (1). The severity of Ps vulgaris has an
2022, all patients were drawn from Al-Zahraa
impact on the retinal sensitivity (2).
University Hospital's Outpatient Clinic.
TNF- is essential for a healthy immune response.
The immune system can be activated to regulate by
Inclusion criteria: This study included patients with Ps
TNF-, but excessive or improper TNF- production
Vulgaris and PsA who were diagnosed using the
can be damaging and can result in Ps and PsA (3). Bone
CASPAR criteria for PsA and were aged from 20 to 50
remodeling
encourages
osteoclastogenesis
by
years.
increasing the frequency of osteoclast precursor cells
Exclusion criteria: Other autoimmune diseases such
and upregulating receptor activator of nuclear factor
systemic lupus erythematosus, rheumatic, high uric
kappa-B ligand (RANKL) in synovial tissue, which
acid, vasculitis, neurological diseases, and space-
causes increased bone resorption. TNF- is a dominant
occupying lesions). Systemic or ocular disease,
cytokine in PsA (4).
hypertension, diabetes mellitus, and other autoimmune
One of the most prevalent adipokines, PEDF is
diseases. Color vision issues, cataracts, uveitis, the use
found in a variety of human tissues (5).
of systemic topical retinoic acid or immunosuppressive
It is a secreted protein with multiple activities,
medications, and UV therapy. Optic neuropathy, high
including anti-angiogenic, anti-metastatic, anti-
refractive errors, glaucoma, retinal detachment, retinal
inflammatory, antioxidative, and neurotrophic. It has
pigment changes, and active or past retinol choroiditis.
primarily been investigated in the eye, where disorders
like age-related macular degeneration and diabetic
Ocular examination: Best corrected visual acuity
retinopathy cause changes in its levels there (6).
(BCVA) at a distance using Landolt's C chart and
assessment of the refractive status using an auto
555
Received: 18/07/2022
Accepted: 20/09/2022
c:\work\Jor\vol901_79
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 561-568
Association of GATA3 Rs3824662 Gene Polymorphism with Response to
Induction Therapy in Acute Lymphoblastic Leukemia
Amna Muhammed Salih 1, Jaffar Nouri Jaffar Alalsaidissa 2
1 Ibn Al-Bitar Center for Cardiac Surgery, Baghdad, Iraq
2 Department of Pathology and Forensic Medicine, College of Medicine, University of Baghdad, Baghdad, Iraq
Corresponding Author: Amna Muhammed Salih, Email:amnamuhammed485@gmail.com, Mobile: 07814957600
ABSTRACT
Background: The malignant transformation and multiplication of lymphoid precursor cells in the bone marrow, blood,
and extramedullary tissues is known as acute lymphoblastic leukemia. ALL susceptibility has been linked to the GATA3
SNP rs3824662. Numerous studies have found a link between the rs3824662 risk allele and a worse prognosis and
relapse.
Aim: To evaluate the frequency of GATA3 gene single nucleotide polymorphism (SNP rs3824662) in newly diagnosed
Iraqi patients with acute lymphoblastic leukemia and its correlation to response to induction therapy.
Patients and methods: A cross-sectional study was conducted on 53 patients (33 adult and 20 pediatric patients) with
newly diagnosed acute lymphoblastic leukemia. Sanger sequencing polymerase chain reaction-based techniques have
been employed by us to enable the detection of GATA3 rs3824662 gene polymorphism.
Results: For the adult group genotype frequency of GATA3 rs3824662 wild type (CC) was 19 (57.6%) of patients, and
heterozygous state (CA) genotype was detected in 14 (42.4%) of patients while the homozygous state (AA) genotype
was not detected in the adult group of this study. In the pediatric group of ALL patients wild type (CC) was detected in
11 (55%) of patients, the heterozygous state (CA) genotype was present in 6 (30%) of patients, while the homozygous
state (AA) genotype was detected in 3(15% ) of patients. There was no significant association between the GATA3
rs3824662 genotype and response to induction therapy, p-value = 0.54.
Conclusion: The GATA3 rs3824662 AA genotype and A allele could be risk factors for childhood and adult acute
lymphoblastic leukemia. There was a nonsignificant association between the GATA3 rs3824662 genotype and response
to induction therapy
Keywords: GATA3 rs3824662, Acute lymphoblastic leukemia, Single nucleotide polymorphism.
INTRODUCTION
Acute lymphoblastic leukemia (ALL) is a clonal
T cells. The thymus's functions in the CD4 versus CD8
hemopoietic stem cell condition that is defined by the
lineage option and at the - selection checkpoint during
growth of blasts with little to no differentiation, which
T-cell development are best understood (5). Early B-cell
are typically B-cell or T-cell precursors. Assessing
commitment requires transcriptional regulation of
disease prognosis and choosing current and better
GATA3, a crucial early regulator of innate lymphoid
treatments to require an understanding of blast lineage
cells (6).
(1).
GATA3, which has been demonstrated to be
It was characterized by somatically acquired
expressed in multipotent hematopoietic stem cells,
genomic alterations, but research over the past ten years
regulates the equilibrium between self-renewal and
has revealed that genetic polymorphisms that are
differentiation in hematopoietic stem cells (HSCs) (7,8).
inherited (germline) have a significant role in the
variability in susceptibility between patients to ALL,
MATERIALS AND METHODS
drug action, and side effects of treatment. Germline
Patients:
variants strongly linked to ALL susceptibility have been
A cross-sectional study was done on 53 patients
discovered using genome-wide association studies(
(33 adult and 20 pediatric patients) who are newly
GWAS), which has led to a new understanding of the
diagnosed with acute lymphoblastic leukemia. The
driving forces behind leukemogenesis and evidence of
collection period was from December 2021 to May
the intricate correlation between inherited and acquired
2022. The patients were seen and followed up in the
genetic variants in ALL (2).
Hematology Unit at Baghdad Medical City and Central
The GATA3 gene is situated at location p14, close
child's hospital.
to the end of the short arm of chromosome 10. The
For each patient, a questionnaire form was done
GATA3 SNP rs3824662 corresponds to 10p14 and is
including the patient's general information, past and
located in intron 3 of the transcription factor (3). A
recent medical history, and results of blood and flow
transcription factor required for early T-cell
cytometry tests.
development and lymphoid cell lineage commitment is
Bone marrow and peripheral blood were used to
encoded by GATA3 (4).
monitor patients following the induction therapy to see
GATA3 has been referred to as a vital regulator
their response to treatment.
of T-helper 2 (Th2) cell development in matured CD4+
561
Received: 05/12/2022
Accepted: 07/12/2022
c:\work\Jor\vol901_80
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 569-574
Ratio of Tricuspid Annular Plane Systolic Excursion to Systolic Pulmonary
Artery Pressure in Patients with Heart Failure with Preserved Ejection Fraction
Ragab A Mahfouz, Haitem Najmeddein Ali, Alaa Salama, Mohamed Salah Abdelbasit*
Cardiology Department, Faculty of Medicine, Zagazig University, Egypt
*Correspondence author: Mohamed Salah Abdelbasit, Mobile: +2 01092791494, Email: msa_20122002@yahoo.com
ABSTRACT
Background: Tricuspid annular plane systolic excursion (TAPSE) connected to pulmonary artery systolic pressure
(PASP) may enhance prognosis in heart failure with an adequate ejection fraction.
Objective: The aim of the current study is to evaluate the applicability of TAPSE in cases with heart failure and
preserved ejection fraction (HFpEF), which is indexed to PASP.
Patients and methods: The present study included 75 patients with HFpEF. They were divided into 2 groups depend
on the results of 6-minute walking test. Group I included 49 patients with good exercise tolerance and Group II included
36 patients with reduced exercise tolerance.
Results: The TAPSE/PASP ratio has a sensitivity of 83.5% and a specificity of 79.3% for detecting individuals with
reduced exercise intolerance, with an area under the curve (AUC) of 0.834 (95%CI: 0.753-0.916, P <0.001).
Conclusion: A relevant clinical indicator of the length/force relation may be the correlation between longitudinal RV
fibre shortening (TAPSE) and developed pressure (PASP), and the ratio of 2 variables may be more reliable than either
of the two measures alone in predicting the severity of disease.
Keywords: TAPSE, Right ventricular function, Heart failure, Case control study, Zagazig University.
INTRODUCTION
PATIENTS AND METHODS
A crucial indicator of prognosis for certain
A cross-sectional study was conducted at
cardiovascular diseases, right ventricular (RV)
Cardiology Department, Zagazig University Hospital,
malfunction is one of the heart failures that include the
from Heart Failure Clinic. Included patients were
left side. Maladaptive RV remodel ing is connected to
diagnosed with HFpEF (EF more than 50%, Symptoms
RV myocardial dilatation, sarcomere changes, fibrosis,
of HF, Signs of HF, Evidence of diastolic dysfunction)
capil ary rarefication, and metabolic problems, is a
and functioning classes I through III of the New York
common complication of ischemia and non-ischemic
Heart Association (NYHA) were included.
cardiomyopathy. These alterations result in right side
Cases with greater mild mitral regurgitation, severe
heart failure (HF) and progressive RV dysfunction (1).
arrhythmias, limited physical activity caused by
conditions other than cardiac symptoms, such as
With rising prevalence and morbidity, on a global
arthritis, and those with clinical signs of cardiac
level, a significant public health issue is HFpEF.
decompensation were excluded from the study.
Despite the fact that modern medicinal methods have
Every patient had a thorough medical history
increased life quality, mortality rates are stil high (2).
Determinants of functional ability in individuals with
review and physical assessment. Thereafter, laboratory
tests included lipid profile, kidney profile, hemoglobin,
HFpEF have not been thoroughly studied. The 6-minute
fasting blood glucose levels, brain natriuretic peptide.
walk test (6-MWT) has been utilized to objectively
Al patients underwent standard 12-lead ECG
assess activity ability in the context of HF. For
recordings during both rest and stress.
individuals
with
HFrEF,
several
resting
echocardiographic indicators indicated limited exercise
Echocardiography was performed for al
ability; however, none of these markers are related to
participants: The apical 2 and 4 chamber photos were
functional ability in people with HFpEF (3).
utilised to determine the LV volumes and EF utilizing a
modified Simpson's technique. The M-mode cursor was
People with HF and reduced left ventricular (LV)
placed at the lateral, septal, and tricuspid ring angles to
ejection fraction (HFrEF) as wel as those with HF and
track the movement of the ventricles along their long
retained LV ejection fraction (HFpEF) have revealed
axis. Like I said previously, peaks from the inside to the
that the TAPSE/PASP ratios can predict serious adverse
outside were used to calculate the long axis motion's
outcomes (4).
overal amplitude (5). The M-mode cursor was put at the
position of the aortic valve leaflets to estimate the left
The aim of the current study is to evaluate the
atrial diameter from recordings of the aortic root.
applicability of TAPSE in cases with heart failure and
Area-length measurements of LA volumes were
preserved ejection fraction (HFpEF), which is indexed
made from the apical four chamber images. Left atrial
to PASP.
maximal volume (LAV max) and left atrial minimal
volume (LAV min) were assessed at the conclusion of
569
Received: 20/10/2022
Accepted: 20/12/2022
c:\work\Jor\vol901_81
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 575-584
Impact of Home-Based Self-Isolation Abiding on Outcome of
COVID-19 Patients: An Exploratory Study in Egypt
Eman Hany Elsebaie1, Amany Ahmed Salem1, Mennatallah Said Hosney Shehata1,
Mohamed Tharwat Hegazy2, Ibrahim Naguib El Ebrashi3, Ahmed Sayed Kotb3,
Mariam Amr Amin3, Yousra Elsayed Diab3, Fady Nagy3, Sobhi Eid Rizk3, Christina Samir Ragheb3,
Alaa Abdallah Salah3, Hadeel Abd El Wahab4, Maha Hossam Al-Din Ibrahim3, Mohamed Abdelkader Morad5
1Public Health & Community Medicine Department, 2 Rheumatology and Clinical Immunology Unit, Internal Medicine
Department, 3 Internal Medicine Department, 4 Department of Chest diseases, 5 Clinical Haematology Unit, Internal
Medicine Department, Kasr Alainy, Faculty of Medicine, Cairo University, Cairo, Egypt
Corresponding author: Eman Hany Ahmed Elsebaie Email: eman.elsebaei@kasralainy.edu.eg Tel: 01005645129
ABSTRACT
Background: The ongoing Coronavirus Disease 19 (COVID-19) pandemic has caused an increased burden on healthcare
organizations and public health resources.
Objective: This study aimed to examine the potential impact of home-based self-isolation on health-related outcomes of
patients suffering from COVID-19, to assess patients' and household contacts' compliance to physicians' instructions while
isolated at home, and to explore predictors affecting home-based self-isolation compliance.
Methods: A cross-sectional analytical study of 393 mild/moderate adult cases of COVID-19 patients referred to home
isolation by Cairo University Hospital through the period from June 1st to September 30, 2020.
Results: The proportion of patients admitted to the hospital while isolated at home was 76 (19.3%). When examining the
factors contributing to hospital admission among the home isolation instructions measures, we found that 74.5% of those
who abide by the home isolation rules were not hospitalized compared to 25.5% hospitalized (P-value<0.001; OR= 11.8;
95% CI: 3.6538.59). The infection rate among household contacts while patients isolated at home was 38.42%. About
66.8% of those who abided by the home isolation instructions did not infect contacts compared to 33.2% who got infection
(P-value=0.001; OR= 2.207; 95% CI: 1.4044.807). Significant predictors for compliance with home-based isolation
instructions were the presence of hypertension, previous hospitalization, and absence of chronic liver diseases.
Conclusion: Compliance with isolation instructions and conforming to infection and control procedures are important
factors to decrease hospital visits and infection rates among household contacts.
Keywords: COVID-19, Home isolation, Outcome, Egypt, Impact, Feasibility, Follow-up.
INTRODUCTION
Coronavirus disease-2019 (COVID-19) is an
resources limited, home-based self-isolation is a key
infectious disease of pandemic proportions, with more
public health strategy to curb the spread of the pandemic
than 85,000,000 cases and approximately 1,800,000
under the country's coronavirus treatment protocol, mild
deaths reported worldwide as of January 3, 2021 (1).
and moderate COVID-19 patients are treated at home or
COVID-19 is a public health emergency of
at the university hostels, to free up beds for critical cases
international concern (2), and as such, it requires
at isolation hospitals. The total number of home-isolating
coordinated, protective responses from national and
coronavirus patients in Egypt has so far reached 10,168
supranational entities around the world. The absence of
cases since the health ministry launched its program for
specific preventive or therapeutic medical interventions
non-hospitalized cases in July 2020 (5).
for COVID-19 infection, alongside its rapid transmission
Home-based self-isolation, however, has several
rate
and
apparently
substantial
undocumented
important limitations. For one, home-based isolation is
contamination and transmission numbers, has led to the
not effective in preventing transmissions within
scientifically sound recommendation that individuals
households. In China, before the implementation of
must stay home to avoid social interactions and restrain
facility-based isolation, more than half of COVID-19
the disease spread, thereby reducing pressure on health
patients had at least one family member with the disease,
systems worldwide. Therefore, physical distancing,
and 75-80% of all clustered infections occurred within
intensive contact tracing, and case isolation remain
families (6,7). In New York City, 66% of COVID-19 cases
frontline measures in controlling the spread of COVID-
were people who had stayed in their homes (8), suggesting
19 infection (3).
high rates of intra-family transmission of COVID-19.
In Egypt, with a population of over 100 million,
Furthermore, it is difficult to achieve high compliance
since most cases of COVID-19 are mild (4) and health care
with home-based isolation (9).
575
Received: 20/07/2022
Accepted: 22/09/2022
c:\work\Jor\vol901_82
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 585-589
Effect of Covid19 Vaccination on Semen Parameters in Sample of
The Egyptian Male in Upper Egypt
Ali Mahram, Hatem Kamal, Mohamed Elmahdy Abdelmotaleb*
Department of Dermatology, Venereology and Andrology, Faculty of Medicine, Assiut University Hospital, Assiut
*Corresponding author: Mohamed Elmahdy Abdelmotaleb, Mobile: (+20) 0109 866 5809,
E-mail: m_mahdy_teama@yahoo.com,
ABSTRACT
Background: Despite the safety and efficacy of mRNA COVID-19 vaccines against SARS-CoV-2, immunisation rates
have stalled.
Objective: This study aimed to assess the effect of the COVID-19 immunisation on semen parameters in comparison
with unvaccinated males.
Patients and Methods: Semen analysis was used to survey adult males in Egypt between March and October 2022
before and 3 and 6 months after immunisation.
Results: Regardless of immunisation status or prior COVID-19 medical history, 220 men who are now above the age
of 18 and reside in Upper Egypt are eligible to participate in the survey. Respondents have to be at least 18 years old
and have never had main or secondary infertility identified by a doctor. The results of the multivariable adjusted analysis
showed that semen parameter affliction was not linked to COVID-19 immunisation.
Conclusion: Overall, this cross-sectional study revealed that males 18 years of age and older did not have an elevated
risk of alteration of semen parameters following COVID-19 immunisation.
Keywords: Coronavirus disease-19, Semen, Vaccination.
INTRODUCTION
patients have a higher risk of COVID-19-induced
As of December 5, 2022, there have been over
testicular injury than older ones (5).
650 million confirmed cases of the COVID 19
The
secondary
immunological
and
pandemic, which is brought on by the severe acute
inflammatory response, which is increased during the
respiratory syndrome coronavirus 2 (SARS CoV 2).
severe viral infection in the testicles due to the high load
This has been a huge public health issue throughout the
of virus in the blood stream going to testicles, has also
world. Despite the fact that the condition mostly attacks
been theorised as a potential cause of testicular injury
the lungs, it can also harm the heart, kidney, liver, and
(1).
testicles (1). The global SARS-Cov-2 epidemic caused a
Through a variety of pathogenic pathways, such
significant blow to sexual relations (1). Due to the limits
as increased oxidative stress and increased DNA
imposed by the various states and the general public's
methylation and fragmentation, COVID-19 infection
perception of the virus as a threat. COVID-19 has
may also reduce male fertility (2). The ace enzyme has
altered social connections around the world. These
the potential to directly harm spermatocytes and Leydig
changes completely overcame us in a short amount of
cells. In addition, persistently elevated blood
time, giving little time for our bodies and minds to
temperatures during active viral infections might harm
adjust to the new situation. The mental stability of each
the blood-testis barrier (BTB), allowing viruses to enter
person has been put to the test by their distress over the
seminiferous tubules (6). This demonstrates how
state of the world and their constant exposure to pictures
testicular infection brought on by SARS-CoV-2 induce
of illness and death (2).
orchitis that may harm BTB and cause virus to leak into
Numerous studies have demonstrated that
semen. Therefore, hypothetically, it is possible that
COVID 19 vaccines have no impact on a man's ability
COVID-19 infection might harm the testicular cells,
to engage in sexual activity after being exposed to
which are the virus's potential target, and ultimately
various vaccines in various regions throughout the
result in infertility (7).
world (3). Due to the fact that ACE2 receptors are crucial
The safety of these vaccinations has been
in the pathophysiology of COVID-19 (4). Therefore, the
established via a number of clinical trials, but their
virus may directly harm cells that express ACE2 at high
effect on male fertility has not yet been examined.
levels. Numerous studies have demonstrated that
Studies have revealed that SARS-CoV-2 infection has a
testicular cells such as seminiferous duct cells,
considerable deleterious influence on sperm parameters
Spermatogonia, Leydig cells, and Sertoli cells have
(7, 8, 9). According to a Chinese research, 37% of
significant levels of ACE2 expression (3). Age is
individuals assessed had less sexual activity in the early
associated with this expression of ACE2 in testicular
stages of the epidemic. In that research, 44% of
cells. In a study, it was discovered that the expression
participants reported having fewer sexual partners (9).
was highest in patients aged 30 years, higher than
Holtmann and coworkers (10) provided the
people in their twenties, and lowest in patients 60 years
initial report on the effects of SARSCoV-2 infection on
of age and older. This may suggest that younger male
semen parameters. They discovered that individuals
with severe infections had impaired semen parameters,
585
Received: 20/07/2022
Accepted: 22/09/2022
c:\work\Jor\vol901_83
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 590-594
Response of Immune System and Wound Healing to
Laser Puncture in Burned Patients
Mohamed Maher Elkeblawy1, Amany Gomaa Atiaa Farag2*,
Salah El-Din Abdel-Ghani Mohamed3, Khadraa Mohamed Ali4
1- National Center of Research, Egypt,
2-Department of Physical Therapy for Surgery, Faculty of Physical Therapy, Heliopolis University, Egypt,
3-Department of General and Plastic Surgery, Faculty of Medicine, Kasr Al-Aini, Cairo University, Egypt,
4-Department of Physical Therapy for Surgery, Faculty of Physical Therapy, Cairo University, Egypt.
Corresponding author: Amany Gomaa Atiaa Farag,Email: dr.mony_555@yahoo.com, Mobile: +201223002855
ABSTRACT
Background: laser acupuncture due to its anti-inflammatory and immunocorrection action has great role in improving
immunity parameters (neutrophils and total lymphocytes) and accelerate wound healing in patients with depressed
immune system after burn.
Aim: This study aimed to investigate the response of immune system and wound healing of laser puncture in burned
patients through comparing the impact of laser puncture and routine medical treatment on treatment of burned patients.
Subjects and Methods: After one week of burn injury, sixty patients (31 males and 29 females) suffering from thermal
burn injury (second degree) were randomized into two groups: laser puncture group (A) (n = 30) as well as control group
(B) (n = 30). The intervention was performed 3 sessions each week for two months. Wound measurement working
out surface area in cm² and complete blood cell counts (Neutrophils, total lymphocytes) were evaluated pre- and post-
intervention.
Results: In groups A and B, there was a significant decrease in wound surface area and a substantial increase in
lymphocytes as well as neutrophils post-treatment compared to pre-treatment (p > 0.001).
Conclusions: laser puncture is an effective technique to increase the immunity parameters and wound healing in burned
patients.
Keywords: Immune, Wound Healing, Laser puncture, Burn.
INTRODUCTION
excitation, tissue regenerative, antimicrobial, anti-
Burns are the 4th most common type of injury
inflammatory, and analgesic properties )6(. To the
worldwide, following car accidents, falls, and acts of
author's knowledge, there is no previous study on the
violence )1(. The systemic inflammatory reaction
response of immune system and wound healing of laser
syndrome is triggered by burn injuries and can lead to
puncture in burned patients.
tissue and organ destruction throughout the body )2, 3(.
Neutrophils as well as macrophages are the initial
SUBJECTS AND METHODS
immune cells that reach at the wound site
Randomization and study design
following burn injury that triggers the acute phase of the
A cluster randomised-controlled trial with two
immune reaction )4(. The bone marrow is responsible for
arms was carried out. When patients were admitted,
producing and renewing the blood's neutrophils as well
they were given an identification number. Group 1 was
as macrophages. These innate immune cells clear the
assigned odd numbers, while group 2 was assigned even
body of infections and necrotic tissue through processes
numbers. Before beginning treatment, participants'
called phagocytosis and the generation of reactive
consent was obtained after a thorough explanation of the
oxygen species )5(.
study's details.
Acupuncture (ACU) is an integral part of the initial
response in the multifaceted treatment of burn trauma
Participants:
(BT). The anti-inflammatory, analgesic, and immune-
From the Burn Department of Hehia Hospital in
stimulating effects of ACU, as well as its influence on
Sharqia, Egypt, 60 patients who fulfilled the inclusion
the veins and lymphatic system, all contribute to its
criteria were chosen for this study. Total of sixty
ability to reduce the symptoms of post-traumatic stress.
patients (31 males and 29 females), their ages ranged
When it comes to healing wounds, ACU is crucial,
from 25 to 55 years with thermal burn injury (second
especially for avoiding hypertrophic scarring )6(. All
degree). After one week of burn injury, they were
burn patients, but especially those in mass disasters and
randomized into two groups: laser puncture group (A)
medium and low-income countries, can benefit from
(n = 30) and control group (B) (n = 30).
ACU's easy and inexpensive application. The use of
ACU in BT complex therapy has several benefits,
Inclusion criteria: Patients with ages ranged from 25
including those in the fields of medicine, economics,
to 55 years old, both genders, patients were diagnosed
and psychology, as well as the avoidance of medical-
with 20 to 30% TBSA, and able to follow instructions
law conflicts. Laser acupuncture therapy has bio
or complete self-report scales.
590
Received: 19/07/2022
Accepted: 21/09/2022
c:\work\Jor\vol901_84
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 595-600
Assessment of Maternal Contributing Factors of Preterm Birth in
Soran Maternity Hospital
Fatima Mohammed Azo1, Magroom Esmail Seniar1*, Safiya Sabri Piro2
1 Soran Technical College, Erbil Polytechnic University, Kurdistan Region, Iraq
2 College of Nursing, Dohuk University, Dohuk, Kurdistan Region, Iraq
*Corresponding Author: Magroom Esmail Seniar, Tel.: +9647504473776, ORCID: 0000-0003-2192-5697,
Email: Magroom.seniar@epu.edu.iq
ABSTRACT
Background: Preterm birth has become a global issue owing to its high morbidity and mortality rate. It accounts for
significant medical expenses and places a considerable economic strain on children, families, and healthcare systems.
Objective: This study aimed at determining the maternal risk factors related to preterm birth.
Patients and methods: This cross-sectional study was conducted in Soran Maternity Hospital from 15th November 2019 to
25 th October 2020; the time of data collection was from 20th December 2019 until 30th September 2020. A total of 130
pregnant women with 24-37 gestational weeks and painful uterine contractions admitted to the labor room during the time
of data collection were included in the present research. A self-structured questionnaire was utilized to collect information
from participants. The data were analyzed utilizing SPSS version 20.
Results: The highest percentage, 66.2%, was multiparous, and the commonest maternal contributing factors for preterm
birth were urinary tract infection, vaginal infection, anemia, and hypertension during pregnancy. There was a significant
association between parity, urinary tract infection, pregnant women's age, and risk for preterm birth by gestational age.
Urinary tract infection, vaginal infection, anemia, and hypertension during pregnancy were the most prevalent risk factors
for preterm birth. Conclusions: Early recognition of preterm risk factors can benefit healthcare workers and medical staff
to identify high-risk pregnant women to adopt preventive measures against preterm birth.
Keywords: Preterm birth, Risk factors, Parity, Cross sectional study, Erbil Polytechnic University.
INTRODUCTION
Across 184 countries, its prevalence varies from 5 % to
Preterm birth (PTB) is among the main
18%. The highest preterm birth percentages are in Sub-
complications in pregnant women, affecting 10% of all
Saharan Africa and Asia, accounting globally for half of
pregnancies. One million neonatal deaths happen
the births, over 60% of preterm babies, and over 80% of
annually due to preterm birth. It accounts for significant
neonatal deaths annually (8).
medical expenses and places a considerable economic
Al-Diwan (2006) reported the preterm birth
strain on children, families, and healthcare systems (1).
frequency as 31% in the west (Al-Anbar), 51.8% in the
PTB, the birth of an infant before 37 post-menstrual
east (Diyala), and 50% in the center (Baghdad) of Iraq (9).
weeks (and after 20 weeks gestation), is a dreadful
Preterm birth causes are not known in more than
pregnancy complication with long-term medical and
50% of spontaneous preterm labor, while preterm labor
financial burdens on children, families, and healthcare
mechanisms remain poorly understood. (9) Potentially,
systems (2).
recognizing and understanding the preterm birth risk
In developed countries, preterm labor is the main
factors helps address this issue. Similar to most
cause of perinatal morbidity and mortality, with most
developing countries, Iraq lacks reliable data on the
deaths occurring in neonates with a gestational age
preterm delivery burden. Despite this, few studies have
<32 weeks (3). Recently, the care offered in Neonate
been published locally on the preterm birth burden and its
Intensive Care Units (NICU) has increased the survival of
associated factors. This research aims to determine the
premature neonates while increasing the hospitalization
maternal factors associated with preterm birth.
stay and cost. Accordingly, the care of premature infants
now accounts for a large share of the total in-hospital
PATIENTS AND METHODS
costs globally (4). Overall, 15 million premature births are
This cross-sectional study was conducted in Soran
reported globally per year, (5) about 90% of which happen
Maternity Hospital from 15th November 2019 to 25th
in developing countries in Asia and Africa, even though
October 2020; data collection time was from 20th
preterm labor frequency differs significantly between
December 2019 to 30th September 2020. A total 130
them (6).
pregnant women with a gestational age of 24-37 weeks
Preterm birth has become a global issue owing to
and painful uterine contractions admitted to the labor
its high morbidity and mortality rate. According to World
room during data collection time were included in the
Health Organization (WHO), in 2018, the preterm birth
research. The gestational age was obtained on the basis of
rate in Africa and South Asia was more than 60% (7). LMP (first day of the last menstrual period) or/and early
595
Received: 22/7/2022
Accepted: 24/9/2022
c:\work\Jor\vol901_85
The Egyptian Journal of Hospital Medicine (January2023) Vol. 90, Page 601- 606
Comparison of Anti-inflammatory Effect between Intracameral Triamcinolone
Acetonide and Topical Dexamethasone after Phacoemulsification
Nashwa Mohamed Mohamed Elkhodary*, Zeinab Sayed Hasan, Nermin Salah El-Din Mohamed
Department of Ophthalmology, Faculty of Medicine (for Girls), Al-Azhar University, Egypt
*Corresponding author: Nashwa Mohamed Mohamed Elkhodary, Mobile: 01016976242,
Email: Nashwa_kh90@yahoo.com
ABSTRACT
Background: Despite better surgical methods and intraocular lenses, phacoemulsification has emerged as the most
widely used and gold standard in cataract surgery today. One of the most typical surgical consequences is
postoperative inflammation. Surgical trauma damages the blood aqueous barrier, allowing proteins and inflammatory
cells to flow into the anterior chamber. Objective: The aim of the current study is to compare the effectiveness of a
single intracameral dose of triamcinolone and topical dexamethasone in controlling inflammation following
phacoemulsification.
Patients and methods: The current clinical trial included 60 eyes divided into two equal groups; Group A included 30
eyes which received single intracameral injection of triamcinolone acetonide (ICTA) 1 mg at the end of surgery, and
Group B included 30 eyes which was given topical dexamethasone eye drops 5 times per day for 1 week and the dose
decreased gradually. Results: It is found that there was no statistically significant difference between the two studied
groups regarding corneal edema, anterior chamber (AC) cells at 1 day and 1 week after surgery. All cases of the two
groups were found negative for corneal edema, AC cells at 1 month and 3rd month postoperative. There was no
significant difference between the two groups in terms of mean BCVA or intraocular pressure (IOP) at any time point
(P >0.05) postoperatively. Our results show that there was highly significant difference between the two studied
groups regarding conjunctival irritation at 1 day, 1 week and 1 month and there is non-significant difference at 3rd
month. No significant complications like endophthalmitis were observed.
Conclusion: Intracameral triamcinolone injection was demonstrated to be a promising safe alternative to topical
dexamethasonen with comparable efficacy in terms of the management of postoperative inflammation after
phacoemulsification and was associated with minimal complications and higher compliance.
Keywords: Cataract, Inflammation, Phacoemulsification, Triamcinolone.
INTRODUCTION
The aim of this study was to compare the
The most common form of curable blindness
effectiveness of a single dose intracameral
worldwide is cataract (1). The most frequent treatment
triamcinolone injection and topical dexamethasone in
performed by ophthalmologists globally is cataract
controlling
post-operative
inflammation
after
surgery, which is carried out on about 18 million
phacoemulsification.
patients per year and is predicted to rise as the world's
population and life expectancy rise (2). Although better
PATIENTS AND METHODS
surgical methods and intraocular lenses have made
This study was a prospective, non-randomized,
phacoemulsification the most widely used and gold
controlled clinical trial. This clinical trial was
standard
in
cataract
surgery,
postoperative
conducted on 60 patients admitted from Al Zahraa
inflammation remains one of the most frequent
University Hospitals in the period from January 2019
postoperative consequences (3).
to April 2021 with age ranging from 30 years to 70
Surgical trauma damages the blood aqueous
years.
barrier, allowing proteins and inflammatory cells to
Inclusion criteria were participants with age 30-
flow into the anterior chamber. Increased recovery
70 years old, both sexes, clear ocular media and
time, increased intraocular pressure (IOP), synechiae
catractous lens.
development, and cystoid macular edoema are all
Exclusion criteria were previous intraocular
consequences
of
uncontrolled
postoperative
surgical intervention, history of trauma, anterior
inflammation (4). After cataract surgery, topical
uveitis, glaucoma, complications during surgery, and
steroids are frequently used to reduce postoperative
presence of systemic diseases or conditions as diabetes
inflammation. Injections into the anterior chamber,
mellitus.
sub-tenon, sub-conjunctiva, also intravitreal injections
All subjects in our study were subjected to
are other methods of administering steroids to the eye
demographic data as age, gender, history of presence
(5). Although topical steroids are useful for reducing
of systemic diseases and history of trauma or previous
postoperative inflammation, they have several
ophthalmic interference, and full ophthalmological
drawbacks, such as poor compliance from daily
preoperative examination including slit lamp
dosages that must be repeated, disturbance of the tear
examination for anterior chamber cells, corneal edema,
film, and discomfort (6).
visual acuity by Snellen chart, IOP measurements by
air-puff and fundus examination.
601
Received: 15/10/2022
Accepted: 15/12/2022
c:\work\Jor\vol901_86
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 607-609
Assessment of Role of Latanoprost in Management of Vitiligo: Review Article
Laila Ismail Mohamed Ismail*, Abdulla Hassan Kandil, Abdulla Mohamed Essawy
Department of Dermatology, Venereology and Andrology, Faculty of Medicine, Zagazig University, Egypt.
*Corresponding author: Laila Ismail Mohamed Ismail, Mobile: (+20) 01006484160, E-Mail: lailaismail294@gmail.com
ABSTRACT
Background: One of the PGF2 analogues, latanoprost solution is applied topically to the eye to lower intraocular
pressure and treat glaucoma. Latanoprost has been examined for the treatment of cutaneous hypopigmentation since
evidence of its periocular and pigmentation adverse effects emerged. It has been found to be useful, especially when
combined with other medications. It has been reported that topical latanoprost is effective as a monotherapy for vitiligo.
Objective: This study aimed to assess the possible role of latanoprost in management of vitiligo.
Methods: We searched PubMed, Google Scholar, and Science Direct for information on vitiligo with latanoprost.
However, only the most current or comprehensive study from November 2001 to May 2021 was considered. The authors
also assessed references from pertinent literature. Documents in languages other than English have been disregarded
since there aren't enough resources for translation. Unpublished manuscripts, oral presentations, conference abstracts,
and dissertations were examples of papers that weren't considered to be serious scientific research.
Conclusion: According to some studies, using latanoprost in conjunction with other treatments for vitiligo is more
beneficial than using latanoprost alone.
Keywords: Latanoprost, Management of vitiligo.
INTRODUCTION
advances to whole or nearly total skin and hair
Milky white macules and patches appear on the skin
depigmentation (5).
and mucous membranes of people with vitiligo, an
Regarding focal vitiligo, a little, single, depigmented
inherited, progressive depigmenting illness that results
lesion that hasn't spread or changed much over the course
from a significant loss of epidermal and, in some cases,
of two years. Possible future states include SV and NSV
hair follicle melanocytes (1). Between half a percent and
(5).
one percent of the population may have vitiligo (2).
The exact aetiology is not well understood, but it is
In Mixed vitiligo, simultaneous presence of both SV and
known to be complex and include the interaction of
NSV. Wood lamp examination rules out nevus
several variables. Most notably, the autoimmune process
depigmentosus at birth and within the first year of life;
has been thoroughly documented. Anyone of either
(2) SV is followed by NSV with a delay of at least 6
gender can develop vitiligo at any time (3).
months; (3) SV affects at least 20% of the dermatomal
segment or presents a definite Blaschko linear
Generalized vitiligo:
distribution; (4) SV responds poorly to conventional
Macules or patches of skin without pigmentation
narrow-band ultraviolet B (NB-UVB) treatment
that appear at random locations all over the body and are
compared to NSV (good response). Patients with SV who
usually bilateral and symmetrical. This condition
present with leukotrichia or halo nevi at presentation are
typically manifests in parts of the body that are frequently
at increased risk of developing MV (4).
subjected to stressors including rubbing, squeezing, and
bruising. It can start at any age, from childhood to young
In Punctate vitiligo, macules that are between 1 and 1.5
adulthood (4).
millimeters in diameter and are completely depigmented
In acrofacial vitiligo, macules with missing
at their borders. In the absence of conventional vitiligo
pigmentation that appear only on the hands, feet, and/or
macules, these spots should be called leukoderma
face. Depigmentation of the extremities, such as the
punctata (6).
fingers and the orifices of the face, is a defining
characteristic. As time goes on, it could spread to other
Hypochromic vitiligo or vitiligo minor, indicated by
parts of the body, at which point it would be more
the appearance of hypopigmented macules across the
accurately described as systemic or even global (5).
trunk and scalp, as well as a seborrheic distribution of
In mucosal vitiligo, normal mucosal surfaces, such
these lesions across the face and neck. It appears to affect
as those in the mouth and genitalia, are frequently
only those with dark complexion (7).
affected. It might be an isolated occurrence or part of a
more widespread case of vitiligo. Unclassified mucosal
Follicular vitiligo, manifests as leukotrichia without
vitiligo is characterized as persistent, isolated vitiligo that
accompanying epidermal depigmentation (8).
has been present for at least 2 years (5).
In vitiligo universalis, full or near-full
Segmental vitiligo, fast onset and segmental distribution
depigmentation (80-90% of the body's surface).
of depigmented macules are hallmarks of leukotrichia.
Typically, it begins with widespread vitiligo and
The macule-like lesion is a clinical hallmark of NSV. A
macule that is completely devoid of melanin and is white,
607
Received: 22/7/2022
Accepted: 24/9/2022
c:\work\Jor\vol901_87
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 610-620
Acceptability of The Flu Vaccine among The General Population in
Tabuk, Saudi Arabia, 2021-2022
Rofayda Mansour Ahmed Mohamad1*, Khalil Ibrahim Abu Jamileh2,
Mohammad Radwan Abdelhak Ali2, Khalid Hassan Ali Makki2, Waheed Ali Alshehri1,
Safa Salih Ahmed Fadul3, Samir Salah Eldin Mohamed Buraei2, Wareef Abdullah Saleem Al-lahim1,
Haytham Abdullah Amin Abosalamh2, Abdulla Saeed Hassan Althobaiti1, Mohammed Ali Abdullah Khubrani1
1 Preventive Medicine Department,
2 Family Medicine Department, King Salman Armed Forces Hospital, Tabuk, Saudi Arabia
3 Ministry of Health, Tabuk, Saudi Arabia
*Corresponding author: Rofayda Mansour Ahmed Mohamad, Phone: +966545450874,
Email: rofayda.mohamad22@gmail.com
ABSTRACT
Background: Vaccine hesitancy and ignoring prevents reaching the desired rates of vaccine coverage.
Objectives: The present study was conducted to identify factors for the acceptability of the seasonal flu vaccination in
the 2021-2022 season.
Patients and methods: A cross-sectional study was conducted between December 2021 and February 2022 among the
general population of Tabuk, KSA. A structured, self-administered, web-based questionnaire was distributed to a sample
of adult residents of Tabuk, Saudi Arabia. The questionnaire included: 1) demographic data; 2) information about
contracting COVID-19 and/or getting COVID-19 vaccination; and 3) acceptance or refusal of flu vaccination and
reasons for either.
Results: Most respondents (73%) believed that the flu vaccine was important, but only 45% received the vaccine during
the years 2021-2022. Independent predictors for believing the vaccine's importance were having good knowledge about
the vaccine, thinking that influenza is dangerous, hearing about the vaccine or taking it before, and believing that it
reduces susceptibility to the disease. The independent predictors for vaccine acceptability were the male gender, the
medical profession, perceiving influenza as a dangerous disease, believing the importance of the vaccine, uptake of the
vaccine, and believing that the vaccine could reduce susceptibility.
Conclusion: A considerable proportion of the Tabuk adult population holds misconceptions about influenza and its
vaccines. These misconceptions reduce the rate of vaccination coverage. COVID-19 infection or vaccination did not
significantly contribute to flu vaccine acceptability. Health education about the flu vaccine's safety and efficacy can
increase vaccine acceptability.
Keywords: COVID-19, Immunization, Influenza vaccine, Seasonal influenza, Vaccination uptake, Cross sectional
study, King Salman Armed Forces Hospital.
INTRODUCTION
addition, the Saudi Ministry of Health launched a 5-year
The global annual incidence of influenza
strategic project in 2014 to increase vaccination
approximates one billion cases, out of which 35
coverage among high-risk groups (7). During the
million cases develop severe disease, and 290,000
COVID-19 pandemic, concerns have been raised
650,000 cases end in death. Most deaths occur in
regarding the co-occurrence of the influenza epidemic
children younger than 12-years-old or elderly people
and the resultant aggravated respiratory morbidities and
aged over 65 years (1).
mortalities (8). The WHO has recommended influenza
Influenza leads to hospital admissions and absence
vaccination for high-risk groups during the COVID-19
from work, resulting in increased health expenditure
pandemic. The Saudi Ministry of Health stated the role
and reduced productivity, which in turn account for
of the influenza vaccine in reducing influenza-related
massive economic costs (2). Vaccination represents the
mortality and morbidity during the COVID-19
main strategy for reducing the incidence of seasonal
pandemic (9).
influenza. The WHO and the Centers for Disease
Understanding the factors that increase the
Control and Prevention in the United States have
acceptability of influenza vaccination is essential to
emphasized the safety and efficacy of the seasonal flu
designing effective strategic projects to increase
vaccine to protect against the disease and prevent the
vaccination coverage and rate with the goal of reducing
development of severe complications and hospital
seasonal influenza-related morbidity and mortality (10).
admissions (3-5). The Kingdom of Saudi Arabia (KSA) is
The present study aimed to assess knowledge, beliefs,
particularly susceptible to outbreaks and epidemics of
and attitudes regarding flu vaccination and to
influenza as the Kingdom receives millions of Muslims
investigate the association between participants'
from around the world to perform Umrah and
demographic and professional characteristics, COVID-
pilgrimage (6). Influenza vaccination is free of charge in
19 exposure and/or vaccination, and the acceptability of
Saudi Arabia and is indicated for any individual over 6
seasonal flu vaccination in the 2021-2022 season.
months of age in the absence of any contraindication. In
610
Received: 22/7/2022
Accepted: 24/9/2022
c:\work\Jor\vol901_88
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 621-627
A Comparison Between Pregabalin and Gabapentin as Adjuvants to
Opioids in Elective Lumbar Microdiscectomy to Control Postoperative Pain:
A Randomized-Controlled Study
Mohamed S. Arafa1, Abeer S. Salem2*, Ahmed Kadry1, Gomaa Zahry Hussien1,
Mohamed Mahmoud Mohamed1
1Anesthesia Department, Faculty of Medicine, Cairo University, Cairo, Egypt
2Anesthesia Department, Research Institute of Ophthalmology, Giza, Egypt
*Corresponding author: Abeer S. Salem, Email: abeer.samir.salem@gmail.com, Mobile: +201125666006
ABSTRACT
Background: Although pregabalin and gabapentin have been used to control pain after spinal surgery, there is little
evidence comparing their analgesic advantages to opioids.
Objective: The current study aimed to assess efficacy and safety of analgesia with pregabalin versus gabapentin
compared to opioids in patients undergoing elective lumbar microdiscectomy.
Methods: This randomized-controlled trial included 72 patients scheduled for elective lumbar microdiscectomy. The
patients were randomly allocated to three groups. Each group enrolled 24 patients who received 0.1 mg/kg of morphine
intramuscularly 30 minutes before the surgery. One hour before the surgery, 150 mg of pregabalin was given orally for
the pregabalin (P) group, meanwhile, in the gabapentin (G) group, 400 mg of gabapentin were given orally, and in the
control (C) group, 100 micrograms of vitamin B12 were given orally. The primary outcome was the time to first rescue
analgesia. The secondary outcomes were the intraoperative hemodynamics, visual analogue score, total consumption of
morphine during the first postoperative 24 h, and morphine complications.
Results: Groups P and G had significantly longer time to first analgesia and significantly lower total morphine
consumption during the first 24 h and visual analogue scores at 10, 12, 16, 20, and 24 hours postoperatively. All groups
had comparable hemodynamic parameters and postoperative complications.
Conclusion: In elective lumbar microdiscectomy, preoperative administration of pregabalin provided longer time to
first rescue analgesia with better acute pain control and lower total analgesic consumption compared to gabapentin and
opioid analgesia.
Keywords: lumbar discectomy, Pregabalin, Gabapentin, Analgesia, Opioid.
INTRODUCTION
inflammatory hyperalgesia, gabapentin and pregabalin
Acute postoperative pain is a common problem
were
found to
exhibit antinociceptive
and
after spine surgery. Eighty percent of these patients rate
antihyperalgesic
characteristics.
Furthermore,
their pain as severe (1). Postoperative pain can be
pregabalin decreases several neurotransmitters' (e.g.,
brought
on
by
tissue
damage, inflammatory,
serotonin, glutamate, dopamine, and substance P)
neuropathic, or visceral in nature. Both peripheral and
release by interacting with the calcium channel's 2-
central sensitization has a role in the development of
subunit (8).
pain (2). Thus, preemptive analgesia aims to prevent
Pregabalin is approximately 2.5 times the potency
central sensitization brought on by surgical incisional
of gabapentin (9). Over the past ten years, the off-label
injury and other inflammatory reactions to surgery.
use of gabapentinoids for managing acute nociceptive
Preemptive analgesia is a form of treatment that begins
pain, postoperative analgesia and to reduce opiate use
before surgery (3).
has dramatically increased (5, 10). However, the scientific
Morphine is the first treatment option for
evidence for the growing gabapentinoids use is
postsurgical pain. However, its use has been restricted
contradictory, which may indicate clinical agnosticism
because of several side effects including nausea and
instead of additional proof of clinical efficacy (11).
vomiting, respiratory depression, itching, constipation,
As the possibility of opioid-induced respiratory
and urine retention. Furthermore, some forms of pain do
depression was raised by gabapentinoids, an increased
not respond well to opioids (1). Thus, using a variety of
rate of naloxone administration was linked to continued
pharmacologic medications could improve early
usage of chronic gabapentin after surgery (12). Thus, the
ambulation, early release, and a lower incidence of pain
current study aimed to assess efficacy and safety of
(4). Gabapentinoids are anticonvulsant drugs including
preoperative administration of pregabalin versus
pregabalin and gabapentin. Food and Drug
gabapentin as adjuvants to opioids for postoperative
Administration has licensed gabapentinoids to treat a
pain in elective lumbar microdiscectomy.
number of ailments, such as partial seizures, nerve pain
from spinal cord injuries, shingles, and diabetes (5).
METHODS
Pregabalin and gabapentin have a well-established
Study design: This randomized trial was carried out at
place in the treatment of neuropathic pain (6, 7). In
the Neurosurgery Unit, Kasr Al-Ainy Hospital, Egypt
experimental research on neuropathic pain and
between September and November 2022.
621
Received: 20/07/2022
Accepted: 22/09/2022
c:\work\Jor\vol901_89
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 607-614
Cytokine Dependent Hematopoietic Cell Linker and Anemia in
Liver Cirrhosis Patients
Mohammed Sayed Mostafa1, Mona Mahmoud Hassouna1, Hanaa Nagy Ibrahim Heikal1*,
Mostafa Gamal El Din El Helbawy2, Heba Mohamed Ibrahim Abdallah1
Department of 1Clinical Pathology and 2Internal Medicine,
National Liver Institute, Menoufia University, Menoufia, Egypt
*Corresponding author: Hanaa Nagy Ibrahim Heikal, Mobile: (+20) 01093889877, E-mail: hanaaheikal972@gmail.com
ABSTRACT
Background: About 75% of people with liver cirrhosis have anemia. It significantly lowers their quality of life and
raises mortality. Additionally, several etiologies may be involved. A tyrosine-phosphorylated polypeptide called
cytokine dependent hematopoietic cell linker (CLNK) controls immunological receptor signalling and controls the
receptor signalling of T-cells and natural killer T-cells. Tyrosine of the cytoplasmic domain band-3 is phosphorylated
by oxidative stress, which is a significant factor in the development of liver cirrhosis. Tyrosine phosphorylation thus
triggers the release of microparticles, local red cell membrane instability, and major changes in erythrocyte shape. It has
not been previously investigated how CLNK affects liver cirrhosis and anemia caused by cirrhosis.
Objectives: The aim of the current study was to evaluate serum level of CLNK in cirrhotic patients compared to healthy
controls, and its level was correlated with various hematological parameters.
Patients and methods: A casecontrol study was conducted on 60 liver cirrhotic patients (30 anemic and 30 not anemic)
and 30 age and sex-matched healthy individuals. All patients were subjected to full history taking, complete medical
examination, and thorough radiological and laboratory investigations as complete blood counts, ferritin, CRP, liver
function tests, kidney function tests, and serum CLNK using enzyme-linked immunosorbent assay were done.
Results: Serum CLNK levels were significantly higher in anemic [178.86 (IQR 68.25)]) and nonanemic cirrhotic
patients [138.17 (IQR 170.55)] than in controls [90.28 (IQR 10.61) with a P-value <0.001. There was no significant
difference between anemic and non-anemic groups compared with each other. CLNK serum levels showed a statistically
significant positive correlation with ferritin and reticulocyte count in anemic patients' groups.
Conclusion: Serum CLNK is significantly elevated in patients with liver cirrhosis and there is still some debate
regarding the association between CLNK levels and the incidence of anemia in cirrhotic patients.
Keywords: CLNK, Liver cirrhosis, Anemia, Case control study, Menoufia University.
INTRODUCTION
An overabundance of iron, which may be identified by
The pathophysiological effects of cirrhosis have a
higher blood ferritin levels, increases the risk of HCC (5,
major impact on the liver's immunological and synthetic
6). The liver produces crucial mediators known as acute
activities. Hematological dysfunctions, such as anemia,
phase reactants during acute and chronic inflammatory
are how this manifests (1).
diseases, which lead to a number of negative outcomes
Anemia may develop in 66% to 75% of liver
such as fever and anemia of chronic illness. Interleukin-
cirrhotic patients. Notably, the cause of anemia is still
6 is the main cytokine that stimulates the liver to make
unknown in the majority of cases. 53% of all cases of
more (IL-6). Acute-phase reactants can also be induced
anemia were unknown in etiology, hemorrhage (25%)
by IL-1, tumor necrosis factor-alpha (TNF-alpha), and
and iron deficiency (9%). Unfortunately, the high
interferon-gamma (IFN-gamma) (7).
occurrence of anemia can lead to a misperception that it
In addition to the cytokines generated in response
is a necessary component of liver disease (2).
to various stimuli and immune system dysregulation, a
Anemia brought on by cirrhosis is linked to higher
different class of proteins known as adaptor proteins is
mortality and morbidity rates. There may be many
an essential part of signaling pathways both inside and
etiologies at play as well. Therefore, it is crucial to have
outside the immune system (8).
a straightforward, simple to use, but informative
Different hematopoietic cell types have a variety
diagnostic procedure to help with the identification and
of adaptors, which refers to hematopoietic stem cells,
subsequent treatment of the primary cause of anemia in
which includes all mature cell types as well as their
cirrhosis (3).Hepatocytes primarily generate ferritin, a
immature progenitors (9).
sign of iron homeostasis and an acute phase reactant. A
In cytokine-dependent lymphoid and myeloid cell
systemic review of the accuracy of ferritin analysis in
lines, including neutrophils, mast cells, macrophages,
cirrhotic patients showed that levels of <15 g/dL were
platelets, T cells, and natural killer (NK) cells, CLNK,
essentially diagnostic of iron deficiency anemia (IDA)
an adaptor protein, has been found to be expressed. It
in cirrhosis whereas values of >100 g/dL practically
seems that persistent exposure to cytokines like IL-2
ruled it out (4).
and IL-3 is the only factor that influences its expression.
Even without particular genetic defects, iron
It possesses a leukocyte protein of 76 kD (SLP-76)-
overload has been discovered in 8% of people with an
related molecule with a Src homology 2 domain (10). The
advanced liver illness comparable to hemochromatosis.
Src family of protein tyrosine kinases (SFKs) is a group
628
Received: 23/07/2022
Accepted: 25/09/2022
c:\work\Jor\vol901_90
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 636-654
Composition and Development of the Intestinal Microbiome in
Children and Its Changes with Certain Pathologies (Cystic Fibrosis,
Multisystem Inflammatory Syndrome, Type 1 Diabetes, and Autism): Meta-Analysis
Abduladeem G.M. Al-Selwi1,2,4* and Amina Barkat1,3
1. Department of Clinical Epidemiology and Medico-Surgical Sciences,
2. Faculty of Medicine and Pharmacy, University Mohammed V, Rabat, Morocco
3. Medical Research Laboratory, Children's Hospital, Ibn Sina University Hospital, Rabat, Morocco
4. National Reference Center for Neonatology and Nutrition, Rabat Children's Hospital Ibn Sina, Rabat, Morocco
5. Taiz University in Yemen
Corresponding author: Abduladeem G.M. Al-Selwi, Mobile: + (212) 639604766, ORCID: 0000-0003-4211-6223,
E mail: abdualadeem12@gmail.com, abduladeemgazemmoq_thabet@um5.ac.ma
ABSTRACT
Background: Establishment of the intestinal flora in childhood is a critical window for growth and development. Objective:
The aim of the current meta-analysis is to investigate the composition, development of intestinal flora in children and its
change with certain pathologies.
Material and methods: A comprehensive search was conducted in Scopus, PubMed, Google Scholar and Other engines.
A total of 603 articles were identified of them only 11 fulfilled our inclusion criteria.
Results: Composition of the intestinal flora in children: Firmicutes (51.1%) and Bacteroidetes (36%) at the phylum level.
Bacteroidaceae, Lachnospiraceae (17.5%) and Ruminococcaceae (13.9%) at family level. Bacteroides, Prevotella,
Faecalibacterium and Bifidobacterium (16%, 8.69%, 7.51%, and 5.47%, respectively) at genus level. Children with cystic
fibrosis had different intestinal microbiota structures compared to healthy children. Alterations of the intestinal microbiota
could be a predisposing factor for the multi-systemic inflammatory syndrome. In SARS CoV-2: Firmicutes, Bacteroidetes,
Proteobacteria, Actinobacteria, and Verrucomicrobia (51%, 25%, 12%, 9%, and 2%, respectively). In non-diabetic
children: Enterococcus 28.4%, and in children with type 1 diabetes Enterococcus 22.8%. The diversity and stability of the
microbial composition: Bacteroidetes, Proteobacteria, Firmicutes, Actinobacteria, Fusobacteria, and Verrucomicrobia are
different in diabetic and non-diabetic children. The percentage of microbiota species in children with signs of constipation
varies compared to children without constipation. In children and adults, there is variation in species composition at the
family, phylum, and genus level. Bacteroidetes raised in the severe autistic group. Dysbiosis was elevated in autistic children
compared to healthy children. Sutterella sequences were absent in healthy children. Conclusion: It is a very important to
know the influence of the change in the microbiota predisposition to develop different pathologies or the opposite, which
opens a wide range in this subject, hence the importance of carrying out more in-depth studies and research, especially in
childhood.
Keywords: Intestinal microbiota, children, pathologies, meta-analysis, University Mohammed V.
INTRODUCTION
Breast milk can encourage the proliferation of
The intestinal microbiota is an important set of
Lactobacillus and Bifidobacterium strains, whose
bacteria distributed along the intestinal tract and whose
function is to provide an acidic environment rich in short
overall composition varies according to the location, the
chain fatty acids with an intestine protective and
individuals, the age, the periods of the life of a same
nutritional function. Additionally, breastfeeding has been
individual, the human intestinal microbiota is composed
shown to provide a balanced gut microbiota to infants,
of about 1014 bacteria as well as other microorganisms
which positively impacts their health (2).
such as viruses, fungi and archaea.
The intestinal microbiota is composed in a very large
Intestinal microbiota research has revealed the
majority of anaerobic bacteria, 95% of the microbiota is
fundamental role it plays in intestinal physiology but also
represented by four bacterial phyla: Firmicutes (Firmus
in human health in a more general way, as a real "hidden
cutis: hard skin) are bacteria traditionally Gram-positive
organ", after bacterial colonization of the digestive tract,
but of which certain classes are Gram-positive (we find in
this transient microbiota is crucial for the growth of each
particular the genera: Ruminococcus, Clostridium,
person's unique intestinal microbiota and actually has a
Lactobacillus (of which several strains are used as
significant impact on how a newborn develops. We
probiotics), and of Eubacterium, Faecalibacterium and
explain the structure and role of the intestinal microbiota
Roseburia (producers of butyrate), Bacteroidetes is Gram
as well as its implications in human pathology (1).
negative with a phylum consisting of three major groups
636
Received 23/07/2022
Accepted 25/09/2022
c:\work\Jor\vol901_91
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 655-659
Results of Dynamic Hip Screw with Trochanteric Stabilizing Plate in
Treatment of Unstable Trochanteric Hip Fractures
Mohammed Mazher Mohammed Saif *, Mohamed Omar Soliman,
Mohamed Said Abd El Maksoud, Mohamed Ahmed Abd El Moneim, Mahmoud Fahmy Tayel
Orthopedics Department, Faculty of Medicine, Cairo University, Cairo, Egypt
Corresponding author: Mohammed M M Saif, Mobile: +966532902112, Email: dr_m_seif@yahoo.com
ABSTRACT
Background: Trochanteric hip fractures are common among elderly patients. They are categorized as stable and
unstable fractures depending on integrity of postero-medial cortex. Integrity of lateral wall is important to prevent
excessive fracture collapse and poor outcome.
Objective: This study aimed to assess the results of using dynamic hip screw with trochanteric stabilizing plate (TSP)
in management of unstable trochanteric fractures (A2 and A3 patterns in AO classification).
Patients and methods: Forty patients with unstable hip fractures were operated in Kasr Alainy Hospital using dynamic
hip screw (DHS) with TSP. The study had a minimum follow up of 18 months.
Results: In this study, operative time ranged from 90 to 180 minutes with mean of 105.5 ± 24.06. Six patients (15%)
had 500 cc packed RBCs transfusion and only one case (2.5%) needed 1000 cc of packed RBCs. At 6 weeks HSS ranged
from 20 to 80 points, the mean was 54.94 ± 16.17 points. At 3 months the HSS ranged from 43 to 89 points, the mean
was 70.22 ±12.65 points. At 6 months the HSS ranged from 50 to 100 points, the mean was 82.81 ±10.37 points. At 12
months the HSS ranged from 55 to 100 points, the mean was 89.09 ±9.20 points. At 18 months the HSS ranged from 62
to 100 points, the mean was 93.84 ± 7.95 points.
Conclusion: TSP is a good option in management of unstable trochanteric fractures. We recommend making more
studies on TSP to reveal its efficacy.
Keywords: Dynamic, Hip, Screw, Trochanteric, Hip fractures.
INTRODUCTION
excessive fracture collapse, limb shortening and
Hip fractures are those which occur between the
fixation failure (4).
articular margins of the femoral head to 5 cm below the
The purpose of this study is to assess the results of
lesser trochanter. They are divided into extracapsular
using dynamic hip screw with trochanteric stabilizing
and intracapsular hip fractures. The extracapsular hip
plate in management of unstable trochanteric fractures
fractures are subdivided into pertrochanteric and
(A2 and A3 patterns in AO classification).
subtrochanteric fractures (1).
Hip fractures occur most commonly in elderly
PATIENTS AND METHODS
patients. Decreasing bone mass with age increases the
This prospective study was conducted in Kasr Alainy
risk of hip fractures. That is why hip fractures in elderly
Hospital in the period from June 2018 to June 2020. It
generally
occur
from
low
energy
trauma.
included patients with unstable type of trochanteric
Intertrochanteric
fracture
femur
represents
fractures AO/OTA classification 31-A2 and 31-A3.
approximately 50% of all proximal femur fractures.
Based on the integrity of the postero-medial cortex,
Inclusion criteria:
the Evan's classification system divides the
1. Skeletally mature patients which have diagnosed
intertrochanteric fractures into stable and unstable
unstable trochanteric fractures AO/OTA classification
fractures (2).
31-A2 and 31-A3 types.
The conservation of the side trochanteric wall was
2. Both genders.
significant in reducing a planned fracture influence.
3. Age from 50 to 90.
Disruption of the lateral wall, after miniaturization and
fixture progress to excrescent fracture breakdown and
Exclusion criteria were polytrauma patients,
less results. Integrity of the lateral cortex considered the
pathological fractures, open fractures, bed ridden
most common factor leading to post-operative failure
patients, patients below 50 years or above 90 years, and
and reoperation (3). The operative management of
patients with dementia.
intertrochanteric fractures can be done with different
implant choices. Dynamic compression hip screw,
Sample size calculation:
proximal femoral nail, fixed angle blade plate and
The size of the sample was obtained by IBMª SPSSª
locked plate proximal femur are examples of implant
Sample Powerª version 3.0.1 (IBMª Corp., Armonk,
choices in such fracture pattern (4).
New York, United States). A previous study by Patil
Trochanteric stabilizing plate over dynamic hip
and Srinivas (5) reported that the Harris Hip Score at 6
screw provides lateral buttress for the proximal
months was 85.45 (SD 6.04). A minimal sample size of
fragment. This buttressing for the lateral cortex prevents
40 cases will have 80% power to detect an expected
difference of 3 in the Harris Hip Score at 6 months, at
655
Received: 01/09/2022
Accepted: 02/11/2022
c:\work\Jor\vol901_92
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 660-661
Sensitive Uterus Post Bariatric Surgery (Case Report)
Latteefah Saleh Alnaeem*
College of Medicine, Obstetrics and Gynecology Department, King Faisal University,
AI Hfouf, Kingdom of Saudi Arabia.
*Corresponding author: Latteefah Saleh Alnaeem, Mobile No.: +966504935792,
ORCID: 0000-0002-3677-2454, E-mail: Latifa_alnaeem@hotmail.com
ABSTRACT
Background: This female case highlights the effect of bariatric surgery in modifying the physiology of the patient and
her irregular hormonal response to stress.
Case summary: The reported patient had an uneventful menstrual history prior to performing her gastric sleeve till
two years post-surgery, started to become sensitive to any stressful event with intermenstrual bleeding, all
investigations suitable to her case were within the standard limits and despite trial of variable hormonal and non-
hormonal treatments were ineffective, while relaxing techniques and cognitive behavioural therapy were applied with
positive results.
Conclusion: Bariatric surgery could change the physiological stress response; after the exclusion of other known
causes, behavioural therapy could improve the treatment outcome. Further studies need to support these findings.
Keywords: Intermenstrual, Vaginal bleeding, Bariatric surgery, Obesity, Case report, King Faisal University.
CASE PRESENTATION
Thirty-three years old female patient presented to
cervical motion tenderness was noted. Investigations
the outpatient clinic with a history of recurrent onset of
included transvaginal ultrasound showing thin
intermenstrual bleeding, which was characterized to be
endometrium 0.1 mm, no myometrial pathology noted,
mild, dark coloured blood with mucus that started on
and ovaries were average size with no cysts.
her twelfth day of the period after five days being dry .
Pregnancy was excluded, and laboratory tests
It continued for ten days then stop spontaneously
results were within normal limits of lab reference,
without any interventions. The events were recurrent
including haemoglobin 13.2 g/dl , haematocrit 39%
irregularly through the year.
platelets 319 thousands/cmm, total leukocytes count 8
The patient claims that this complaint started after a
thousands/cmm, coagulation profile including PT 12
serious psychological accident in her life two years ago,
seconds, a activated PTT 27seconds , fibrinogen 133
the death of her dearest friend. She described this
mg/dl , liver functions tests including (ALT) Alanine
bleeding happened to her later with the stressful events.
aminotransferase 15, (AST) Aspartate aminotransferase
She delivered three times with no history of previous
25, and TSH (thyroid stimulating hormone) 1.25
miscarriages or other abnormal pregnancies. Regarding
mIU/L, Calcium 9.7 mg/dl, total vitamin D 47.4 ng/ml.
her previous deliveries, all were spontaneous vaginal
As a management strategy plan, the patient was
delivery; she is not known to have any medical illness
instructed to use nonsteroidal anti-inflammatory drugs
with a history of gastric sleeve four years ago with a
combined with antacids in doses suitable to her history
gradual loss of thirty-five kilograms during the first two
of bariatric surgery and to change the pills market
years, then her weight stabilized. She is not on
company for twelve months; unfortunately, in a follow-
medications except for combined oral contraceptive
up visit, no benefits were achieved especially after a
pills for six years after her last delivery and vitamins.
stressful episode. The patient was counselled about
She had a regular period with combined oral
behavioural therapy and relaxation techniques. Six
contraceptives, average blood loss for five to six days,
months later, the patient reported improvement in her
and no vaginal discharge or itching. She had no post-
symptoms, decreasing the duration of bleeding while
coital bleeding or dyspareunia. There was no family
practising relaxing techniques.
history of endometrial, ovarian, or breast cancer.
The patient is a teacher and has an average income
DISCUSSION
and stable family bonds. She had been screened for the
Irregular uterine bleeding (AUB) is the coordinated
psychological disorder during her annual women's
cause of a critical healthcare burden for females, their
health visit and was never diagnosed with any disorder
families, and society. Up to 30 percent of ladies will
and mentioned that it was not the first emotional
look for medical advice for this issue throughout their
accident in her life; however, it was the first one after
reproductive years (1).
her surgery. The patient underwent assessments,
Intermenstrual bleeding means AUB that happens
including a general examination and speculum
between well-defined patterned menses. It can be
examination, which showed no signs of infection or
cyclical or acyclical. Recurrent midcycle intermenstrual
ectropion. The PAP smear was obtained, and the result
bleeding refers to a small amount of bleeding emerging
was normal. Bimanual examination showed a pelvic
from the endometrium around midcycle and happens in
anteverted uterus with unpalpable ovaries with no
roughly 9 percent of all reproductive-age females. This
660
Received: 7/7/2022
Received: 12/9/2022
c:\work\Jor\vol901_93
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 662-667
Predictive Value of Cervical Dilatation at Initial Presentation in
Labor and Subsequent Intervention
Essam A. Amin1, Tarek Mohammed Sayed1, Rasha Zaki Abd Al-Aziz2*, Hesham Ammar1
1 Department of Obstetrics and Gynecology, Faculty of Medicine, Menoufia University, Egypt
2 Department of Obstetrics and Gynecology, Qwesna General Hospital, Menoufia, Egypt
*Corresponding author: Rasha Zaki Abd Al-Aziz, Mobile: (+20) 01007004976, E-mail: rashazaki913@gmail.com
ABSTRACT
Background: The development of initiatives to lower caesarean section rates requires a fundamental understanding of
the dynamics of normal and atypical labor, as well as women's behavior.
Objective: The aim of the current study is to assess the predictive value of initial cervical dilatation at the time of
hospital admission in nulliparous women in labor and its relation to subsequent intervention, mode of delivery, and
maternal, fetal outcomes.
Patients and methods: This cohort study was conducted at the Department of Obstetrics and Gynecology of both
Menoufia University Hospital and Quesna General Hospital included 60 nulliparous pregnant women with singleton
cephalic deliveries at 36-42 weeks who were admitted in spontaneous labor at various grades of cervical dilatation <
or equal 6 cm. Results: There was a significant difference between the Average Dilatation Rate (ADR) and Initial
Dilatation Rate (IDR) and the number of vaginal examinations and duration of 1st stage and a highly significant
difference in the duration of 2nd stage. While correlating with the mode of delivery, we found that ADR is 1cm/h or
more 100% in the spontaneous vaginal group and 80% in the assistant vaginal group while it is 100% less than 1cm/h
in the cesarean group. IDR is 1cm/h or more in 88.6 % of the spontaneous vaginal group and less than 1cm/h in 100%
of assistant vaginal and 100% of cesarean groups.
Conclusion: The IDR appears to be an accurate indicator and predictor of the course of labor. When IDR was
1cm/hour or more percentage of vaginal delivery was more and if less than 1cm/hour percentage of CS was more.
Keywords: Average dilatation rate, Cervical, Initial dilatation rate, Labor, Pregnancy.
INTRODUCTION
Cervicographs are the primary component of
The physiological progression of labor and the
Partograms, according to Philpott and Castle. Their
differentiation between physiological and non-
alarm line notifies the obstetrician to provide the
physiological labor have recently received attention in
patient with prompt treatment, such as moving to
obstetrical research, particularly to minimize
another well-equipped hospital or initiating an
caesareans and improve labor management [1].
oxytocin drip, among other things. Active management
These efforts led to the creation of the
is typically needed when the cervicographs pass the
Partographs by Friedman, Hendricks, and Philpott. An
action line. Obstetricians in practice get the ability to
established instrument for monitoring labor progress is
spot the early indicators of atypical labor via practice
a partogram. A partogram's usage is linked to better
[8].
treatment quality and labor outcomes, according to a
Initial dilatation rate (IDR) measures' main
number of studies [2-4].
benefit is their ability to accurately identify births that
Friedman's work from the 1954s served as the
might pose a concern. 100% of pregnancies ended in
foundation for the widely used WHO partogram,
vaginal births, either naturally or with some help, when
which has since been updated and updated labor curves
the lDR was 1 cm/hr or above. With an IDR of 1
evaluated. Friedman created a cervical dilatation time
cm/hour or more, 96% of primiparas spontaneously
curve that allowed for important labor progression
gave birth, whereas 60.5% needed assistance or a
monitoring [2,5].
caesarean section with an IDR of less than 1 cm/hour
Hendricks, however, sparked resurgence in
[4].
interest for partograms, notably with cervicograms.
Therefore, examining the cervix during labor
Cervicograph upkeep throughout labor is very
might reveal important details about how labor is
beneficial in the treatment of challenging patients [6].In
developing and what is likely to happen next.
the early detection of slowly progressive labor
Together, the pace of cervical dilatation and the
dystocia, partograms are particularly helpful. By
descent of the presenting section provide the most
retrospectively evaluating the nomograms of a
reliable indicator of labor productivity. It appears that
primigravida in labor, the study discovered that
the early rate of cervical dilatation is a reliable
nomograms are helpful in discriminating between
indicator of how labor will progress. The first
normal and abnormal labor [1]. Ledger claims that an
dilatation rate provides an early indicator of potential
aberrant cervical dilation pattern suggests the necessity
labor complications [5].
for a clinical examination and potential intervention,
Thus, we aimed to assess the predictive value of initial
but does not define the course of treatment [7].
cervical dilatation at the time of hospital admission in
nulliparous women in labor and its relation to
662
Received: 24/07/2022
Accepted: 26/09/2022
c:\work\Jor\vol901_94
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 668-678
Histological and Ultrastructural Changes of Cefepime on the
Kidney in The Adult Albino Rats
Mohammed Hegazy Hassan Ali ¹,*; Mohamed Al-Hady Zahran ²; Gamal M. Aboul-Hassan¹
¹ Departments of Anatomy, Faculty of Medicine, Al-Azhar University, Assuit, Egypt
² Departments of Anatomy, Faculty of Medicine, Al-Azhar University, Cairo, Egypt
*Corresponding Author: Mohammed H. H. Ali, Mobile: +201550624531, E-mail: drhegazy2008@gmail.com
ABSTRACT
Background: The cephalosporins are -lactam antibiotics that, in terms of both structure and function, are very similar to
penicillin. Cefepime is one of the most widely used parenteral fourth generation cephalosporins with broad-spectrum action.
The administration of a high dose of cefepime can exert a direct cytotoxic effect which accumulated in the tubular epithelial
cells.
Objective: The present work aimed to reveal the histological and ultrastructural alterations in the kidney of the adult albino
rats in relation to the dose of cefepime given. That's may give a new insight into the prophylaxis of cefepime nephrotoxicity.
Material and methods: 25 adult albino rats were divided into five equal groups. In group I (control group) each rat was
injected intramuscularly with 1 ml isotonic saline solution /day for one week. Each rat of group II, III, IV and V was injected
by cefepime intramuscularly in doses 50, 75, 100 and 125 mg/kg/day respectively for one week. After 2 months kidneys of
rats were excised for routine histological and electron microscopic studies. Results: Intramuscular injection of cefepime led
to histological and ultrastructural alterations of the cortex and medulla which were marked with increasing its concentration.
Cytotoxic damage to the renal tubules, glomeruli and interstitium was obtained. The histological and ultrastructural changes
in the kidney caused by cefepime were marked in group III, IV and V.
Conclusion: Cefepime nephrotoxicity were marked with increasing its concentration which proves that, cefepime
nephrotoxicity in rats were dose related.
Keywords: Cefepime; cephalosporins; nephrotoxicity; kidneys.
INTRODUCTION
Various drugs or their metabolites are excreted by the
A rat model has been used to describe the dose-
kidney. Modifications in glomerular nephropathy, tubular
dependent feature of cefepime nephrotoxicity. As this
damage or obstruction, kidney hemodynamics, and
antibiotic's concentration rises, it directly causes injury of
interstitial
nephritis
are
the
manifestations of
the renal tubules, resulting in manifestations as
nephrotoxicity (1).
proteinuria, glycosuria, and an increase in the urine salt
The onset of many acute and chronic renal disorders
excretion (4). There have been reports of interstitial
is usually correlated with drug use. The two most
nephritis in association with cefepime (5).
common forms of tubulointerstitial compartment injury
This work aimed to investigate the histological and
either acute tubular necrosis (ATN) or acute interstitial
ultrastructural alterations in the kidney of the adult albino
nephritis (AIN) are linked to nephrotoxicity.
rats in rel/ation to the dose of cefepime administration.
Additionally, the possibility of drug-induced glomerular
diseases has been brought up in an increasing number of
MATERIAL AND METHODS
publications, including immune-mediated injury or even
Experimental animals:
direct cellular injury. It is believed that an immune
Twenty-five adult albino rats with average body weight
response is a part of the pathogenesis of AIN. Frequently,
150 ± 40 g were purchased from the breeding unit of
the development of that hypersensitive reaction involves
"Helwan Farm of experimental animals - VACSERA,
cephalosporins, especially cefepime (2).
Egypt". The study was done at faculty of medicine, Al-
The development of cefepime was in 1990. Its
Azh ar University. The rats were kept for one week in
antibacterial activity is close to that of third generation
standard cages with clear sides, controlled temperature
cephalosporins, however it has a significant level of beta-
(23± 3°C), humidity (approximately 60%), 12 hours of
lactamase resistance. Furthermore, due to its high potency
light and 12 hours of darkness, and access to food and
and broad spectrum, it is useful in treating a variety of
water. Strict cleaning and care procedures were crucial for
serious illnesses, including septicemia, bacteremia,
maintaining animals in good health.
febrile neutropenia, and hospital-acquired pneumonia (3).
For an average adult with normal renal function, the
Chemical material:
recommended therapeutic dose of cefepime is 1-2 g/day
Cefepime 500 mg vial was obtained from "Pharco B
intravenously. In child with febrile neutropenia, the dose
International, Egypt". Its commercial name is
is 50 mg/kg/day intravenously (3).
"Cefepime". Each 1 ml contains 100 mg of cefepime. The
668
Received: 6/7/2022
Accepted: 11/9/2022
c:\work\Jor\vol901_95
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 679-688
A Prospective Study Comparing Three-Dimensional Ultrasonography versus
Hysteroscopy in Evaluation of Uterine Cavity in Infertile Women
Mohamed Ahmed Fekry*, Mohamed Mohamed El Toutongy, Yasser Abd El Dayem Elmorsy
Department of Obstetrics and Gynecology, Faculty of Medicine, Mansoura University, Egypt
*Corresponding author: Mohamed Ahmed Fekry, Mobile: (+20) 01006322127, E-Mail: mohafekry@gmail.com
ABSTRACT
Background: Hysteroscopy (HS) is a frequently utilized procedure for diagnosing and treating intracavitary pathologies
in gynecological practice. It is a favored procedure for assessing of infertile women. While different types of ultrasounds
scanning for infertility such as baseline or screening ultrasound, follicular monitoring ultrasounds, saline infusion
sonograms (SIS) with or without three-dimensional transvaginal ultrasonography (3D-TVS) evaluation are utilized to
evaluate uterine cavity. Abdominal ultrasound might be required with any of the above scanning modalities for better
assessment of pelvic structures.
Objective: The current study aimed to evaluate the diagnostic accuracy of 3D ultrasonography versus hysteroscopy for
assessment of uterine cavity in infertile females.
Patients and methods: The diagnostic study included 139 infertile patients. All cases were subjected to detailed history
taking with special focus on age, parity, age of menarche, past history of obstetric problems or surgeries. All patients
had pelvic 3D TVS assessment and then reassessed by hysteroscopy.
Results: The 3D TVS showed perfect performance characteristics for detection of uterine abnormalities in relation to
hysteroscopy as a standard method, with sensitivity of 96.9%, specificity of 85.7%, positive predictive value (PPV) of
94%, negative predictive value (NPV) of 92.3%, and accuracy of 93.5%. The 3D TVS showed perfect performance
characteristics regarding any Mullerian abnormality, septate uterus, subseptate uterus, bicornuate uterus, unicornuate
and arcuate uterus.
Conclusion: 3D TVS is a cost-effective, non-invasive modality without complications in comparison with HS, must be
considered as a first-line investigation in infertility.
Keywords: Hysterosalpingography, Three-dimensional TVS, Hysteroscopy.
INTRODUCTION
Infertility is failure to achieve a pregnancy after
This study aimed at assessing the diagnostic
one year or more of regular unprotected intercourse (1).
accuracy of 3D-TVS versus HS for assessment of
Uterine cavity evaluation is mandatory in infertile
uterine cavity abnormalities among females with
females. Pathologies including fibroids, polyps as well
infertility.
as Müllerian anomalies can cause infertility, recurrent
miscarriages and poor outcome of gestation. Thereby,
PATIENTS AND METHODS
their diagnosis and treatment are significant to achieve
Study Design:
pregnancy in natural and ART cycles (2).
This study was a prospective diagnostic study, and
Hysteroscopy (HS) has now become a gold-
was carried out from November 2018 to November
standard method to assess uterine cavity in infertile
2021 at Obstetrics and Gynecology Department in
females (3). Apart from direct endometrial visualizing by
Mansoura University Hospitals. This study included
the naked eye, any pathology missed by other methods
infertile women (primary or secondary) with age
can be detected and treated (3,4). Unfortunately, HS can
ranging between 18- 40 years old. Female patients less
have complications e.g. perforations, cervical
than 18 years or more than 40 years old, females with
lacerations, hemorrhage, inadequate access in cases of
pelvic inflammatory diseases, or females with active
cervical stenosis and considered as an invasive method
uterine bleeding were excluded.
(5).Two-dimensional transvaginal ultrasonography (2D-
TVS) and three-dimensional TVS (3D-TVS) are non-
Methods:
invasive procedures used to evaluate uterine cavity. The
A full history was obtained from each participant.
3D-TVS is better than 2D-TVS in diagnosing uterine
Thorough clinical examination (including general,
cavity abnormalities as it obtains a view of 3 uterine
abdominal examination and local examination) was
planes (6).
performed. Basic infertility workup including a semen
analysis,
assessment
of
ovulation,
a
Reports vary concerning the diagnostic accuracy
hysterosalpingogram was revised. All patients were
of 3D-TVS which was found to have 41.3-81.5%
subjected during the proliferative phase to two
sensitivity and 94.6-98.7% specificity (7,8). Thus, 3D-
diagnostic techniques for evaluating the uterine cavity.
TVS is considered a non-invasive and safe tool for
assessment of uterine cavity abnormalities however its
1. The 3D-TVS:
sensitivity, specificity and accuracy remain a matter of
The uterine cavity was evaluated by obtaining a mid-
debate.
coronal render image. Evaluation of mullerian
679
Received: 23/7/2022
Accepted: 25/9/2022
c:\work\Jor\vol901_96
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 689-694
Histopathological Artifacts in Skin Biopsies: Types, Frequencies and
Its Impact on Final Diagnosis
Mohammed J E Ahmed1*, Sajid Saad Mohammed2
1Department of Dermatology and Venereology,
2Department of Histopathology, Al-Yarmouk Teaching Hospital, Baghdad, Iraq.
Corresponding author: Mohammed J E Ahmed, Mobile: (+964)7848771871, *E mail: mohammedjasimessa@gmail.com
ABSTRACT
Background: Generally, in practical dermatology, the term artifacts is used to describe what is called pathomimia which
means self-inflicted lesions or that lesions induced accidentally on oral mucosa and skin. Regarding dermatopathology, the
word, `artefact' comes from the Latin term, `Ars' = art and `factum' = made. This study evaluates types of artifacts,
frequencies, and their impact on final diagnosis.
Patients and method: This observational, cross-sectional study. The study worked on 590 dermatological slides, that
stained with hematoxylin and eosin stain. Slides evaluated from archive and that collected during time of study which occur
from June 2022 to November 2022, in Al-Yarmouk Teaching Hospital, Baghdad, Iraq, analyzed for artifacts under light
microscope.
Results: Totally 590 slides were evaluated, only 69 (11.695%) show no artifacts. Slides with artifact(s) counting
521(88.305%). Histopathological artifacts were accounted for 931 because more 45% of total examined slides show two or
more artifacts. Folding artifacts were the most common type, while artefacts related to fixation were the least 307(32.975%),
6(0.644%) respectively.
Conclusion: Histopathological evaluation of skin biopsies had long, and multiple stages done by the dermatologist, assistant
pathologists, and lab technicians. That led to increased incidence of errors and artifacts. Artifacts invariably occur in the
majority of dermatopathological slides and may interfere with the interpretation of histopathological diagnosis. These
artefacts should be recognized and do all effort to avoid or at least, minimized them, which yet defied even with soft tissue
handle and wrong techniques avoidance.
Keywords: Histopathological artifacts, skin biopsies, impact on final diagnosis.
INTRODUCTION
Generally, in practical dermatology, the term
embedding stage, microtomy stage, staining stage and
artifacts used to describe what call it pathomimia which
mounting process (8).
mean self-inflicted lesions or that lesions induced
accidentally on oral mucosa and skin (1).
Artifacts can be categories as below according to
Regarding the dermatopathology, term biopsy
known stages of dermatopathology processing:
derived from Greek word bios = `life' and opsis = `sight'
· Surgical removal of specimen related artifact
(2,3). The word, `artefact' comes from the Latin term, `Ars'
· Fixation artifact
= art and `factum' = made (4). Skin biopsy remains the
· Tissue processing artifact
paradigm procedure for obtaining sufficient tissue for
· Embedding artifact
histological assessment and subsequently for obtained
· Microtomy artifact
final diagnosis (5).
· Staining artifact
Artefact refers to "an artificial structure or tissue
· Mounting and Coverslipping artifact.
alteration on a prepared microscopic slide caused by some
extraneous factors" (6). Artifacts may lead to changing of
Surgical biopsy procedure:
normal morphology or even cytology of tissue, and with
Many
types
of
artifacts
encountered
in
multiple artifacts of same slide may give fully non useful
dermatopathology are occur in this stage, like epithelial
tissue specimen, which may lead to major errors and mal-
vacuolation and connective tissue separation along with
diagnosis histopathological picture (7). Regarding the
hemorrhage (Fig. 1) all may cause by injection of
artifacts influence on final histopathological diagnosis,
anesthesia (9). That can be avoided by prelesional injection
artifacts may be minimally affected or may lead to totally
of anesthesia. Crush (Fig. 2) and hole artifact (Fig. 3) may
distrusted prepared stained tissue (4).
cause by using of forceps with over-force before the stage
Because of histopathological evaluations are multi-
of fixation and produced by syringe needle that use for
stages process, so many artifacts may happen through
separation of biopsy, respectively (10,11,3) which can be
these stages which includes; surgical removal of
avoid by gently holding the biopsy and use Terson lens
specimen, fixation of obtained tissue, processing stage,
capsule forceps (12). During obtaining of biopsy,
electrocautery may be used to cutting or for hemostasis
Received:22/9/2022
Accepted:23/12/2022
689
c:\work\Jor\vol901_97
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 695-700
Detection of Fungal Infection in Patients on Hemodialysis with
Double Lumen Catheter by Conventional and Molecular Methods
Rusul Jabbar Abdulzahra*1, Alaa kassar Salih2, Azhar A. F. Al-Attraqchi3, Shatha Hussain Ali4
1 College of Medicine, Al-Nahrain University, Baghdad, Iraq
2 Department of Surgery, College of Medicine, Al-Nahrain University, Baghdad, Iraq
3 Department of Microbiology, College of Medicine, Al-Nahrain University, Baghdad, Iraq
4 Department of Pediatrics, College of Medicine, Al-Nahrain University, Baghdad, Iraq
*Corresponding author: Rusul Jabbar Abdulzahra, Moblile: 009647705341439
Email: rusulrusul1996@gmail.com
ABSTRACT
Background: In hemodialysis patients, tunneled, cuffed, double-lumen catheters are frequently used for long-term venous
access. Infections associated with these catheters are one of the major causes of morbidity and resource usage in the
hemodialysis population. Objective: The aim of the current study is to investigate the frequency and types of fungal
infection in patients on hemodialysis with double lumen catheter in Imamein Kadhimein Teaching Hospital and Al-Karama
Teaching Hospital, Iraq.
Material and methods: For the purpose of detecting a fungal infection, 19 blood samples from hemodialysis patients with
double lumen catheters were subjected to both BacT/ALERT system (Blood Culture) and molecular approaches (Multiplex
Real Time PCR). Results: By using traditional techniques, the fungi Candida spp. (2%), and Cryptococcus spp. (1%) were
detected. The following fungi were identified using molecular techniques: (2%) R.oryzae.
Conclusion: The nephrologist should be aware of the many fungal infections that patients receiving hemodialysis with
double lumen catheters may acquire, including R.oryzae, Candida spp., and Cryptococcus spp. The fungi mentioned above
may be acquired during hemodialysis or may already be present as underlying illnesses. This study established that
hemodialysis patients with renal impairment who use double lumen catheters could have several complications.
Keywords: Fungal Infection, Hemodialysis, Double lumen, M-RTPCR, BacT/ALERT, Case series, Al-Nahrain University.
INTRODUCTION
culture should be taken from a catheter and a peripheral
With a rising worldwide burden among solid organ
vein from patients in whom CRI is suspected (6).
and bone marrow transplant recipients, cancer patients,
Molecular methods for the precise detection of certain
people living with HIV and those receiving
genera or species, as well as broad range (or pan-fungal)
immunomodulatory therapies, invasive fungal diseases
assays to capture "all fungi," are available for the direct
(IFDs) represent a serious hazard to human health,
detection of fungal DNA in clinical specimens (7).
especially in the immunocompromised. The pathogens
Initially, the detection of mucorales DNA from clinical
Candida spp. and Aspergillus spp. are the most frequent
specimens was primarily established for tissue samples as
causes of IFDs, followed by Pneumocystis and the
an adjunct to histopathological and microbiological
Mucorales, with the prevalence of IFDs varied by
diagnosis (8,9). However, recently, molecular blood and
geographic location and patient population from pathogen
even urine tests were developed (10). The load of
to pathogen (1). /For hemodialysis and IV medicine,
circulating mucorales species DNA in serum was shown
central venous catheterization with a double-lumen
to be extremely high compared to invasive aspergillosis,
catheter is frequently used (2). As more permanent
possibly due to the angioinvasive character of mucorales
vascular access, arteriovenous fistulas, is used usually,
infections (11). As a result, blood samples are suitable for
but tunneled and cuffed double lumen catheters are being
therapeutic monitoring and suspicion-free screenings of
utilized more frequently for acute procedures (3).
high-risk patients (12).The aim of the current study is to
Infections associated with catheters are a frequent
investigate the frequency and types of fungal infection in
problem and a significant source of morbidity and death
patients on hemodialysis with double lumen catheter in
in these individuals (4).
Imamein Kadhimein Teaching Hospital and Al-Karama
Fever, localized redness, and discomfort at the
Teaching Hospital, Iraq.
insertion site are less sensitive and specific indicators of
catheter-related infection. The most accurate way to
PATIENTS AND METHODS
identify fungi is by culture, which also enables the
A total of 19 patients aged between 13 and 70 years, who
assessment of an antifungal's susceptibility (5). To identify
were receiving hemodialysis with double lumen catheters
a catheter-related infection, a quantitative blood culture
in Imamein Kadhimein Teaching Hospital and Al-
collected from a peripheral vein and a culture of the
Karama Teaching Hospital were included in our study.
central venous catheter tip can be employed. Samples for
Blood samples from participants were collected from
December 2020 to February 2021.
695
Received: 23/07/2022
Accepted: 25/09/2022
c:\work\Jor\vol901_98
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 701-705
Cytokines in Chronic Hepatitis C Liver Diseases: Interleukin 20
Nabila Hassan Ahmed1, Heba Fouad Pasha2, Mohamed Nagiub El-khashab1, Rania Mostafa Mohamed3
Departments of 1Tropical Medicine and 2Biochemistry, Faculty of Medicine, Zagazig University, Sharkia, Egypt
Department of 3Tropical Medicine, El-Ahrar Teaching Hospital, Zagazig, Sharkia, Egypt
*Corresponding author: Nabila Hassan Ahmed, Mobile: (+20) 01224892292, Email: nabilaahassanahmed@gmail.com
ABSTRACT
Background: The Interleukin (IL-20) cytokine subfamily is a major IL-10 cytokine subfamily that is thought to produce
a role in the response to hepatic injury. The IL-22 cytokine is the most studied of this family to the inflammatory
imbalance of the liver, and it primarily serves bi-role, it is supposed to increase the susceptibility to HCC development.
Objective: We aimed to study the relationship between IL-20 serum levels and the clinical parameters of chronic HCV-
associated diseases.
Patients and Methods: In this case-control study, a total of 3 groups included Chronic hepatitis C, liver cirrhosis, and
HCC post HCV patients (15 in every group) compared by a healthy group concerning serum IL-20 assay. Clinical
features, laboratory, radiological elements, and CLD scoring were evaluated and compared with IL-20.
Results: The April and FIB-4 scoring show a significant difference (p-value < 0.001) between the chronic hepatitis c
patients and both the cirrhosis and HCC group, with no significant difference between cirrhosis and HCC groups. There
was a significant difference between the three groups regarding the child. Pugh classification (HCC group by 40% as
both child B and C, while 20% child A). In both HCC and cirrhosis groups, the IL-20 level is not related significantly
to the first presenting symptom.
Conclusions: Newly studied cytokines such as IL-20 are easy, cheap ELISA tests that can be useful in assessing the
related clinical parameters of chronic liver diseases.
Keywords: Cytokines, Interleukin, IL-20, Hepatitis C, Liver cirrhosis, Hepatocellular carcinoma.
INTRODUCTION
injury, promoting survival, and inhibiting apoptosis of
Hepatocellular carcinoma (HCC) accounts for the
epithelial cells [5].
common cause of primary liver cancers and is the
The work aims to study the relationship between
principal cause of cancer-linked death worldwide.
IL-20 serum levels and the clinical parameters of
Infections with the HBV or HCV and alcohol use are
chronic HCV-associated diseases.
the most important risk factors [1].
Unsettled chronic inflammation is a leading
SUBJECTS AND METHODS
feature of HCC, regardless of the etiology. Local
The study design
activation of cell populations in the liver in response to
This case-control study was carried out at Zagazig
organisms and/or tissue injury may initiate a linked and
University Hospitals at the Department of Tropical
coordinated cascade process, followed by immune cell
Medicine from March 2020 to July 2021. Three
infiltration, and eventually repair of the organ. The
diseased groups related to HCV infection 15 patients in
release of soluble factors, such as cytokines, occurs as a
each group (HCC, Cirrhosis, and Chronic hepatitis)
result of this fine coordination of events [2].
compared to 15 healthy participants in a controlled
Cytokines have been studied as potential
group.
biomarkers for predicting different stages of HCC and
The study included patients of HCV infection with
for additional understanding of HCC formation
age more than 18 years old (positive antibody by ELISA
mechanisms. The initial inflammatory response in the
and quantitative PCR) and excluded other causes of
liver is unresolved in the presence of HCC-promoting
chronic liver diseases as autoimmune, other chronic
risk factors, and so, the unbalanced expression of
liver viral diseases HBV (excluded by HBV surface
cytokines promotes a persistent healing response [3].
Antigen), known metabolic, autoimmune diseases
By enhancing hepatocyte proliferation and
(excluded by autoantibodies were negative), and known
regeneration, which can lead to mutagenesis and set the
vascular diseases (Ultrasound Doppler).
stage for HCC development, this response may lead to
Liver cirrhosis was confirmed by history, clinical,
the sequential development of inflammation and
laboratory, and radiology evaluation. HCC was
eventually HCC. Once HCC has formed, cytokines
evaluated by alpha-fetoprotein and tri-phasic CT, and
released by the tumor or immune cells can act on the
extra-hepatic malignancy or metastases were excluded.
malignant lesion to promote tumor survival through a
Pregnant and lactating females were also excluded.
variety of mechanisms [4].
Other interleukins in the IL-20 subfamily have the
Methods:
common function of communicating with leukocytes
Complete history, detailed clinical examination,
and epithelial cells in different tissues such as the liver.
routine investigations, radiological assessment (US
They are crucial in controlling tissue regeneration after
(Sonoscape c11) and tri-phasic CT scanning (Philips
Ingenuity 128)) and the studied interleukin-20 assay (3-
701
Received: 10/06/2022
Accepted: 17/08/2022
c:\work\Jor\vol901_99
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 706-715
What Does 3/4D Ultrasound Add to 2D Examination in The
Assessment of Fetal Neural Anomalies: Tertiary Center Experience
Nashwa Mohamed Adel*1, Ahmed Kodb Ebd El Hakeem2,
Mohamed Ali AbdelKader3, Mohamed Ahmed Amin1
Departments of 1Radiodiagnosis and 2Obstetrics and Gynecology,
Faculty of Medicine, Minya University, Minya, Egypt
Department of 3Obstetrics and Gynecology, Faculty of Medicine, Ain Shams University, Cairo, Egypt
*Corresponding author: Nashwa Mohamed Adel, Mobile: (+20) 01005651501, E-Mail: nashwaadelrad80@yahoo.com
ABSTRACT
Background: Central nervous system (CNS) malformations are the most common congenital abnormalities.
The detection of fetal anomalies was one of the earliest uses and remains a pivotal application of prenatal ultrasound.
Objective: This prospective study aims to clear out the value of 3/4D examination with advanced techniques (TUI, MIP
& surface mode) over 2D in the evolution of fetal neural anomalies.
Patients and methods: 120 pregnant women with suspected CNS fetal anomalies by 2D US were examined over a
period starting from January 2015 until October 2017. Fetal gestation ranged from 8-39 weeks with a 24-week mean
age. In all patients, 2D and 3/4D ultrasound as well as fetal Doppler were performed.
Results: 3/4D ultrasound shows higher sensitivity in the detection of neural anomalies such as anencephaly, Chiari
malformation, Hydranencephaly, holoprosencephaly, encephalocele, meningocele (spina bifida with no brain changes),
Iniencephaly and Dandy-Walker variants, 3/4D ultrasound of 100% deletion rate over 85% for the 2D ultrasound. 3/4d
& 2D ultrasound had the same detection rate of anomalies like hydrocephalus (communicating & non-communicating),
microcephaly, and Dandy-Walker malformation.
Conclusion: 3/4D ultrasound had a higher sensitivity in the detection of fetal neural anomalies over 2D which allows
early interference or decision-making to save fetal or material life.
Keywords: Prenatal ultrasound, 3D/4D ultrasound, Congenital brain anomalies, Fetal CNS.
INTRODUCTION
The most frequent developmental abnormalities
Following 2D ultrasonography, 3D/4D ultrasound
identified at birth and in conceptuses that spontaneously
has been employed as an imaging modality. Thus, the
abort are those affecting the central nervous system
current
paradigm
involves
using
3D/4D
(CNS) (1). There are 1 to 65 cases for every 1,000 births
ultrasonography to do a target scan after 2D
(2). Embryos from spontaneous abortions have a rate of
ultrasonography has formed an initial diagnostic
neural tube abnormalities that is around ten times
impression (5,6).
greater than that of newborns. CNS abnormalities are
So, this study aimed to clear out the value of 3/4D
typically found in early-death chromosomal syndromes
examination with advanced techniques (TUI, MIP &
in aborted embryos and less frequently in aborted babies
surface mode) over 2D in the evolution of fetal neural
with fewer chromosomal abnormalities (2,3).
anomalies.
Ultrasound has a major role in the evaluation of
fetal anomalies, one of them being central nervous
SUBJECTS AND METHODS
system anomalies, 2D ultrasound alone is helpful to
A prospective study was conducted at Minya
evaluate several conditions but it lakes advanced
University and OBST/GYN tertiary center, 120
capabilities to evaluate some structures as mid-line
pregnant women with suspected CNS fetal anomalies
structures such as lakes of the general overview of the
by 2D US were examined over a period starting from
head and spine unlike volumetric assessment (3).
Jan 2015 until Oct 2017. Fetal gestation ranged from 8-
The rising of advanced ultrasound machines and
39 weeks with a 24-week mean age. In all patients, 2D
their technologies to create volumetric examination of
and 3D/4D ultrasound as well as fetal Doppler were
the fetus parallels the wider availability of 3/4D
performed.
machines, and the assessment of the fetal body and CNS
anomalies becomes easier, more efficient, and lesser
Inclusion criteria:
time consumer (4).
1. Previous history of congenital anomalies.
3/4D ultrasound allows examination of the fetus
2. Family history of congenital or chromosomal
in three orthogonal planes by taking one volume saving
abnormalities.
time and effort. It is considered also a quick way to
3. Diabetic patients with polyhydramnios.
image the mid-line structures in the brain, especially the
4. The patient who referred with a sonographic
corpus callosum & vermis. The surface mode helps to
report showing or suspecting fetal anomalies.
obtain a fully detailed image of any associated facial
5. Patient with +ve TORCH screen.
defect (2,4).
6. Ultrasound
was
done
and
revealed
Polyhydramnios
706
Received: 21/7/2022
Accepted: 23/9/2022
c:\work\Jor\vol901_100
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 716-720
Molecular Detection of (Urec , Mrpa , Hpma) Genes in Proteus mirabilis Bacteria
Isolated From Patients with Urinary Tract Infection
Somaya A. J. Al-obaidi1* and Ashwak B. J. Al-Hashimy2
Institute of Genetic Engineering and Biotechnology for Post Graduate Studies, Baghdad University, Iraq
*Corresponding author: Somaya A. J. Al-obaidi Mobile: 0096 47706293099, E-mail: somaia.ali1200a@ige.uobaghdad.edu.iq
ABSTRACT
Background: Urinary tract infection (UTI) is the term for bacterial colonization or infection of the urinary bladder, ureters
and tract. Objective: This study aimed to detect specific virulence genes in Proteus mirabilis isolated from urine samples
of Iraqi patients with urinary tract infection.
Patients and methods: During the study period from early December 2021 to late April 2022, urine specimens (103
specimens) were collected from patients with symptoms and signs of UTI from various hospitals in Baghdad and private
laboratories in Baghdad. Samples were collected from men and women of different age groups (4-75 years) with clinically
suspected UTI.
Results: All specimens were identified based on their properties on media (blood agar and MacConkey agar). Colonies on
blood agar were identified as P.mirabilis due to their colonization, also had a characteristic fishy smell and appeared to form
smooth, pale or colorless colonies on Macckongy agar instead, further diagnosed by using VITEK 2 system and molecular
diagnosis by urec gene also gave positive results for 22 isolates of P. mirabilis. (mrpA, hpmA) genes detection results: mrpA
presence percentage was 100%, while hpmA was 22.72%.
Conclusion: The molecular technique showed that the mrpA, hpmA and urec genes associated with virulence factor include:
adherence activity, produce Alpha () hemolysin and urease.
Keywords: Proteus mirabilis, Urinary tract infections, PCR, Gene.
INTRODUCTION
This study aimed to detect specific virulence genes
Urinary tract infections (UTIs) occur when harmful
in Proteus mirabilis isolated from urine samples of Iraqi
microscopic organisms enter your urinary tract, most
patients with urinary tract infection.
UTIs are caused by bacteria. This condition can affect the
MATERIALS AND METHODS
urinary tract, which is referred to as urethritis; the
1. Samples collection:
kidneys, which is referred to as pyelonephritis; and the
In this study, 103 urine specimens were collected
urinary bladder, which is referred to as cystitis (1).
from patients with signs and symptoms of urinary tract
Escherichia coli, Proteus mirabilis, Pseudomonas
infection from different age groups (4-75 years) of both
aeruginosa, Klebsiella pneumoniae, Staphylococcus
sex in different hospitals and private laboratories in
saprophyticus, Enterococcus faecalis and Enterobacter
Baghdad from the beginning of December 2021 to the end
cloacae are the most common bacterial UTIs (2).
of April 2022.
Risk factors of UTIs are female anatomy, sexual
activity, diabetes, family history, and obesity (3). Some
2. Isolation and identification of P. mirabilis:
groups of people are more prone to UTI than others, for
In the laboratory, under sterile conditions, all urine
example diabetic patients and female. Females have
samples (103) were cultured on (blood, nutrient agar, and
fourteen times more chance to develop UTI than men due
MacConkey agar) at 37 °C for 24-48 hours, and further
to several factors. Such as they has a shorter urethra
diagnosis was made for suspected colonies based on
compare to men, which open nearer to the anus so that the
morphological characteristics and biochemical tests, and
lower third of urethra is continually contaminated with
the molecular approach of the ureC gene with specific
pathogens from vagina and rectum (1).
primers.
Uncomplicated UTIs usually affect the bladder only.
Cystitis occurs when bacteria invade the lining of the
Molecular methods
bladder. Most organisms that cause UTIs are enteric
Genomic DNA extraction
coliforms that normally inhabit the vaginal opening
DNA extraction was performed; Proteus mirabilis
around the urethra. These microorganisms travel through
isolates were cultured in brain heart broth for 24 hours at
the urethra into the bladder and cause UTIs. People who
37°C. Genomic DNA was isolated from bacterial growth
urinate frequently and void their bladders have a lower
according to the Favour Prep Blood/Cultured Cell
risk of UTIs (4).
Genomic DNA Extraction Mini Kit protocol. A Quantus
Fluorometer is used to determine the concentration of
extracted DNA to determine sample quality for
716
Received: 23/07/2022
Accepted: 25/09/2022
c:\work\Jor\vol901_101
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 721-726
Acid-Base Disturbances in Pediatrics Infected With COVID-19,
A Cross Sectional Study
Hoda Atef Abdelsattar Ibrahim1*, Abeer Mostafa 2, Eatematd Helmy3,
Aya Ahmed Amin4, Sally kamal Ibrahim Ishak1
1 Pediatric Department, 2 Medical Biochemistry and Molecular Biology Department,
Faculty of Medicine, Cairo University, Egypt
3 Pediatric Department, El-Matria Teaching Hospital, General Organization for Teaching Hospitals and Institutes, Egypt
4 Cancer Epidemiology and Biostatistics, National Cancer Institute, Cairo University, Egypt
*The corresponding author: Hoda Atef Abdelsattar Ibrahim
ORCID: 0000-0001-5399-8861, E-mail: hodaibrahim424@cu.edu.eg
ABSTRACT
Background: Data on the pathophysiology and clinical spectrum of COVID-19 in children are few. The dominant
respiratory outcome of COVID-19 is arterial hypoxaemia. Arterial Blood Gas (ABG) analysis helps detect early acid base
balance alternations. Acidbase imbalance hasn't been outlined well in children with COVID-19.
Objective: The aim of the current study is to evaluate the blood gas levels as a reflection to the acid-base status among
COVID19 children at admission and to detect the pattern of acid-base disorders.
Patients and methods: A total of 62 children with positive nasopharyngeal swabs were assessed for ABG at the time of
admission in ElMatria Teaching Hospital from February 1, 2021 to the end of July 2021. Results: Among the study subjects,
53% were males and 47% were female. Most affected age group was <2 years. 53% presented by GIT manifestation (fever,
nausea, vomiting, diarrhea), 37% presented by respiratory manifestation (fever, cough, dyspnea). Most common ABG
finding was hypoxemia in 90.3% (P<0.001). PH (potential hydrogen) of about 50% was within the normal range, while
37.1% had acidosis and 12.9% had alkalosis (P<0.001). Base deficit was significantly found in 53.4% (P=0.004), while
lactic acid was only elevated in 32.3% (P=0.005).
Conclusion: ABG should be evaluated in all COVID-19 patients at admission. Children may present with atypical COVID
symptoms as diarrhea, and children may resist changes in acid-base balance.
Keywords: Coronavirus, ABG, Acidosis, Alkalosis, Cross sectional study, ElMatria Teaching Hospital.
INTRODUCTION
On March 2020, the Coronavirus disease of 2019
One of the most major complications of COVID 19
(COVID-19) was declared by the World Health
is the arterial hypoxemia, thus affecting the lung
Organization (WHO) as a pandemic (1). A worldwide
compliance which could require mechanical ventilation
regular attempt is needed to prevent the more unfold of
(6,7). Acid base imbalance is a frequent association with
the virus. During the COVID-19 outbreak, many studies
patients who suffer from serious viral illnesses including
have investigated laboratory biomarkers used to treat and
COVID-19(8). Tropism of the virus for kidneys and lungs
determine the prognosis of COVID-19 patients, but none
might hypothetically result in frequent acidbase changes
have investigated arterial blood gas and acid-base
due to kidney injury and pneumonia (9,10). To monitor acid
changes in infected children. Very few studies have done
base balance of COVID-19 patients, ABG should be
so. As COVID-19 becomes more severe, many patients
carried out. Most cases of acidbase changes are mild and
require admission to the intensive care unit (ICU),
rarely symptomatic and may have a low tendency to affect
resulting in frequent arterial blood gas (ABG) analysis.
organ homeostasis. Contrariwise, severe changes of acid
Various test results have been identified as risk predictors
base balance can have severe multi-organ significances.
that may help in staging, monitoring, prognosis, and
The prevalence and impacts of acidbase disorders in
treatment of COVID-19 patients (2,3).
COVID-19 patients have been poorly assessed until now
What is currently known is that children may have
(11).
milder symptoms and require hospitalization less
As angiotensin-converting enzyme 2 (ACE2) is the
frequently than adults. Nonetheless, on May 14, 2020, the
entry pathway for SARS-CoV-2 (12), the renin-angiotensin
US Centers for Disease Control and Prevention (CDC)
system (RAS) is affected by COVID-19. When SARS-
reported pediatric multisystem inflammatory syndrome
CoV-2 enters cells, it downregulates ACE2, upregulates
(MIS-C) associated with COVID-19 (4,5). This statement
RAS signaling, and produces angiotensin II and
is from a subset of pediatric patients who presented with
aldosterone. Both angiotensin II and aldosterone affect
multiple organ failure and severe inflammation and were
renal processing of hydrogen (H+) and bicarbonate
diagnosed as SARS-CoV-2 positive.
(HCO3) and can cause acid-base disorders. (13). Reports on
the clinical picture of COVID-19 in children are missing
721
Received: 02/08/2022
Accepted: 22/09/2022
c:\work\Jor\vol901_102
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 727-732
Impact of Titanium Tetra Flouride Material and 810nm Diode Laser on
Demineralized Human Enamel (In Vitro Study)
Amjed Kamel Al-Hassnawi1, Nada Jafer MH. Radhi2*
(1) Ph. D. student, Department of Pediatric and Preventive Dentistry, College of Dentistry/University of Baghdad,
Iraq.Specialist dentist in specialized dental center.Dewanyiah governorate.
(2) Department of Pediatric and Preventive Dentistry. College of Dentistry/University of Baghdad, Iraq.
*Corresponding author: Nada Jafer MH. Radhi, Phone: (+964)7806314951, Email: nada.radhi@codental.uobaghdad.edu.iq
ABSTRACT
Background: Dental enamel was treated with laser irradiation and fluoride compounds as a method to enhance fluoride
absorption by the enamel, which resulted in a rise in the mineral content of the enamel and a significant boost in its resistance
to acid demineralization. Objective: The purpose of this research was to look into the effects of Titanium tetra Fluoride
(TiF4) with or without diode laser on the demineralized enamel.
Material and methods: The sample consisted of 65 premolars teeth: 5 teeth remained sound for energy dispersive
spectroscopy (EDS) analysis where 60 teeth were divided into 6 groups by treatment (N=10): (1) control negative (deionized
water), (2) control positive (acidulated phosphate fluoride gel (APF)), (3) 6% Titanium tetra fluoride (TiF4) solution, (4)
diode laser (810 nm, 0.5W, 60 s), (5) Laser then TiF4, and (6) Tif4 then Laser. Microhardness was measured before and
after demineralization then after treatments. Five samples from each group were selected randomly for EDS analysis.
Results: Microhardness increased significantly after all treatments (p<0.05). Results revealed a significant difference for
all treatment groups (p<0.05). EDS analysis revealed that fluoride content was greater in 6%TIF4 then Tif4 with Laser
groups, while the calcium content was greater in control positive followed by TiF4 groups.
Conclusion: TiF4 alone or in combination with laser enhancing demineralized enamel microhardness and fluoride content.
Diode laser before or after TiF4 had minimal extra impact on remineralization.
Keywords: TiF4, Demineralized Enamel, Diode laser, Microhardness, Experimental study, University of Baghdad.
INTRODUCTION
Dental caries is one of the most common oral health
impact on caries therapy and lowers enamel solubility and
issues, resulting in tooth demineralization caused by
permeability (4).
organic acids produced by biofilm bacteria from the
Diode lasers, which are semiconductor lasers,
metabolism of dietary fermentable carbohydrates,
produce coherent light of a single wavelength. Due to its
primarily sugars. The increase of resistance of teeth to
compact size, low power consumption, and cheap cost of
acid attack can be achieved by fluoride that gives hardness
manufacture, diode lasers have become the most
and durability to the tooth enamel and protect against
prevalent kinds of lasers in the world, being utilized in a
caries (1).
wide range of components and disciplines of medical and
Titanium tetrafluoride (TiF4) has been studied since
dental operations (5).
1972 and has indicated promising preventive and
therapeutic properties. It is reported as a stronger
When tissues interact with laser energy, the impact
cariostatic agent compared to other fluoride compounds
is affected by emission wavelengths, tissue optical
via formation of an acid-resistant coating composed of
characteristics, exposure period, laser intensity, and laser
titanium dioxide or other organo-metallic complexes, and
energy absorption into tissues. The absorptive effect
increased fluoride uptake due to the acidic nature of the
governs how the atoms and molecules of the target tissue
compound (2).
convert laser light energy into heat, chemical, acoustic, or
Titanium tetra fluoride is metal fluorides, a nontoxic
non-laser light energy (6).
element, and no side effects have been reported with it.
The benefit has been attributed to the compound's
Laser irradiation is among the new techniques that
titanium group, which synergizes the impact of fluoride
might be promising in the field of remineralization (7)
(3).
especially when applied with fluoride (2).
Laser irradiation has been used in the area of
The impact of diode laser in conjunction with
preventative dentistry for its potential to enhance tooth
titanium tetrafluoride on demineralized enamel
structure. Low-power red and near-infrared lasers seem to
remineralization had not been explored before; hence the
be a more appealing option for caries inhibition than high-
purpose of this research was to compare the potential
power lasers. It has been shown that combining topical
effect of TiF4 alone or in combination with diode laser on
mineral treatments with laser irradiation has a synergistic
demineralized enamel.
727
Received: 23/07/2022
Accepted: 25/09/2022
c:\work\Jor\vol901_103
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 733-737
Free Flank Modified Supine Percutaneous Nephrolithotomy for
Management of Primary Renal Stones
Esam Abdelgawad1*, Khaled M. Abdelhalim1, Hassan A. Abdelwahab1, Mohamed Bakr2, Ahmed M. Kadry1
1. Urology Department, Faculty of Medicine, Suez Canal University, Egypt
2. Urology Department, Faculty of Medicine, Port Said University, Egypt
Corresponding author: Esam Abdelgawad, Telephone: +201501599744,
ORCID: 0000-0003-2055-4791, E-mail: esam76u@gmail.com
ABSTRACT
Background: Prone percutaneous nehprolithotomy (PCNL) is associated with patient inconvenience, circulatory and
ventilatory impediment. Objective: The aim of the current study is to evaluate the outcome of percutaneous
nephrolithotomy in the free flank modified supine position (FFMSP) regarding the operation duration, hospitalization time,
and the effectiveness and safety.
Patients and methods: From January 2020 to June 2021, 60 patients (36 males and 24 females) with renal stones underwent
PCNL procedure in FFMSP. Descriptive statistics, puncture site, numbers of punctures, operative time, stone free rate,
bleeding, modified Clavien grade of complication, re-treatment rate, additional procedures and hospitalization time were
presented. Results: Multiple stones were in 53% of the cases, the stone distribution was mainly in the inferior calyces and/or
the pelvis of the kidney. Positive history of renal surgery was reported by 70% of cases. The site of puncture was mainly
through the inferior calyx in 83% of cases, 23% of the cases were in need for two punctures, 26% were in need for re-
treatment, mean duration of operation was 89.67 (SD 25.2) minutes, mean hospitalization time was 8.3 (SD 6.32) days and
the patient's ratio who were free from stones was 86%. The average need for an additional procedure was 20%. The
complication grade according to Calvien Dindo classification is mainly grades 2,3A and 4B. Conclusions: The supine
position is effective with average operation duration; however, it has a high complication rate, an increased need for
additional procedures, a re-treatment rate, a long hospital stay and an increased rate for blood transfusion.
Keywords: Supine position, free flank modified supine position, Stone free rate, Descriptive study, Suez Canal University.
INTRODUCTION
the prone position to get better results and conquer these
After Goodwine et al., firstly described the
difficulties (10).
percutaneous kidney access in the prone position, the
In 1998, Valdivia et al., was the first urologist to
earliest case of percutaneous extraction of stone was
perform supine PCNL, reporting many advantages for the
reported. Since then prone percutaneous nehprolithotomy
patients at high anesthetic risk (11).
(PCNL) has been popularly recognized procedure and its
There are many benefits for positioning the patients in
indications were well described (1,2). Recently, PCNL is
supine position, which is easier and less time consuming
best indicated for management of bulky kidney stones,
because there is no need to convert the patient position from
hard stones difficult to crash, or stones occurring in
lithotomy to prone. The supine position gives easy control
anomalous kidneys (3,4).
and accessibility to the airway and is safer for patients with
Historically, PCNL has been carried out in the prone
impaired function of the cardiopulmonary system and
position since it was believed to be a harmless access to
patients with morbid obesity who need long procedure (12).
the kidney allowing puncture of the posterior calyces
The intrarenal pressure is maintained low due to the
through Brodel's line with minimal parenchymal
fact that the tract is horizontal or inclined downwards,
bleeding and avoiding peritoneal and visceral injuries
which may enhance the natural clearance of stone
(5,6). The prone PCNL position causes limitation of the
particles. Both Le Roy et al. and Hopper et al. found only
respiratory movement therefore, is not suitable for all
2% of the patients to have a retro renal colon in supine
patients (7). In the prone position during PCNL, there is
position, which elevated to 10% when prone (13,14). Shoma
reduction of the lung compliance caused by limitation of
et al. studied a total of 130 patients who were operated by
the chest and diaphragmatic movement due to increased
PCNL in a prospective and nonrandomized study in both
abdominal pressure. There is also a lowering of cardiac
prone and supine; found that the stones were cleared in 84
output. All of these make difficult challenges to the
and 89% of patients respectively (15). PCNL in the supine
anesthetist (8).
position can be used safely and effectively as the prone
Marked increased body weight, impaired status of the
procedure (15).
cardiopulmonary system, and skeletal deformities may
Supine PCNL is a head to head alternative to the
cause great challenges to the operator and the anesthetist
standard prone position (16). More prospective, randomized
(9) .The increasing rate of PCNL maneuvers together with
multi-institutional studies are needed to prove the efficacy
increased experience has encourage the urologists to alter
and safety of both procedures. Moreover, recognition and
733
Received: 23/07/2022
Accepted: 25/09/2022
c:\work\Jor\vol901_104
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 738-742
Flu vaccination effectiveness in Tabuk City, Saudi Arabia
Rofayda Mansour Ahmed Mohamad1*, Salem Khalil Adhahi2, Intisar Alwadai1,
Waheed Ali Alshehri1, Shatha Talal Alhakami1, Manal Muhsen Alatawi1, Nadia Salaman Atawi1,
Mona Salem Atawi1, Abdulla Saeed Althobaiti1, Mohammed Ali Khubrani1, Sakeina Saleem Haroon Mohammed3
1Preventive Medicine Department, 2Department of Home Health Care, and
3Family Medicine Department, King Salman Armed Forces Hospital, Tabuk, Saudi Arabia
*Corresponding author: Rofayda Mansour Ahmed Mohamad, Phone: +966545450874; Email: rofayda.mohamad22@gmail.com
ABSTRACT
Background: There are controversies about vaccination effectiveness of seasonal influenza and its wide variation across
seasons and countries. Objectives: This study aimed to estimate the effectiveness of seasonal influenza vaccination among
adult population in Tabuk City, Saudi Arabia.
Methods: This prospective cohort study included residents aged 18 years or older. 532 participants were divided regarding
vaccination status into two equal groups: the first (vaccine group) received the current influenza vaccine, and the other
(control group) received nothing. Data were collected through a structured questionnaire. The vaccine effectiveness was
estimated based on self-reported data regarding the incidence of chest infection or flu-like illness (FLI) after the vaccination,
duration of the FLI, ability to do the normal daily activity, seeking medical care, need for visiting a clinic, taking
medications, and hospital admissions.
Results: The rate of chest infection after vaccination showed no significant difference between the two groups (p=0.879).
The incidence of FLI in winter following vaccine intake was significantly higher in the vaccine group compared to the
control (p=0.038). The FLI affected the daily life activities of 36 subjects (13.5%) belonging to the vaccine group compared
to 28 subjects (10.5%) in the control group (p=0.286). Seeking medical service for the FLI was recorded in 7.5% and 4.5%
of the vaccine and the control groups, respectively, with no significant difference (p=0.145).
Conclusions: The seasonal flu vaccine lacked significant effectiveness among adult population in Tabuk City, Saudi Arabia.
Regularly improving the immunogenicity and efficacy of influenza vaccines seems a necessity.
Keywords: Effectiveness; Influenza; Saudi Arabia; Seasonal influenza; Vaccination; Tabuk
INTRODUCTION
recommends the annual vaccine intake by healthcare
Seasonal influenza is a highly infectious acute
professionals as well as the public to prevent influenza
disease. It causes inflammation of the upper respiratory
pandemics (7-10). Concerns have emerged regarding the
tract leading to a variety of symptoms, such as high fever,
impact of influenza vaccination on the burden and
sore throat, coryza, body aches, and possibly lower
severity of influenza. There are controversies about the
respiratory tract illness (1). It is caused by influenza A and
vaccination effectiveness and its wide variation across
B virus subtypes. Influenza A is the most common type in
seasons and countries (11-13).
humans, and it has a characteristic high mutation rate,
There is a necessity for monitoring the direct
which is over 300 times faster than influenza B. The
protective effect of the vaccine each season. Therefore,
mutations in the virus antigenic proteins are attributed to
this study was conducted to estimate the effectiveness of
antigenic drift and antigenic shift (2).
seasonal influenza vaccination among adult population in
Globally, seasonal influenza affects about five
Tabuk City, Saudi Arabia.
million people, with approximately 500,000 deaths
annually, particularly among young children and the
METHODS
elderly (3). Also, it causes a substantial economic burden
Study design and settings
because of the associated complications, hospital
This prospective cohort study was conducted in Tabuk
admissions, and loss of productivity (4).
City, which is located at the North-Western area of Saudi
Vaccination can reduce the incidence of flu and
Arabia.
lessen the severity of infection by eliciting strain-specific
Sample size calculation
immunity. It constitutes the primary approach for
The study sample size was calculated based on an
controlling influenza and is recommended by most
expected incidence in the unexposed of 0.03, an assumed
healthcare providers (5, 6).
relative risk of 3, a confidence level of 95%, and a desired
In Saudi Arabia, seasonal influenza remains a threat
power of 80. The total sample size was 532.
with widespread cases and deaths. The prevalence of
Eligibility criteria
influenza-like illnesses during the holy pilgrimage in
Residents of Tabuk City aged 18 years or older were
Saudi Arabia ranges from 8 to 78.2%. The Ministry of
included in the study. The criteria for exclusion included
Health keeps the seasonal influenza vaccine available,
history of immediate hypersensitivity reactions to eggs
free of charge to all Saudi citizens and residents, and it
738
Received: 23/07/2022
Accepted: 25/09/2022
c:\work\Jor\vol901_105
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 743-753
Role of Neoadjuvant Chemotherapy Followed by Interval Cyto-Reductive
Surgery in Reducing Progression and Recurrence of Patients with
Advanced Endometrial Cancer
Ahmed Mahmoud Abdou1, Rehab Hemeda2, Doaa Mandour2, Ola A. Harb3,
Mohamed Ali Alabiad*3, Mohamed M. Alkilany4, Loay M Gertallah 4,
Amany Mohamed Shalaby5, Mohamed El-Bakry Lashin1 , Mohamed Moustafa Zaitoun1
1Department of Gynecology and Obstetrics, 2Department of Clinical Oncology and nuclear medicine,
3Department of Pathology, 4Department of General Surgery, Faculty of Medicine, Zagazig University, Zagazig, Egypt.
,5Department of Histology and Cell Biology, Faculty of Medicine, Tanta University, Egypt.
Corresponding author: Mohamed Ali Alabiad, Email: maabyad@medicine.zu.edu.eg,
ORCID: https://orcid.org/0000-0002-6006-3711, Tele: 00201150509554
ABSTRACT
Background: Cytoreductive surgery (CRS) roles in advanced EC are not fully defined and there are few published data
about role of neoadjuvant chemotherapy followed by cytoreductive surgery in advanced endometrioid endometrial
adenocarcinoma which is the commonest histopathological subtype of EC.
Objective: The aim of the study was to evaluate the roles of neoadjuvant chemotherapy followed by interval cyto-reductive
surgery in reducing progression improving survival and prognosis of patients who were initially diagnosed with advanced
stage EC. Patients and Methods: we collected 50 patients of advanced endometrial carcinoma stage III and divided them
into 2 groups the first group included 36 (72%) patients who underwent cytoreductive surgery after neoadjuvant
chemotherapy and remaining patients who have not undergone surgery.
Results: Patients who underwent interval cytoreductive surgery after neoadjuvant chemotherapy had longer progression-
free survival rate (12.53 vs. 5 months, p = 0.001) and longer overall survival rate (25 vs. 8 months, p = 0.002) in comparison
with patients who have not undergone surgery.
Conclusions: Using neo-adjuvant chemotherapeutic agents followed by cyto-reductive surgery in cases of advanced
endometrial carcinoma reduces rates of disease recurrences and improving patients' survival rates.
Keywords: Neo-adjuvant chemotherapy, Cyto-reductive surgery, Recurrence, Endometrial cancer.
INTRODUCTION
there are few published data about roles of neoadjuvant
Endometrial cancer (EC) is considered the
chemotherapy followed by cytoreductive surgery in
commonest gynecological cancer in developed countries,
which has a relatively good prognosis. Advanced EC has
endometrioid endometrial adenocarcinoma, which is the
a poor prognosis and a high incidence of progression with
commonest histopathological subtype of EC (11, 12).
the 5-year OS of stage III EC about 36%57% (1). About
The aim of the study was to evaluate the roles of
13% of female patients with EC were found to have stage
neoadjuvant chemotherapy followed by interval cyto-
III or IV disease (2), at initial diagnosis and have a dismal
reductive surgery in reducing progression improving
outcome (3, 4).
survival and prognosis of patients who initially diagnosed
Management of those patients includes many
with advanced stage EC.
combined lines of therapy, which includes chemo-
radiotherapy in addition to surgery (5). Cytoreductive
PATIENTS AND METHODS
surgery (CRS) roles in advanced EC are not fully defined
We collected all cases with EC who admitted to
(6). In the past adjuvant chemotherapy (CT) was found to
Gynecology and Obstetrics Department and General
reduce incidence of distant recurrence but CT could not
Surgery Departments, Faculty of Medicine, Zagazig
prevent occurrence of local or pelvic recurrence, which
University in the period from May 2015 to May 2020. All
happens in about 18% of cases presented with advanced
specimens were sent to the Pathology Department, where
EC (7).
they processed for routine H & E staining, and
It was found that using multimodality treatment,
immunohistochemistry for diagnoses of EC, classification
which include neoadjuvant chemotherapy followed by
into subtypes and grading.
cytoreductive surgery could improve prognosis, decrease
morbidity and mortality in ovarian carcinoma patients (8).
Histopathological study:
This approach was suggested to be beneficial in uterine
For initial carcinoma diagnosis most patients
papillary serous carcinomas (9) due to its histopathological
underwent endometrial biopsy or a paracentesis for
similarity to papillary serous ovarian carcinoma (10). But
cytology. All patients underwent comprehensive imaging
after initial diagnosis and all patients were confirmed to
743
Received: 23/07/2022
Accepted: 25/09/2022
c:\work\Jor\vol901_106
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 754-756
Outcome of On-Demand Tadalafil in Premature Ejaculation
Mohammad Sayed Abdel-Kader, Ahmed Mahmoud Hasan,
Mahmoud Mohsen Mohammed*, Gamal A. Alsagheer
Department of Urology, Qena Faculty of Medicine, South Valley University
*Corresponding author: Mahmoud Mohsen Mohammed,
E mail: dr.ma7moud.mo7sen@gmail.com , Tel: 01112040604
ABSTRACT
Background: One of the most prevalent sexual diseases among men is premature ejaculation (PE). Phosphodiesterase type-
5 (PDE5) inhibitors used on-demand were successful in treating PE, according to several studies.
Aims: To evaluate the safety and the efficacy of tadalafil in treatment of patients with premature ejaculation.
Patients and methods: This study was conducted on 30 patients with at least a 3-month history of PE. All patients were
submitted to clinical examination with stress on genital examination, laboratory testing for complete blood picture, and
hormonal profile. Patients were received on-demand 20 mg tadalafil 2 hours before intercourse. Intravaginal ejaculatory
latency time (IELT) was measured in all patients before and after the treatment (at 4, 8, and 12 weeks).
Results: The mean age was 33.03 ± 7.5 years, with mean body mass index (BMI) of 28.8 ± 2.9 kg/m². The baseline IELT
score was 39.4 ± 10. There was highly statistically significant (p-value < 0.001) increased 4 weeks IELT score (186.6 ±
24.4), 8 weeks IELT score (188.5 ± 21) and 12 weeks IELT score (187.2 ± 20.5) when compared with baseline IELT score
(39.4 ± 10). Conclusion: Tadalafil 20 mg on demand is thought to help PE patients with good levels of safety and
tolerability.
Keywords: Tadalafil, Premature ejaculation, IELT score.
INTRODUCTION
intercourse enjoyment. In PE patients, using dapoxetine
A male sexual disease known as premature
and PDE5i together is therefore associated with greater
ejaculation (PE) is distinguished by the inability to control
efficacy (6). The study's objectives are to evaluate the
or delay ejaculation and a short intravaginal ejaculatory
efficacy and safety of tadalafil in treating patients with
latency time (IELT), and unfavourable personal effects.
premature ejaculation.
PE causes psychological pressure on both men and their
spouses, having a significant negative impact on the
MATERIAL AND METHODS
marriage (1). The preferred medications for treating PE
This study was an observational prospective study
over the past 20 years have changed from psychotherapy
done on thirty patients having at least a 3-month history
to medications, mainly phosphodiesterase type-5 (PDE5)
of PE.
inhibitors and selective serotonin reuptake inhibitors
PE is characterised by (1) ejaculation that always or
(SSRIs) (2).
almost always happens prior to or within 1 minute of
The only pharmaceutical approved to treat PE,
vaginal penetration, either present from the first sexual
additional off-label medications, such as long-acting
experience or following a new unpleasant shift in
selective serotonin reuptake inhibitors, or dapoxetine on
ejaculatory latency, according to the International Society
demand (OD) (SSRIs), topical anaesthetics (TAs), and
for Sexual Medicine (ISSM). Patients were given a PE
phosphodiesterase type 5 inhibitors (PED5is), and
diagnosis if they fulfilled these criteria (2) Being unable
tramadol are the most popular therapeutic strategies for
to delay ejaculation throughout all or nearly all vaginal
PE management (3).
penetrations (3) Bad psychological outcomes, such as
Dapoxetine on demand therapy for PE has been
avoidance of sexual activity or feelings of worry,
approved in Europe per The European Association of
irritation, or dissatisfaction (2). All patients received on-
Urology's suggestions. Lifelong and acquired PE may
demand 20 mg tadalafil two hours before to sexual
both benefit with dapoxetine (4).
activity.
The effectiveness of PDE5i in the management of PE
has been supported by numerous researches. Central and
Setting: Outpatient Clinic of Urology Department, Qena
peripheral responses are a few of the mechanisms that
University Hospital.
have been proposed for PDE5i's involvement in PE
Inclusion criteria: All married patients verified as having
treatment (5). The vas deferens, seminal vesicle, and
at least a 3-month history of PE and aged older than 18
prostate smooth muscles, and urethra could be mostly
years.
relaxed by PDE5i. Other possible outcomes include
lengthening erections, decreasing sympathetic tone in the
Exclusion criteria: Patients with diabetes mellitus (DM),
central nervous system, and more, and raising overall
chronic prostatitis, patients with erectile dysfunction
754
Received: 23/07/2022
Accepted: 25/09/2022
c:\work\Jor\vol901_107
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 757-762
Validation of Specimen Pooling Versus Individual Samples for Screening of
Viral Markers and Syphilis in Blood Bag Strategy Single-Center Study
Rania M. Saleh1*, Ahmed Mohamed Farouk2, Maha Anani1, Fadia M. Attia1
1 Clinical Pathology Department, Faculty of Medicine, Suez Canal University Hospital, Ismailia, Egypt.
2 Clinical Pathology Department, Military medical academy
*Corresponding author: drrania82@yahoo.com OR drrania82@med.suez.edu.eg, Mobile: 01224428993
ABSTRACT
Background: Blood safety is a crucial health concern, and it is still a problem on a worldwide scale. Pool-testing approach
is to combine multiple samples and test them as one pool. A pool-testing strategy can shorten the screening time and
increase the test rate, especially during times of inadequate reporting speed and limited test availability.
Aim: This research aimed to assess the effectiveness of the pool-testing strategy in Egyptian blood banks and to develop
a pooling test to be used in the routine screening of blood donors. We suggest that the use of pooling for blood screening
is beneficial, especially in our country, which has a high rate of hepatitis infection and recent extensive government control
measures, as well as the importance of potential cost savings in Egypt.
Subjects and methods: Sera from 619 volunteer blood donors approaching Suez Canal University Hospital's Blood
Transfusion Department, were screened individually for Syphilis and viral infectious markers HBV, HCV, and HIV by
ELISA, then pooled into pools of five and retested.
Results: The results showed sensitivity, specificity, and accuracy of syphilis and HBV tests were 100% on pooled samples
while HCV test showed sensitivity 71%, specificity 100%, and accuracy 99.68%.
Conclusion: Our present study demonstrated the importance of a pooling protocol and that a pooling scheme of five
samples is helpful for mass screening for syphilis and viral markers in subjects from large populations as blood donors
without loss of accuracy.
Keywords: Syphilis- HBV- HBV- HIV- Pooling- Screening- Transfusion.
INTRODUCTION
blood donations screening for any newly (re)-emerging
For decades, it has been known that transfusion
viruses. In addition to the increased running expenses for
of blood products and plasma derivatives can transmit
instruments and reagents, as well as the requirement for
viral infections, even though it has to be an inevitable
cold-chain transport and reagents storage (5). So,
result of a life-saving procedure. A viral infection can
decreased cost-effectiveness encouraged the advent of
potentially be transmitted by transfusion when it has a
a number of cost-cutting strategies.
The
enormous
long or brief asymptomatic blood-borne stage, as well as
funding to gain trust in the blood supply safety has led to
having the ability to remain in collected blood products
a distinct issue: the discrepancy that the health care yield
and causing infection intravenously (1). The potential of
is usually extremely poor, and the resources could be
viral transfusion-transmitted infections (TTI) has
more effectively used elsewhere (6).
consistently decreased during the previous forty years
Blood safety at all costs comes with risks that
with the development of laboratory investigations for
might affect sustainability and ability to face new
hepatitis B virus (HBV) surface antigen (HBsAg) in the
problems (7). The technique of sample pooling was
1970s (2). Alanine aminotransferase (ALT) and HBV core
demonstrated to be practical for extensive sero-
(anti-HBc) antibodies testing started in the 1980s to
epidemiological research for years ago (8). This technique
decrease the spread of non-A non-B viral hepatitis. Then,
utilizes enzyme-linked immunosorbent assays (ELISAs)
the emergence of the human immunodeficiency virus
to screen samples from multiple demographic groups,
(HIV) and the subsequent rapid identification of hepatitis
which minimizes resources in terms of time, work, and
C virus (HCV) resulted in extraordinary attempts to stop
supplies (9).
the spread of these new blood-borne viruses and the
Transfusion safety continues to be the main
introduction of antibody tests for both of these agents (3).
driver for the invention of technically advanced
To rule out those who are susceptible to transmit
technologies that can be applied for blood screening for
viral infection, a donor screening procedure has been
facing the ongoing (re)emergence of novel viruses and
established and implemented. This procedure involves the
variations of existing viruses (10). Our research was
donor's medical history and a short physical examination.
planned to assess the detection of Syphilis and viral
The following critical step in lowering viral TTI was
infectious markers HBV, HCV, and HIV by using ELISA
accomplished with the establishment of serologic testing
in plasma pools in blood donors rather than in individual
(4). Blood banks are under increasing economic pressure
samples to lower the time of screening and cost burden on
regarding the addition of any costly molecular testings for
blood banks in Egypt as a developing country.
757
Received: 23/07/2022
Accepted: 25/09/2022
c:\work\Jor\vol901_108
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 763-767
Polyglycolic Acid Sheets and Fibrin Glue Versus Nasolabial Flap for
Reconstruction of Oral Mucosal Defects
Tarek Elsayed Ftohy Abdelrahman*1, Kamal A. A. Hassanein1, Islam A. Elzahaby2,
Ahmed Gaber Hassanein1, Islam A. Amer1, Ahmed Gaber Mahmoud1
1Department of Surgery, Faculty of Medicine, Sohag University, Egypt
2Department of Surgery Oncology, Faculty of Medicine, Mansoura University, Egypt
*Corresponding author: Tarek Elsayed Ftohy Abdelrahman, Mobile: (+20) 01062062481, E-Mail: tarekftohy2@gmail.com
ABSTRACT
Background: Early-stage oral cancers are usually treated with surgical resection and in most of cases the resulting
defects are too large to be primarily reconstructed. There are many modalities of reconstruction as nasolabial flap, buccal
bad of fat, polyglycolic acid sheets. Objective: This work aimed to evaluate the reconstruction of oral mucosal defects
using either polyglycolic acid (PGA) sheet or nasolabial flap.
Material and Methods: 51 patients of them 26 were reconstructed using (PGA) sheet, and 25 using nasolabial flap
retrospectively. The tumors' location, perioperative situation, postoperative aesthetic and functional results were
assessed. Results: There was no significant difference between the 2 groups regarding the early start of oral feeding or
hospitalization time. While, the PGA group had significant shorter operative time. In cases with exposed bone surface,
the PGA sheet was more feasible for reconstruction. There was no significant difference between the 2 groups in speech
intelligibility in lingual cases. In buccal reconstruction the PGA sheets were more suitable for larger defects.
Conclusion: The optimal choice of nasolabial flap or PGA sheet depends on tumor location, mucosal defect size, the
general condition of the patient and tolerability for surgery.
Keywords: Oral mucosal defect, Polyglycolic acid sheet, Nasolabial flap.
INTRODUCTION
polyglycolic acid (Neoveil) sheets and fibrin glue for
Early-stage oral cancers are usually managed with
the restoration of oral mucosal lesions.
surgical excision and in most of cases the resulting
mucosal defects are too large to be primarily
PATIENTS AND METHODS
reconstructed. Extensive mucosal defects are usually
A retrospective study included patients who had
managed with free vascularized grafts. While, in
surgery for oral cancer resulting in mucosal defects and
intermediate ones, there are many modalities for
were reconstructed by PGA sheets or nasolabial flap at
reconstruction such as nasolabial flaps or submental
Maxillofacial Surgery Unit, General Surgery
flaps and recently polyglycolic acid (PGA) sheets and
Department, Faculty of Medicine, Sohag University,
fibrin glue were used (1).
Egypt. The study was conducted between April 2014
The nasolabial flaps are perfect for reconstructing
and June 2020.
the mouth. It is straightforward and appropriate for the
Ethical consent: The Academic and Ethical Committee
closure of oral deformities in the tongue, cheek, and
of Sohag University granted its clearance for the study.
mouth floor (2, 3). The inferiorly based flap is used to
Each patient signed a written informed consent form to
reconstruct the lip, oral commissure, and anterior region
agree to participate in the study. The Declaration of
of the mouth floor. It can be superiorly or inferiorly
Helsinki, the World Medical Association's code of
based (3, 4). The flap's thickness is determined by the
ethics for studies involving humans, guided the conduct
thickness of the donor tissues and the requirement for
of this study.
the defect. A nasolabial flap is a straightforward
operation with little risk of complications and donor
Inclusion criteria: All patients with oral mucosal
defect (2-4).
defects beyond primary repair and not too large defects,
A polyglycolic acid nonwoven membrane makes
which is usually reconstructed with free vascularized
up PGA sheets (a homopolymer with a molecular
flaps.
weight of 100,000 Dalton). Through a unique
Exclusion criteria: Cases presented with recurrent
procedure, the cloth acquires its elastic and soft
lesions associated with marked fibrosis and severe
qualities. Fibrin glue is utilized to adhere the PGA sheet
limited mouth opening.
(Neoveil, Gunze Co., Ltd., Tokyo, Japan). Recently,
Polyglycolic acid sheet and fibrin glue technique
oral mucosal lesions have been repaired using PGA
According to Takeuchi et al. (1), following effective
sheets (4).
hemostasis, the mucosal defect was treated with a small
To our knowledge, there are no papers that
quantity of fibrin glue spray (fibrinogen). The defect
compared PGA sheets with nasolabial flaps for the
was then covered with a PGA sheet that had been cut
repair of oral mucosal lesions in a sufficient number of
into pieces the same size as the remaining region, and
instances. Therefore, we undertook this study to
the sheet and surrounding area were sprayed with a
evaluate the effectiveness of nasolabial flaps vs
solution of fibrin glue and thrombin using a specialized
763
Received: 24/07/2022
Accepted: 26/09/2022
c:\work\Jor\vol901_109
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 768-774
Management of Complicated Acute Appendicitis in Adults:
Laparoscopic versus Open Appendectomy
Yasser Baz1, Yasser A. Orban*2, Ibrahim A. Heggy2
1Department of Surgery, Faculty of Medicine Helwan University, Egypt
2Department of Surgery, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Yasser A. Orban, Mobile: (+20)01002428734, Email: yasser_ali_orban@yahoo.com
ABSTRACT
Background: Nowadays laparoscopic appendectomy (LA) is the management of choice for acute appendicitis (AA) in
simple, uncomplicated cases. For complicated acute appendicitis (CAA), laparoscopic or conventional open
appendectomy (OA) is still in debate.
Objective: This study aimed to compare minimally invasive LA and traditional OA in CAA cases.
Methods: In this study, 44 patients with CAA (22 for LA and 22 for OA) with 18 years of age or older were enrolled.
It was conducted in General Surgery Department, Helwan University Hospital.
Results: The operative time difference between the LA and OA groups was statistically significant (18.5 minutes shorter
in the OA group, (p<0.001). The median length of hospital stay, return to normal activity, and patient satisfaction were
significantly better in the LA group (p-values of 0.001, 0.00, and 0.14 respectively). The need for analgesics in the LA
group was significantly lower than in the OA group. There were no detectable statistically significant findings
concerning the occurrence of surgical findings, postoperative vomiting, postoperative ileus, wound infection, wound
dehiscence, or postoperative intra-abdominal collection.
Conclusions: Laparoscopic appendectomy management of CAA is feasible, safe, and has numerous advantages over
the traditional open procedure in terms of reducing postoperative pain, requiring fewer analgesics, shortening the
postoperative hospital stay, having a low incidence of postoperative infectious complications, and allowing a rapid
return to daily activities with improved comfort and satisfaction.
Keywords: Laparoscopic appendectomy, Complicated appendicitis, Open appendectomy.
INTRODUCTION
randomized-controlled study comparing laparoscopic
Acute appendicitis (AA) is among the most
and open appendectomy in adults (18 and older). Using
prevalent abdominal surgery emergencies worldwide (1).
the closed-envelope randomization approach, the
It is most often seen in patients between 10 and 30 years
patients were divided randomly into 2 groups, with 22
old (2). If neglected, AA ultimately complicates (20
participants in the LA group and 22 in the OA group. It
30%), leading to gangrene, perforation, local peritonitis,
took place at General Surgery Department, Helwan
or diffuse peritonitis, among other potentially serious
University Hospitals.
problems (3-7). The diagnosis of complicated acute
Criteria for inclusion: The study included adult
appendicitis (CAA) is primarily built on a combination
patients with CAA, defined as perforated AA,
of clinical suspicion of AA progression of severity,
gangrenous AA, and a walled-off abscess of localised
inflammatory laboratory blood markers, and pelvi-
peritonitis or diffuse peritonitis, by either preoperative
abdominal imaging such as ultrasonography (US) and
or intraoperative diagnosis. Preoperative diagnosis was
computed tomography (CT) (6-9).
built on history, thorough clinical examination,
The optimal treatment of CAA remains
participants' laboratory findings, and abdominal US,
indeterminate (10). CAA is associated with more risk of
whereas an abdominal CT scan was saved only for
postoperative morbidity and mortality and has been
selected cases. However, the intraoperative gross
delineated as a relative contraindication for LA.
appearance was the basis for the intraoperative
Nevertheless, this conception has been faced by some
diagnosis.
authors. There is a lack of good evidence-based support
for the LA approach for CAA (11-13). On review of the
Criteria for exclusion: Non-CAA patients, patients
literature, most research studies were retrospective and
with CAA aged less than 18 years, pregnant females and
involved heterogeneous groups of cases (7). We assumed
patients with prior abdominal surgeries. Patients who
that laparoscopy is superior to traditional OA in the
are unfit or unwilling to participate in the study, or who
management of CAA, and our purpose of this
had their LA converted to open.
investigation was to compare the outcomes of LA
Preoperative evaluation: All participants were
versus OA in cases with CAA in terms of the operative
exposed to complete history taking, general and local
time, perioperative morbidity, hospital stay, time to
clinical examinations, required laboratory tests, and
return to daily activities, and patients' satisfaction.
imaging investigations, including abdominal US and
PATIENTS AND METHODS
CT. Preoperatively, all participants received 1 gram of
Between January 2021 and March 2022, 44
third-generation cephalosporin and 0.5 gram of
participants were involved in this prospective,
Metronidazole intravenously.
768
Received: 01/09/2022
Accepted: 02/11/2022
c:\work\Jor\vol901_110
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 775-779
The Effect of Surgical Wound Infection on Postoperative Hospital Stay
Ahmed Mohamed Saeed1, Ahmed Osama Abdelmotaal Abdelmeguid1, Wael abd Elatief Khafagy2*
1 Obstetrics and Gynaecology Department, Faculty of Medicine, Al-Azhar University, Egypt
2 Obstetrics and Gynaecology, International Islamic institute, ART Unite
Corresponding Author: Wael abd Elatief khafagy,
Mobile phone: 01005828758, Email: Waelkhafagy2019@gmail.com
ABSTRACT
Background: Patients who experience any postoperative complication have longer hospital stays. Infection at the
surgical site is the major cause of postoperative problems and lengthening of hospital stays. However, numerous
variables contribute to the development of surgical site infections.
Objective: The present study is aimed to investigate the effect of surgical wound infection on postoperative hospital
stay. Patients and methods: This study was conducted in Al Hussein and Al Mokatam General Hospital from February
to August 2022 on 20 cases. Complete history and demographic data were obtained along with complete physical
examination from all participants. All data regarding characters of the surgical wound and time of discharge was
recorded. Results: Mean age in the included patients was 42.22 (SD 10.94) years. Mean weight was 87.72 (SD 13.5)
kg. Mean height was 166.56 (SD 5.88) cm. Postoperative Hb reached 11.36 (SD 0.54) g/dl. Among 20 patients included
in the study lower segment cesarean section (LSCS) was reported in 4 (20%) of cases, myomectomy was in 3 (15%)
and total abdominal hysterectomy (TAH) was in 13 (65%) cases. Mean time to discharge in gapped wound was 2.5 (SD
2.1) days. Time to discharge was significantly increased in cases with gapped wound. There was significant negative
correlation between hospital stay and good wound.
Conclusion: Depending on the surgical category, the length of hospital stays and wound characteristics related to
surgical site infection (SSI) vary greatly by identifying the surgical techniques that have a SSI unfavourable effect that
is more severe. A strong inverse relationship exists between hospitalisation and healing wounds.
Keywords: Surgical site infection; Length of hospital stay, Time to discharge, Case series, Al-Azhar University.
INTRODUCTION
the release of new medications (4). The prevention of
Patients who encounter any postoperative
SSIs has received more attention since the U.S. Centres
difficulties often stay in the hospital for 3 to 11 more
for Disease Control and Prevention (CDC) released the
days than those who do not. According to a recent study,
Guidelines for Prevention of Surgical Site Infection in
regardless of preoperative patient risk, complications
1999.There have been several reports released about
that lasted 30 days or more decreased median patient
how to prevent SSIs and how common they are (5).
survival by 69% (1).
The present study is aimed to investigate the effect of
The third most common type of infection
surgical wound infection on postoperative hospital stay.
connected with healthcare is surgical site infection
(SSI), which makes about 14%16% of all such
PATIENTS AND METHODS
illnesses. According to reports, patients who experience
This was a study conducted in Al Hussein and Al
SSIs have a 2- to 11-fold increased chance of dying,
Mokatam General Hospital from February to August
making them one of the clinically significant post-
2022. The study was conducted on 20 cases. All were
operative consequences. An average of 2 to 5 percent of
followed at the Obstetrics and Gynecology Units.
surgery patients is predicted to experience SSI (2).
The study population consisted of female patients >20
According to estimates, SSI was directly
years. Patients underwent one of the following 3
responsible for 0.64% of hospital mortality in the USA.
categories of surgery: Lower segment cesarean section
According to a recent study from Europe, the infection
(LSCS), Myomectomy, and Total Abdominal
was to blame for 38% of patient deaths with SSI,
Hysterectomy (TAH) were enrolled in the study.
translating to an attributable mortality of 0.9%.
Emergency cases in all categories were excluded.
Furthermore, patients with SSI spend longer in the
hospital, which increases the overall cost of
The following data were collected from all
hospitalisation. The severity of these negative effects
participants:
varies depending on the type of surgery, the country of
Complete history taking: Personal history, any
investigation, and the methods employed (3).
complaint, Obstetric history, menstrual history, past
Case
contamination,
obesity,
stoma
medical and past surgical history, and family history.
development, medical co-morbidities, and preoperative
Complete physical examination including General
antibiotic selection are only a few of the many factors
examination: Vital signs (Blood pressure, Temperature,
that affect SSIs. Despite being a well-established
Heart rate, Respiratory rate).
practise,
prophylactic
intravenous
antibiotic
Every patient receiving surgery in any of the selected
administration during elective colorectal surgeries has
surgical categories, information on their demographics,
recently changed due to changes in drug availability and
discharge, and potential risk factors were recorded.
775
Received:23/07/2022
Accepted:25/09/2022
c:\work\Jor\vol901_111
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 780-786
The Role of Some Organic Acids in The Eradication of Antibiotics
Resistance of E. Coli Isolated from Urinary Tract Infections
Noor Saad latteef1, Warqaa Y. Salih 2, Ali Abdulmueen Al-lawi3
1,2,3 Biotechnology Department Genetic Engineering and Biotechnology Institute for postgraduate,
University of Baghdad, Baghdad, Iraq
Corresponding author: Noor Saad Latteef, Mobile: 0096 47711170239, Email: noorsaad@ige.uobaghdad.edu.iq
ABSTRACT
Background: The organic acids like succinic acid and malic acid have an antibacterial impact on E.coli infection.
Objective: The aim of the present study is the detection of E.coli in urine samples using PCR and antibiotic susceptibility
testing of strains obtained from people and food using ampicillin and erythromycin, in addition to testing malic and
succinic acids against uropathogenic E.coli.
Material and methods: This study describes a biochemical and polymerase chain reaction E.coli test. PCR can
accurately verify E.coli colonies on culture plates. The Minimum Inhibitory Concentration (MIC) method assessed
organic acids and antibiotics for bactericidal action.
Results: The study showed that malic acid has a higher ratio of inhibition that increase from 0.06 to hit 0.14 in
concentration 0.3 mg/ml, while Ampicillin's ratio of inhibition fluctuates the same level until rise gradually to reach 0.04
in concentration 0.09 mg/ml. Succinic acid's ratio increased to 0.35 in concentration 0.4 mg/ml, while in 0.5 mg/ml hit 0.4
and dropped to 0.1 in the concentration of 0.6 mg/ml, in contrast to Erythromycin that have a higher ratio of inhibition
increased gradually to reach 1.5 in concentration 0.7 mg/ml.
Conclusion: Urinary tract infections caused by E.coli may be challenging to treat empirically in Ile-Ife due to antibiotic
resistance. In order to reduce the selection pressure that could lead to the spread of E. coli in the environment and to
increase the likelihood of a successful treatment, culture and susceptibility tests must be performed prior to administering
any antibiotics.
Keywords: Urinary tract infection, Escherichia coli, Succinic acid, Malic acid, Antibiotic resistance, University of Baghdad.
INTRODUCTION
One of the most prevalent bacterial diseases in
Before beginning treatment, it is important to do
humans is urinary tract infection (UTI), which is most
susceptibility and culture tests on the bacterium that is
usually brought on by E.coli (1); The main source of
causing the infection in order to determine whether or
nosocomial and community-acquired diseases (2).
not it is susceptible to the antimicrobial agents that will
be used (10).
When exposed to antimicrobials, commensal E.coli
in the gastrointestinal system is particularly capable of
For severe UTIs such pyelonephritis, amoxicillin-
passing on its genes for resistance to antibiotics to a
clavulanic acid is the treatment of choice. Amoxicillin-
variety of other microorganisms, including pathogenic
clavulanic acid resistance rates among UPEC vary
bacteria (3). This is supported by the findings of a great
greatly between regions. In the European countries, the
deal of study that has been carried out over the years (4,5).
levels of resistance to this antimicrobial range from
Colonization and/or infection of humans is possible
5.3% (Germany) to 37.6% (France) (11).
through unintentional or occupational contact, as well as
through the intake of food that has been tainted with
Seven distinct antibiotics were evaluated, and each
pathogens. There is a widespread dissemination of
one was shown to be effective against a different isolate.
antibiotic-resistant microorganisms throughout the food
Each of the isolates that was examined had some level of
chain, most notably in animal products (6).
resistance to the various antibiotics that were utilized in
the examination process. The majority of bacteria tested
There has been an increase in the number of E.coli
positive for resistance to ampicillin, but just a small
isolates that are resistant to treatment, and a number of
percentage of bacteria tested positive for resistance to
studies have discovered epidemiological linkages
gentamicin (12).
between these strains and humans as well as food (7,8,9).
Researchers discovered that the organic acids in
Urinary tract infections that are brought on by E.coli
cranberry juice can prevent E.coli from colonizing the
in Ile-Ife may be difficult to treat empirically with only
bladder in a mouse model of a urinary tract infection
nitrofurantoin as a treatment due to the extensive
(UTI). The study was conducted on mice (13).PCR
resistance to regularly used antibiotics in the region.
780
Received: XX/XX/2022
Accepted: XX/XX/2022
c:\work\Jor\vol901_112
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 787-790
Impact of Covid-19 Disease on Tuberculosis in Kuwait:
Study from TB Referral Center
Mohammed Abdalla Rakha*1, 2, Asmaa Ali3, Mohmod Omer1, Ahmed Alsyed1, Eman Al- Anbay1
1Department of Pulmonary Rehabilitation Center- Chest Hospital- Kuwait City, Kuwait
2Department of Chest Diseases, Al-Azhar University, Cairo, Egypt
3Department of Pulmonary Medicine, Abbassia Chest Hospital, MOH, Cairo, Egypt
*Corresponding author: Mohammed Abdalla Rakha, Mobile: 0096598847662, E-Mail: drrakha41@gmail.com
ABSTRACT
Background: Tuberculosis is an endemic disease in various regions of the world like South East Asia. The State of
Kuwait compromises a diverse population of non-Kuwaiti expatriates mostly from India, Bangladesh, and Egypt. The
Pulmonary Rehabilitation Centre (PRC) in Kuwait is a referral center for all diagnosed cases that have tuberculosis
either active or latent.
Objective: To study the impact of covid 19 disease on tuberculosis during its pandemic within the period from March
2020 to March 2021 and to compare it with the previous 1 year from January 2019 to February 2020.
Patients and Methods: Data were collected from our system for comparison of the rate of diagnosis and treatment each
month over two years from January 2019 to the end of 2020, which was done during the period of lockdown (total
curfew).
Results: Before COVID-19 disease, the annual number of active TB was 534, which decreased during the pandemic
without reaching the critical difference; mean±SD= 423.3±103.4, P> 0.05. On the other hand, the annual number of
latent TB cases was 438 before the pandemic, which showed a significant increase with a mean of ±SD= 624.5±154.5,
P=0.007. Additionally, Latent TB cases in the COVID-19 era showed significantly higher reports than active TB, P <
0.05. Moreover, we found a considerable double number of multi-drug resistance pulmonary tuberculosis and one case
suspected extensive drug resistance.
Conclusion: Covid 19 pandemic had a significant impact on tuberculosis care as regards diagnosis and treatment as
well as follow-up.
Keywords: Tuberculosis active, Latent covid 19 pandemics, Drug resistance tuberculosis.
INTRODUCTION
PATIENTS AND METHODS
Coronavirus disease (COVID-19) is a highly
Patients and study type
infectious disease caused by novel coronavirus named
A retrospective cohort study was done for all
as SARS Cov-2. It originated in the big city of Wuhan,
tuberculous cases, referred to Pulmonary Rehabilitation
the capital of the Hubei province of China in December
Center and it compared the pre-lockdown during the
2019 and has been announced pandemic by the World
period from March 2019 to March 2020 with the
Health Organization. It has a serious impact on people
lockdown and post-lockdown periods through the
with pre-existing health conditions and has many side
period from March 2020 to March 2021.
effects in the management of other diseases [1, 2].
Data collection:
Tuberculosis (TB) is the world's greater killer
The study used patient records and digital
among infectious diseases, claiming more than 4000
laboratory results in addition to radiological reports
lives each day. India has the biggest number of both
among pulmonary and extrapulmonary as well as latent
drug-sensitive and drug-resistant TB [3]. Kuwait is one
tuberculosis.
of the biggest countries for the recipient of Asian
In pulmonary tuberculosis, the data collected
workers mainly from India.
included AFB smear status, Xpert DNA load, culture
Patients who are on treatment from tertiary care
status, time to culture positivity, hospital admission rate,
hospitals are severely affected due to the lockdown
outpatient follow-up rate, sputum time, AFB conversion
implemented to control coronavirus infection. Almost
to negative, rate of defaulters, as well as the rate of
every country has established national TB programs,
resistant cases.
whereas national programs for COVID-19 are urgently
In extrapulmonary tuberculosis, the data included
required [4, 5].
AFB status, Xpert DNA load, culture status, outpatient
follow-up rate, rate of defaulters, and rate of resistant
However, in March 2020 a rapid analysis
cases.
conducted by the Stop TB Partnership brought attention
In latent tuberculosis, the data included the
to s major impacts of COVID-related lockdowns on TB
proportion of screened contacts identified with latent
care in different countries [6].
tuberculosis infection (LTBI), the outpatient follow-up
rate, and the rate of defaulters.
787
Received: 14/7/2022
Accepted: 17/9/2022
c:\work\Jor\vol901_113
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 791-795
Chest CT Scan Findings in A Sample of Patients with COVID19 Infection
Karim Mahmood Hussein1*, Ali Khalaf Salim2, Sawsan Sahib Hamzah3
1 Department of Anatomy, College of Medicine, University of Kirkuk, Iraq.
2 Kirkuk Oncology and Hematology Center, Kirkuk health directorate, Kirkuk, Iraq
3College of Dentistry, Al-Farahidi University, Baghdad, Iraq.
*Corresponding author: Karim Mahmood, Mobile: +964 770 124 0295, E-mail: karimazaw@uokirkuk.edu.iq
ABSTRACT
Background: Coronavirus disease 2019 (COVID-19) or severe acute respiratory syndrome coronavirus 2 (SARSCoV-2)
on January 7, 2020, was established as a source of the discovered cases, previous name was "2019-NOVAL" corona-virus
"2019 nCoV", then the epidemic was termed COVID-19; Fever, fatigue, dry cough, and dyspnea, as well as a variety of
chest imaging features are what COVID-19 is characterized by.
Objective: This study focuses on critical imaging chest CT scan characteristics in COVID-19 patients with positive PCR
to aid in accurate diagnosis and therapy.
Patients and methods: This study concentrated on the most recognizable CT-scan features in established cases of (COVID-
19) to distinguish the various CT-scan appearance that aid in effective diagnosis as well as proper management.
Results: Ground-glass patchy opacities (33.3%) then ground-glass opacities with consolidations (24.4%), then ground-glass
opacities with subpleural linear fibrotic bands abnormality (14.4), crazy-paving pattern (13.3%), single air bronchogram
(10.0%), and consolidation patches only (4.4%) were the most prominent chest CT scan findings in COVID-19 patients. In
the examined patients, no cavitary-like lesions or sizable lymphadenopathy were detected. The lesions in the lung displayed
distinctive bilateral predominantly right side, mostly all lobes affected, especially basal, and peripheral subpleural in
distribution.
Conclusion: The CT-scan imaging features seen in (COVID19) cases may aid a rapid and precise diagnosis of COVID19
then detailed evaluation of pulmonary parenchymal affection and disease severity.
Keywords: Coronavirus infections, COVID-19, Computed tomography, ground glass opacity, Case series, University of
Kirkuk.
INTRODUCTION
scan of the chest; In the context of diagnostic CT-scan
The first four reported cases were detected by
results, the polymerase chain reaction (PCR) as a
localized
hospitals
by
utilizing
surveillance
screening test may be false negative initially (8).
measurements for pneumonia of unknown origin which
It was applied in some local studies for diagnosis of
was established during the 2003 SARS pandemic )1(.
COVID among infected pregnant women (9).
On (31 December 2019) WHO reported several
However, with the COVID19 outbreak and the fast
instances of unknown cause type of pneumonia in
growing world-wide pandemic that has resulted in
Wuhan-China (2) on (7-January-2020), corona-virus
catastrophic mortality, accurate patient diagnosis and care
disease 2019 (COVID19) or severe acute respiratory
requires a detailed understanding and description of
syndrome coronavirus 2 (SARSCoV-2) verified the
diagnostic imaging characteristics, differential criteria,
etiology of such discovered cases (at previous time
and chest imaging findings (10). This study focuses on
identified as 2019 new corona-virus 2019-n CoV), and the
critical imaging chest CT scan characteristics in COVID-
epidemic was dubbed COVID19 (3). The World Health
19 patients with positive PCR to aid in accurate diagnosis
Organization declared a global health emergency on
and therapy.
January 30, 2020. On 20/Feb/2020, 75,761 cases and
about 2130 fatalities were reported in more than 30
PATIENTS AND METHODS
countries (4).
This was a retrospective research in which 90 cases
Because the COVID-19 largely affects the respiratory
that test result positive for newly discovered corona-virus
system, chest imaging is strongly recommended for both
by naso-pharyngeal exchange received a CT-scan of the
initial screening and follow-up in suspected patients (5),
chest in July 2020. The patients' ages ranged from 20 to
while chest radiographs are ineffective in the early stages
80 years old. There were 55 men and 35 females, for a
of illness, CT lung alterations may be detected even
male to female ratio of 1.6:1.
before clinical symptoms arise. Chest radiographs with
All pictures were taken while the patients were in the
symptoms of acute respiratory distress syndrome (ARDS)
supine position, using CT-Scan Chest procedures. Scans
may be beneficial in the mild to severe types of COVID-
were performed from the proximal thoracic intake to the
19 (6,7), the chest imaging findings are the consequence of
lower costophrenic angle level, with the following scan
COVID-19 overlapping with other viral pneumonias CT-
settings utilized voltage of the CT tube (120 kVp), (250
791
Received: 24/07/2022
Accepted: 26/09/2022
c:\work\Jor\vol901_114
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 796-802
Assessment of The Effect of Lyophilized Platelet-Rich Plasma on
Superficial Wrinkles
May H. El-Samahy, Tabarak R. M. Alwaheely, Mona A. Ibrahim*
Department of Dermatology, Venereology, and Andrology, Faculty of Medicine, Ain Shams University, Egypt
*Corresponding author: Mona Abdel-Halim Ibrahim, Mobile: (+20) 01006228698,
E-mail: monaabdelhalim@med.asu.edu.eg
ABSTRACT
Background: Lyophilized platelet-rich plasma (L-RPR) is considered a simple and effective comparable method
to fresh preparations of platelet-rich plasma (PRP). It is prepared using platelets concentration derived from
different donors. It is ubiquitously available and enables medical professionals to inject a specific volume of
growth factors. Objective: The aim of the current study is to assess the effect of L-PRP in treating superficial
wrinkles.
Patients and methods: The present one-arm clinical trial was performed on 20 adult females (age range between
30 and 50 years old) with Type I and II superficial wrinkles (Glogau classification). The entire face was injected
with a 2 cm reconstituted vial of sterilized L-PRP (L-GF®) for 3 treatment sessions at 2-week intervals. The
evaluation was done before each treatment session and 2 weeks after the last session with 8 megapixels and Antera
3D® cameras. The wrinkles indentation index, the texture (roughness) score, the average melanin level, and the
melanin variation were calculated.
Results: The mean duration of wrinkles was 5.8 (SD 2.9) with a range of 2-12 years. Most cases (95%) had skin
type III and Glogau classification type II (75%). A statistically significant difference was found before and after
treatment in the average melanin level using Antera 3D® camera assessment. However, no significant difference
was found before and after treatment regarding the roughness score, melanin variation level, and wrinkle
indentation index. Treatment was well tolerated with minimal local side effects.
Conclusion: L-PRP is a safe, simple, and cost-effective treatment modality for aging-related hyperpigmentation.
Keywords: L-PRP, wrinkles, PRP, Pigmentation, Aging, One-arm.
INTRODUCTION
PRP as it has a much longer shelf life (12 months in
Skin aging is a physiological process that poses
L-PRP vs 8 hours in fresh preparations). In order to
significant distress to many people, especially
achieve standardization, apheresis and platelet
females. Skin aging occurs by combined
processing were obtained from different volunteers,
mechanisms; intrinsic as hereditary or hormonal
thereby eliminating variations in the concentrations
factors and extrinsic as ultraviolet rays (UVR) and
of platelets and growth factors between individual
smoking. The combination of these factors leads to
donors (4).
the appearance of signs of aged skin clinically in the
On the other hand, leukocyte depletion, gamma
form of atrophy, laxity, sagging, dryness,
irradiation, or lyophilization have no deleterious
dyspigmentation, telangiectasia, and wrinkles (1). The
effects on growth factor concentrations (5,6).
increased desire to look younger led to the
L-PRP powder contained a variety of growth
development of novel dermatological techniques for
factors, such as transforming growth factor ß1 (TGF-
treating skin aging. Recently, a greater emphasis has
ß1), platelet-derived growth factor-AB (PDGF-AB),
been placed on minimally invasive treatments and
vascular endothelial growth factor (VEGF), basic
approaches for treating skin elasticity, wrinkles,
fibroblast growth factor (bFGF), insulin-like growth
dyspigmentation, roughness, and skin photodamage
factor 1 (IGF-1), epidermal growth factor (EGF),
(2).
interleukin (IL)-1a, IL-1b, and IL-1 receptor agonist
Platelet-rich plasma (PRP) has gained interest as
(IL-1RA) (7). These various growth factors can have a
a minimally invasive technique in treating the signs
beneficial effect in reducing skin aging. Scarce data
of skin aging. PRP stimulates the body's natural
is available on the role of L-PRP in skin
healing process and tissue regeneration by releasing
rejuvenation. The aim of the current study is to assess
platelet-derived compounds at the treatment site in a
the effect of L-PRP in treating superficial wrinkles.
hyperphysiologic manner. It may result in the
reduction of a number of age-related skin aging
PATIENTS AND METHODS
symptoms (3).
The study groups:
Lyophilized PRP (L-PRP) is a novel and refined
The present one-arm clinical trial included 20
form of PRP. It shares the same first preparation
adult females (30-50 years old) with superficial
steps, benefits, and uses of PRP. However, L-PRP
wrinkles (Type I and II by Glogau classification) (8).
uses allogenic, pathogen-free platelets as a source of
Exclusion criteria include patients who had
growth factors as opposed to autologous platelets. It
received facial dermabrasion procedures, topical or
offers many advantages over fresh preparations of
systemic retinoid use, facial botulinum toxin
796
Received: 25/07/2022
Accepted: 27/09/2022
c:\work\Jor\vol901_115
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 803-805
Musculoskeletal Diagnoses for Patients with Non-cardiac Long-Standing Chest Pain
Sheerwan Bahaa Assim1, Zainab A. Mahmood 2, Ammar Salih Abbood3, Haider Kadhem Saeed4*
1Cardiologist. Department of Medicine, 2Rheumatologist. Department of Medicine,
3Cardiologist. Department of Medicine, College of Medicine, University of Basrah, Basrah, IRQ
4Otolaryngologist, Department of Surgery, Alzahra College of Medicine,
University of Basrah, Alsadar Teaching Hospital, Basrah Health Directorate, Basrah, IRQ
*Corresponding author: Dr. Haider Kadhem Saeed, Mobile: (+96) 47705757688, Email: haider.kadhem@uobasrah.edu.iq
ABSTRACT
Background: Three quarters of patients with non-diagnosed chest pain after a normal cardiac evaluation continue to
complain from residual pain. By careful history taking and physical examination, number of those patient diagnosed to have
musculoskeletal pain. The proper management will help to reduce the socio-economic consequences due to fear and anxiety
of undiagnosed coronary artery diseases.
Aim: To highlight one of the other differential diagnoses of ischemic chest pain.
Patients and Method: Fifty patients with chest pain were involved. All these patient had chronic chest pain and normal all
cardiac evaluations. These patients were examined by rheumatologist to reach the final diagnosis.
Results: The mean age was 46.6±14 standard deviation. About 40% of the patients were complained from left side chest
pain. The final diagnosis was either muscular pain, shoulder problem, cervical radicular pain, costochondritis, or
fibromyalgia.
Conclusion: Musculoskeletal chest pain is not uncommon and an important differential diagnosis of chest pain for patients
presented to cardiac clinic. After exclusion of cardiac causes, a high index of suspension and an appropriate approach is
recommended to diagnose and treat these conditions to improve patients' quality of life.
Keyword: chest pain, ischemic heart disease, musculoskeletal pain, shoulder diseases.
INTRODUCTION
Patients who present to the office with chest pain
The likelihood of chronic coronary syndrome
are a diagnostic challenge due to many possible
decreases by a normal ECG exercise test or normal
etiologies, including life-threatening conditions (1).
calcium score by CT, keeping in mind false negative ECG
The key for a definitive diagnosis is a precise and
exercise test especially in the absence of a diagnosis that
a detailed clinical history. The diagnosis can be achieved
explains patients' symptoms (6).
by history alone in substantial number of patients. A
If clinical assessment alone cannot exclude
careful physical examination and special tests should be
coronary artery diseases, the diagnosis can be established
done to confirm the diagnosis and to exclude other
by non-invasive tests. The current Guidelines recommend
diagnoses. Almost 70 - 75% of patients with non-
the use of functional imaging or anatomical imaging by
diagnosed chest pain next to normal cardiac assessment
CT coronary angiography as an initial test for coronary
remain suffering from residual discomfort with
artery diseases diagnosis (7).
significant individual and socioeconomic concerns due to
An anatomic assessment by CTCA or invasive
fear and anxiety of undiagnosed coronary heart diseases,
coronary angiography should be considered in cases of
loss of working capability, and repeated hospitals'
non-diagnostic findings or a strong suspicion conflicting
admissions (2).
with stress tests findings.
Differential diagnoses of chest pain include
cardiac, pulmonary, musculoskeletal, gastrointestinal or
AIM OF THE STUDY
psychological disorders. Musculoskeletal causes accounts
To highlight one of the other differential diagnoses of
for 520% of consultations to chest pain clinics (3).
ischemic chest pain.
The ECG is the initial test for evaluation of a
patient presents with a chest pain. An echocardiography
PATIENTS AND METHOD
is an essential study to assess cardiac function and
Study design:
anatomy (4). ECG stress test is a useful test to exclude
This was a cross-sectional descriptive study
ischemic heart disease in patients with low and
conducted in the Cardiac and Rheumatological clinics in
intermediate pre-test probably. In addition to the classic
Al Sadar Teaching Hospital in Basrah (Iraq), from
Diamond and Forrester classes (5).
January 2021 till June 2022.
803
Received: 7/7/2022
Accepted: 12/9/2022
c:\work\Jor\vol901_116
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 806-810
Prevalence of Catheter Related Blood Stream Infection among Patients on
Maintenance Hemodialysis, Causative Organism and Catheter Outcome
Ayman Seddik1*, Abdelrahman Khedr1, Ayman Asaad2, Islam Elshazly1
Departments of 1Internal Medicine & Nephrology and 2Medical Microbiology & Immunology,
Faculty of Medicine, Ain Shams University, Cairo Egypt
*Corresponding author: Ayman Seddik, Mobile: (+20) 01142497699, E-mail: aymanseddik@med.asu.edu.eg
ABSTRACT
Background: Hemodialysis (HD) patients are at risk of several causes of morbidity and mortality especially
cardiovascular related complications and Infection. In patients on maintenance HD infection and sepsis are major
hospitalization cause and the second most common cause of mortality. Objective: The aim of the current study is to
investigate the incidence of catheter related blood stream infection among HD patients.
Patients and methods: A total of 161 patients on maintenance HD at Ain Shams University Hospital Dialysis Unit for
at least 3 months prior to start of study, and followed up for 12 consecutive months.
Results: A total of 161 patients were included in our study; mean age was 55.2 (SD 17.1) years old, and mean follow
up was 10.9 (SD 2.7) months. Patients were observed for 12 months on maintenance HD, 102 (63.4%) of the patients'
vascular access was arteriovenous fistula and 59 (36.6%) patients with dialysis catheter (tunneled or non-tunneled
catheter). Patients older than 65 years old were independently associated with increased risk of CRBSI relative risk 1.13
(95%CI: 1.57-2.24) [P-value <0.001]. Prolonged of catheter indwelling was independently associated with higher
CRBSI relative risk in patients with >12 months catheter indwelling time relative risk 1.75 (95%CI: 1.0-2.0) [P-value
<0.001]. Diabetes is independently associated with higher relative risk of CRBSI 1.94 (95%CI: 1.15-3.26) [P-value
<0.001]. Most common causative organism was gram-positive bacteria (65) %, followed by gram-negative bacteria
(35%). gram negative CRBSI is independently associated with higher risk of catheter loss compared to gram positive
organisms' relative risk 5.18 (95%CI: 1.76-15.18) [P-value <0.001].
Conclusion: CRBSI is common among patients on maintenance hemodialysis maximizing prevention strategies and
tailoring treatment approaches is vital for the reduction of rate of CRBSI and appropriate catheter management.
Keywords: Hemodialysis, Catheter related blood stream infection, Bacteremia.
INTRODUCTION
Bacteremia had a high incidence among HD
End stage renal disease (ESRD) is a major public
patients using tunneled catheters as compared to those
health problem and a significant financial burden (1).
an arteriovenous fistula (AVF) or even with a graft
Hemodialysis (HD) patients are at risk of several causes
(AVG). Tunneled catheter is associated with an 8-fold
of morbidity &mortality especially cardiovascular
greater bacteremia risk compared to AVF. CRBSI, exit-
related complications and Infection. In HD patients'
site infection and tunnel infection or colonization are
infection and sepsis are major hospitalization cause and
common central venous catheter complication in HD
the second most common cause of mortality (2,3).
patients (7,8). There are 1.1 to 5.5 occurrences of
The exact definition of catheter-related blood
catheter-related bloodstream infection per 1000 catheter
stream infection (CRBSI) lacks consistency. In 2018,
days, and these episodes are more likely to result in
the Kidney Health Initiative's Catheter End Points
hospitalization, morbidity, and fatality (9).
Workgroup was performed by a multidisciplinary group
Gram-positive
bacteria,
particularly
of experts to establish a standardized definition of
Staphylococcus
aureus
and
coagulase-negative
catheter-related bloodstream infection (CRBSI) in HD
staphylococci, account for 40% to 80% of CRBSIs
patients. The definition criteria for CRBSI diagnoses in
whereas gram-negative organisms account for 20% to
HD patients: 1) Clinically (temperature more than 37.5
40%, polymicrobial infections account for 10% to 20%,
C or rigors or new predialysis hypotension or altered
and fungal infections account for 5%. Endocarditis,
mental status), 2) Bacteremia confirmation (the same
septic pulmonary emboli, osteomyelitis, spinal epidural
organism growing in the blood cultures from the HD
abscess, septic arthritis, and brain abscess are possible
catheter and a peripheral vein or dialysis bloodline), and
CRBSI complications (10).
3) exclusion of any alternate infection (4).
Management of CRBSI depends on the catheter
The accurate diagnosis of CRSBI in HD patients
type and the infection severity. As soon as a diagnosis
face challenges as peripheral blood cultures are not
is made, empirical systemic antibiotics should be given
obtained either because an existing vein is preserved for
until the results of the culture and sensitivity test are
arteriovenous fistula (AVF) creation or veins cannot be
available (11). Decision for catheter removal depends on
accessed. Symptomatic HD patients with fever usually
infection severity and the organism involved. Whenever
will go the hospital and not to the HD facility with
catheter salvage is attempted, a systemic antibiotic and
antibiotics prescribed without taking blood cultures.
an antibiotic lock should be provided (12).
Catheter tips are not routinely sent for culture due to
The objective of the current study is to study the
catheter salvage (5,6).
incidence of catheter related blood stream infection
806
Received: 03/08/2022
Accepted: 04/10/2022
c:\work\Jor\vol901_117
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 811-814
The Subclinical Hypothyroidism and Cardiovascular System
Muhamad Hossam El Den Maghrapy1, Manal El Sayed Ez EL Deen1,
Randa Mahrous Roushdy1, Sara Mahmoud Ahmed Hassanein1
Internal Medicine Department, Faculty of medicine, Assiut University, Assiut, Egypt.
Corresponding author: Randa Mahrous Roushdy, Tel: +201021584548, Email: randama7rous@yahoo.com
ABSTRACT
Background: Because of its high prevalence, subclinical hypothyroidism (SCH) has clinical significance as it is
associated with many of the risks of atherosclerotic cardiovascular disease (CVD) due to its direct and indirect effect
on lipid profile, diastolic function, and endothelial dysfunction. However, the link between SCH and CVD is still
unknown.
Objectives: This study aimed to evaluate the carotid intima media thickness (CIMT) and the lipid profile as evidence
of endothelial dysfunction and atherosclerosis on patients with SCH.
Patients and methods: The current study was a cross-section study carried out on 50 patients with SCH who were
enrolled from the Outpatient Clinics of Diabetes and Internal Medicine Department, Assiut University Hospitals,
Assiut, Egypt in the period from the 1st of September 2019 up to the end of December 2021. Also, 50 healthy matched
participants who served as control group. All participants underwent full history taking, a thorough clinical
examination, and routine lab investigation, in addition to thyroid function tests, lipid profile, echocardiography, and
estimation of CIMT.
Results: Patients with SCH had significantly higher waist to hip ratio (W/H), higher triglycerides, cholesterol, low-
density lipoprotein cholesterol (LDL-c), and increase in CIMT. Seven patients (14%) in the study group had diastolic
dysfunction versus no one in the control group. In addition, SCH patients showed that significant positive correlations
were founded between CIMT and thyroid-stimulating hormone (TSH), cholesterol and LDL levels.
Conclusions: The study found that various cardiovascular risk factors were prevalent in patients with SCH and should
be considered.
Keywords: Subclinical hypothyroidism, Cardiovascular system.
INTRODUCTION
Subclinical hypothyroidism is a biochemical
MATERIALS AND METHODS
disorder marked by elevated serum level of TSH
Study participants:
while the thyroid hormone concentrations still within
The current study was a cross-sectional hospital-
their normal reference values[1]. The prevalence rate
based study at one of major Tertiary Health Care
ranges from 12 to 18%, being more common with
Hospitals, Assiut University Hospital, Assiut, Egypt
increased age and among women[2].
through the period from the 1st of September 2019 to
Autoimmune thyroiditis is one of the main
the end of December 2021. Fifteen patients with SCH
causes of SCH, but it can also be caused by other
were recruited from the Outpatient Clinics of
factors
[3].
Subclinical
hypothyroidism
is
Diabetes and Internal Medicine Department of Assiut
accompanied by cardiovascular hazards such as
University Hospitals, in addition to 50 healthy
hyperlipemia, diastolic hypertension, increase arterial
matched individuals with normal thyroid function
stiffness, an elevated C- reactive protein, and
who serve as control group. All patients had a
endothelial dysfunction[4, 5].
thorough medical history taking, including their body
Hyperlipidemia is a significant risk factor for
mass index (BMI) and W/H ratio, presence of other
atherosclerosis; elevated TSH is linked to higher
comorbidities (as hypertension, diabetes mellitus),
LDL, higher serum triglycerides (TGs), and reduced
and current use of medications. Assessment of vital
breakdown of cholesterol. This could contribute
signs was done for all studied participants. 3 ml of
to the dyslipidemia observed with SCH[4, 5].
venous blood samples were collected from all studied
Endothelial dysfunction is the centerpiece in the
participants to assess the thyroid stimulation hormone
onset and progression of atherosclerotic CVD, which
(TSH), lipid profile, blood glucose, and CRP. All
leads to increase carotid artery intima media thickness
participants
were
subjected
to
ECG,
(CIMT) [4, 5].
Echocardiography, and measurement of CIMT.
The association between SCH, atherosclerosis
and CIMT has been reported but the exact
Exclusion criteria:
mechanisms have not entirely cleared[6].
Patients aged less than 18 years old, those with
The main goal of this study was to estimate the
thyroid dysfunction (either hypo or hyperthyroidism),
correlation between SCH and cardiovascular risk
diabetics, hypertensives, pregnant or lactating
factors by assessment of lipid profile and CIMT as
women, smokers, those who received antithyroid
evidence of atherosclerosis and endothelial
medications or any drug that had an effect on thyroid
dysfunction.
functions, patients with a history of receiving
811
Received: 24/7/2022
Accepted: 26/9/2022
c:\work\Jor\vol901_118
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 815-820
Study of Morbidity and Mortality of The Cardio-Renal Syndrome in
The Pediatric Intensive Care Unit
Sameh E Z Abdulsamea*, Ahmed Attia
Pediatrics department, Faculty of Medicine, Benha University, Benha.
*Correspondence author: Sameh Abdulsamea, Mobile: 00447943109130,
E-mail: samoha779@gmail.com, ORCID: 0000-0002-7478-5037
ABSTRACT
Background: Cardio-renal syndrome (CRS) is a term that describes the acute or choric comorbid state of the heart and
kidney. Cardio renal axis is of significant importance in pediatric patients in acute conditions as identification and optimum
management of this condition improves the survival in the PICU.
Objectives: This study aimed to describe the pattern of CRS in our unit and to compare it with other PICU centers and to
highlight the impact of this condition on PICU-admitted children.
Patient and methods: This study was carried out in Benha University Hospital, Egypt on 321 critically ill patients aged
from 1 month to 18 years.
Results: In this study, we described 321 children patients admitted to the PICU, out of which 79 (24.9%) acquired cardio-
renal syndrome. The primary diagnosis leading to admission to PICU was attributed to CVS causes like heart failure and
arrhythmia in 51 patients (15.9%), CNS in 109 cases (34%) with the predominance of CNS infection being the commonest.
There was no significant correlation between the severity of kidney injury and the stage of the heart failure in all types of
CRS expect in type III. PICU stay significantly longer with CRS III (mean 10.4 ± 5.1 days) compared to other types. The
mortality was the highest in type 5 (72.8% compared to other types).
Conclusion: CRS is an important PICU phenomenon that needs to be early recognized and managed to improve the survival
of PICU patients and to reduce the mortality.
Keywords: Cardio-renal syndrome, AKI, CKD, PICU, Heart failure.
INTRODUCTION
addition to old well-known theories of abnormal
Acute or chronic malfunction in one organ may
hemodynamics, anemia, hypoxia and hypertension (7).
cause acute or chronic malfunction in the other organs. In
Although the link between the kidney and heart was
the illness known as CRS, which affects both the heart
studied thoroughly, the CRS is introduced in pediatric
and the kidneys (1,2).
literature in 2008 following a cohort study at Cincinnati
Heart failure is a clinical illness characterized by
children hospital in the USA between 2003 and 2005 on
elevated venous pressure, early myocardial cells loss, and
children admitted with acute decompensated heart failure
diminished cardiac output. Acute kidney injury (AKI) is
(8).
a severe clinical condition characterized by abnormal
kidney functioning, with or without testing evidence
PATIENTS AND METHODS
(often within 48 hours of bilateral renal affections of any
This was a prospective cohort study that was
degree) (3-5).
conducted over a period from 1/10/2013 till 30/9/2017.
CRS was divided into five categories: Acute cardiac
The study was approved by the ethical committee of
failure that results in acute renal damage is a characteristic
Benha University. All admitted cases to the PICU during
of type I. Chronic cardiac dysfunction of type II results in
the aforementioned period who met PICU admission
chronic renal disease. Acute renal injury that results in
criteria were included in the study. The total number of
heart failure or an arrhythmia as a result of acute cardiac
patients was 321 cases (169 male and 152 female).
dysfunction characterizes type III. Type IV describes
chronic kidney disease leading to chronic cardiac
Inclusion criteria (PICU admission criteria):
abnormality, while type V is the presence of combined
Patients with severe or potentially life-threatening
cardiac and renal dysfunction due to systematic disorder
pulmonary or airway disease such as those requiring
(6). There are many mechanisms explaining the heart-
endotracheal intubation and those with rapidly
kidney interaction including neuro-hormonal activation
progressive pulmonary lower or upper airway disease.
of renin-angiotensin-aldosterone axis, high abdominal
Those with life-threatening or unstable cardiovascular
pressure, increased venous pressure and endothelial
disease and those with acute or unstable neurological
dysfunction.
condition.
Pediatric
patients
with
acute
Free radical production and cytokine-induced
hematologic/oncologic emergencies like those with
apoptosis are also contributing mechanisms. Defects in
severe coagulopathy. Those with GIT, renal, metabolic or
perfusion autoregulation pathways contribute to CRS in
multisystem affection were also included (9).
815
Received: 23/07/2022
Accepted: 25/09/2022
c:\work\Jor\vol901_119
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 821-823
Implications of Antimicrobial Resistance during Acne Treatment:
Review Article
Hend Darwish Gamil1, Sara Ahmed Gouda Mustafa*1,
Rania Mohammed Mohammed Amer2, Shrook Abd Elshafy Khashaba1
Departments of 1Dermatology, Venereology and Andrology and
2Medical Microbiology and Immunology, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Sara Ahmed Gouda Mustafa, Mobile: (+20) 01060140667, E-Mail: sea.friends1994@gmail.com
ABSTRACT
Background: P. acnes is a pleomorphic rod that is aerotolerant, anaerobic, Gram positive, non-spore-forming, and a
member of the class Propionibacteriales in the phylum Actinobacteria. Antibiotic therapy for acne is widely recognized as
an effective strategy for managing this common skin condition. P. acnes skin colonization can also lead to Pseudomonas
folliculitis, a Gram-negative folliculitis. By stimulating a regional upsurge in keratinocyte autophagic activity, P. acnes
strains may play a role in antimicrobial defence pathways.
Objective: This review article aimed to assess the antimicrobial resistance during acne treatment.
Methods: We searched PubMed, Google Scholar, and Science Direct for information on Antimicrobial Resistance with
Acne Treatment. However, only the most current or comprehensive study from January 2000 to May 2021 was
considered. The authors also assessed references from pertinent literature. Documents in languages other than English
have been disregarded since there aren't enough resources for translation. Unpublished manuscripts, oral presentations,
conference abstracts, and dissertations were examples of papers that weren't considered to be serious scientific research.
Conclusion: Antibiotic resistance in P. acnes could compromise the success of acne treatments. Extensive use of
antibiotics to treat acne may have consequences in other illnesses where P. acnes may be the etiological culprit. Recent
research has shown that the phylotype IA1 is the most common among resistant strains. Variants of this genotype that
are resistant to antibiotics have been discovered all over the world, including on the skin of otherwise healthy people.
Keywords: Antimicrobial Resistance, Acne Treatment.
INTRODUCTION
In normal skin, the cutaneous microbiome is in a
cutaneous group Propionibacterium within the field of
delicate balance that can be thrown off by external
dermatology (5).
factors, potentially leading to a number of inflammatory
skin illnesses. Corynebacteria, Propionibacteria, and
Microbiology of P. Acnes:
Staphylococci are the top three genera of cutaneous
P. acnes is a pleomorphic rod that is aerotolerant,
bacteria (1).
anaerobic, Gram positive, non-spore-forming, and a
member of the class Propionibacteriales in the phylum
Structure of P. Acnes:
Actinobacteria. This bacterium is nonpathogenic and is
Acne-causing, Propionibacterium acnes is a
found as a component of the normal flora of the skin,
commensal of human skin that is Gram-positive, does not
mouth and digestive and urine systems. Rather of
form spores, and thrives in anaerobic environments (2).
flourishing in an acidic or alkaline environment, P. acnes
Like Propionibacterium avidum, Propionibacterium
thrives in the more neutral pH range of 6.0 to 7.0. Aerobic
granulosum, and Propionibacterium humerusii, it is part
blood culture bottles are ideal for P. acnes because they
of the typical skin microbiota. The entire P. acnes
lack the anaerobic microenvironment that occurs at the
genome, at a size of 2.5 Mb has been sequenced. Lipases
bottom of nonshaken bottles. The optimal growth
that degrade pilosebaceous follicle lipids give the
temperature lies between 30 and 37 degrees Celsius (6).
bacteria energy, and the genes that code for these
Acne pathology can't start until P. acnes has
enzymes allow the bacterium to survive in
colonized the skin, but that's not enough on its own.
microaerophilic conditions (3).
Patients with acne have P. acnes make up more than
After the discovery of the lipase genes
30% of the face microbiota, and this bacterium is
triacylglycerol lipase and lysophospholipase, which are
present in 87% of clones in both acne and non-acne
specific to the breakdown of sebum lipids, a proposal was
patients (7).
made to rename P. acnes to Cutibacterium acnes in order
Conversely, P. acnes may reduce the expansion of
to reflect the genomic adaptation changes and to
S. aureus and S. pyogenes by boosting triglyceride
differentiate it from other Propionibacteria species (4).
hydrolysis and propionic acid generation. The
Some have advocated, however, that the name
pilosebaceous follicle, as a result, has a constantly
should be changed back to "Cutibacterium acnes" for a
acidic pH. Damage to the skin's protective barrier and
number of reasons, including the potential for
inflammation could result from a shift in the
misunderstanding with the old name. As far as taxonomy
microbiome's composition (8).
is concerned, it is acceptable to keep calling the
Acne is associated with a different phenotype of P.
acnes, and distinguishing phylotypes in patients with
821
Received: 25/07/2022
Accepted: 27/09/2022
c:\work\Jor\vol901_120
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 824-832
Study of Risk Factors Leading to Conversion of Laparoscopic Simple
Closure to Open Surgery in Perforated Peptic Ulcer
Emad Mohammed Salah, Tamer Alsaied Alnaimy, Atwa Arafat Atwa, Gamal Mohamed Osman
Department of General Surgery, Faculty of Medicine - Zagazig, University, Egypt
*Corresponding author: Atwa Arafat Atwa, Mobile: (+20) 01024455270, E-Mail: atwa.arafat@medicine.zu.edu.eg
ABSTRACT
Background: When compared to open surgery for perforated peptic ulcers, laparoscopic treatment has many
advantages, including less pain, a quicker recovery time, and less consequences. Objective: This study aimed to assess
the risk factors that lead to conversion of laparoscopic simple closure of perforated peptic ulcer to open procedure in
Zagazig University Hospitals.
Subjects and Methods: Our study is prospective randomized clinical trial was done in the General Surgery Department
at Zagazig University Hospital on a study sample of 24 patients who visited an emergency room complaining of severe
stomach discomfort and were told they had a perforated peptic ulcer. Those patients underwent laparoscopic repair at
first. The steps of laparoscopic repair were performed after the perforation site was located laparoscopically, assuming
that the initial diagnosis was correct.
Results: Studied groups differed significantly regarding duration of perforation and its size, hospital stay and duration
of operation. These variables were higher among conversion group than laparoscopic group. The average laparoscopic
simple closure (LSC) conversion rate was 12.4% (range: 0% to 28.5%). The size of the perforation was the primary
factor in most cases of conversion, however the location of the perforation was also a typical contributing factor. Only
4 of the total 24 instances in the research were converted, at a percentage of (16.7%).
Conclusion: Laparoscopic management of perforated peptic ulcer is safe and practicable for the well-trained surgeon.
It causes less pain postoperatively, and the rate of complications is less than an open approach.
Keywords: Laparoscopic simple closure, Open surgery, Perforated peptic ulcer.
INTRODUCTION
SUBJECTS AND METHODS
Medical advances like H2 receptor antagonists,
Subjects:
proton pump inhibitors (PPIs), and the elimination of
Our study is prospective randomized clinical trial
Helicobacter pylori have led to a decline in the incidence
that was done in the General Surgery Department at
of peptic ulcer disease in recent decades (1). However,
Zagazig University Hospital on a study sample of 24
complications from peptic ulcers have not decreased in
patients who were presented with acute abdominal pain
tandem with the decline in peptic ulcer disease (2).
and diagnosed with perforated peptic ulcer.
However, the prevalence of perforated peptic
ulcers (PPUs) has stayed relatively constant over the
Methods of the study:
previous few decades despite their high mortality rate (3).
Perforated peptic ulcer was diagnosed based on:
Many studies have been conducted since the first
Proper history and examination: History of
report of laparoscopic management of PPU in 1990 to
smoking and intake of NSAIDs. Perforation
assess its efficacy and safety (4). When comparing
symptoms present themselves with a sudden onset of
laparoscopic repair of PPU to open surgery, laparoscopic
severe stomach discomfort, nausea, and vomiting.
repair is preferable since it results in less pain, a shorter
Abdominal rigidity, discomfort, and rebound
hospital stay, and less overall damage to the body. As
tenderness are all symptoms of a perforation.
medical care for PPU has advanced and laparoscopic
surgery has become more widespread, a new trend has
Lab investigations: Testing for initial evaluation
emerged: the use of laparoscopic simple closure (LSC)
and resuscitation purposes, including complete blood
instead of open repair. On the other hand, laparoscopic
count, serum electrolytes (Na, K), serum amylase,
surgery isn't a good option for everyone (5).
kidney, and liver functions.
Compared to open surgery, reoperation rates
Radiology: Most commonly in the form of an upright
following laparoscopic repair have been shown to be
abdominal X-ray and a plain chest X-ray to detect the
much higher in several studies (4-6). While many studies
presence of free air in the belly and verify a
have shown laparoscopic and open repair to be effective
perforation. However, other tests, such as pelvic-
for PPU. Surgeons still sometimes have complications
abdominal
ultrasonography
for
detecting
with the procedure (7).
intraperitoneal turbid fluid or collections, are also
It was the goal of this study, to assess the risk
performed and when the diagnosis was uncertain,
factors that lead to conversion of laparoscopic simple
patients underwent a CT of the abdomen and pelvis
closure of perforated peptic ulcer to open procedure in
with oral and intravenous contrast since free air under
Zagazig University Hospitals.
the diaphragm is not always visible on a standard X-
ray.
824
Received: 25/07/2022
Accepted: 27/09/2022
c:\work\Jor\vol901_121
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 833-836
Immunotherapy Growing Role in Warts Management: Review Article
Aml Ibrahim Mohamed Ismael*, Ayman Elsayed Yousef, Basma M. Elkholy
Department of Dermatology, Venereology and Andrology, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Aml Ibrahim Mohamed Ismael, Mobile: (+20) 01115387163,
E-Mail: amlelshorbagy47@gmail.com
ABSTRACT
Background: Common dermatological disorders induced by the human papillomavirus (HPV) include warts (both
cutaneous and genital). It's not dangerous, but it's unpleasant to look at, can spread to others, and sometimes koebnerizes.
So, it's crucial to get the right care at the right time. Several conventional therapies are available, although their efficacy
varies. Noninvasive, user-friendly, and showing great promise, topical and systemic immunotherapy has quickly become
a mainstay in the treatment of warts.
Objective: Assessment of Growing role of immunotherapy in treatment of warts.
Methods: We searched PubMed, Google Scholar, and Science Direct for information on Immunotherapy with Warts
and human papillomavirus. However, only the most current or comprehensive study from April 2005 to July 2022 was
considered. The authors also assessed references from pertinent literature. Documents in languages other than English
have been disregarded since there aren't enough resources for translation. Unpublished manuscripts, oral presentations,
conference abstracts, and dissertations were examples of papers that weren't considered to be serious scientific research.
Conclusion: Intralesional immunotherapy using Candida antigen has the benefits of being inexpensive, showing
promise, being simple and easy to inject into a single wart. A promising immunotherapeutic strategy is intralesional
injection of the Candida antigen. In both injected and non-injected lesions, this modality is related to Th1 cytokines
production.
Keywords: Immunotherapy, Warts, Human papillomavirus.
INTRODUCTION
An
extensive
group
of
non-enveloped,
following infection, at which point it may vanish on its
epitheliotropic, double-stranded DNA viruses called
own. In children, cleaning often begins within a few
human papillomavirus (HPV) is responsible for a variety
months, with around 50% clearing by one year and 2/3
of human malignancies. Infection causes enhanced
clearing by two years. While childhood warts often
epithelial proliferation in particular areas, which might
disappear after a year or two, adult ones can linger for
lead to cancer in some cases (1). Double-stranded DNA
five to 10 years (5).
viruses, human papillomaviruses (HPV) are about 8
Two main therapeutic approaches are used to treat
kilobases in length and 50-55 nm in diameter. The viral
warts: immunotherapy, which is based on immune
DNA is enveloped in an icosahedral spherical capsid
system activation, and the traditional aggressive and
that has a preference for epithelial cells and infects the
destructive strategy,
laser ablation, chemical
skin and mucous membrane (2).
cauterization, cryotherapy, electrocautery, surgical
Abrasion to the skin or mucous membranes
excision, and surgical excision all fall under this
frequently results in HPV infection. Through contact
category (6).
with contaminated surfaces like gym floors or the area
around swimming pools, cutaneous forms can also
Immunotherapy in Warts Management (Figure 1):
spread inadvertently (3).
Immunotherapy is a biological therapy that employs
The ability of HPV to elude the immune system is
medicines that stimulate or suppress the immune system
unique. Three fundamental viral characteristics allow
to combat cancer, infections, and other diseases. Topical
for this ability. Since there is no viremic phase, immune
and systemic immunotherapy has now assumed a
cells in circulation have difficulty accessing the virus.
pivotal position in the treatment of warts because of its
Despite the abundance of Langerhans cells on the
non-invasive nature, ease of use, and promising results
mucosal surface, infections typically begin at the
(7).
basement membrane. Second, HPV is able to replicate
Growing evidence of the importance of cell
"silently" because it does not cause significant harm to
mediated immunity (CMI) in wart elimination,
the host cells, such as lysis of the infected cell, hence
particularly in patients with many and persistent warts,
reducing inflammation and the accompanying signaling
has justified the use of a variety of immunomodulatory
(4).
alternatives to eliminate warts on the skin. These
The inflammation associated with warts is not
include topical sensitizers like diphenylcyprone, pro-
always present, and they might persist for years. The
inflammatory cytokines like interferons, intralesional
wart may first shrink in size a few months to years
antigen therapies like Candida antigen therapy, and
others (8).
833
Received: 25/07/2022
Accepted: 27/09/2022
c:\work\Jor\vol901_122
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 837-842
Study of Risk Factors of Diabetic Foot and Role of Hypoxia- Inducible
Factor I Alpha in Egyptian Type 2 Diabetic Patients
Sahar Hossam ElHini1, Hala Elsayed Mohamed1, Ahmed Abdelfadil Saedii2,
Tamer El Zaeem Esmaeel3, Mostafa Mahmoud Hussein4, Hatem Ahmed Hassan5*
Departments of 1Endocrine and Diabetes Unit, 2Clinical Pathology, 3Radio-Diagnosis,
4Vascular Surgery and 5Internal Medicine, Faculty of Medicine, Minia University, Egypt
*Corresponding author: Hatem Ahmed Hassan, Mobile: (+20) 01008199481, Email: Dr.Hatem.ahmed@mu.edu.eg
ABSTRACT
Background: Diabetes mellitus (DM) causes elevated blood sugar levels and over time can cause problems of the heart,
blood vessels, kidneys, retina, and nervous system. One of the most severe complications of diabetes, diabetic foot ulcers
(DFU) are a major factor in the majority of non-traumatic lower-limb amputations. A heterodimer of HIF-1 and HIF-
1 , hypoxia-inducible factor I (HIF-1) is a transcription factor that is stabilized by hypoxia and acts as a fundamental
regulator of oxygen homeostasis and adaptive cellular responses to hypoxia. Objective: The current study aimed to
evaluate the risk factors of DFU and investigate the serum level of hypoxia inducible factor 1 alpha as biomarker for
incidence of DFU. Patients and methods: The study was conducted on 80 patients. Participants were divided into two
groups: Group I (diabetic foot) subdivided according to Wagner Meggitt 1987 Classification into grade (0), grade (1),
grade (2) and grade (3). Each group included 10 patients. Group II patients (control group) included 40 healthy subjects.
Patients were subjected to detailed history and complete examination, and complete laboratory evaluation which
included serum Hypoxia- inducible factor I alpha. Results: The associated risk factors of DFU identified in our study
were peripheral neuropathy, peripheral vascular disease, diabetic nephropathy, age, duration of DM, lack of education
about care of diabetic foot and male gender. There was higher level of serum hypoxia inducible factor 1 alpha in diabetic
patients than control subjects with significant increase in DFU patients.
Conclusion: HIF-1 may have a role in pathogenesis of DFU.
Keywords: Diabetic foot, Hypoxia- inducible factor I alpha, Egypt, type 2 diabetes mellitus.
INTRODUCTION
factor-1 (HIF-1, a heterodimer of HIF-1 and HIF-1 ),
The World Health Organization (WHO) describes
which is stabilized by hypoxia and controls
diabetes mellitus (DM) as a chronic metabolic disorder
angiogenesis, erythropoiesis, metabolic changes,
characterized by high blood sugar that eventually leads
proliferation, migration, proliferation, and cell survival
to issues with the heart, arteries, kidneys, retina, and
(5). The increased cytosolic ratio of free NADH to
nervous system (1).
NAD+ in hyperglycemia might create metabolic
According to the International Diabetes Federation
abnormalities despite appropriate tissue oxygenation.
(IDF), 700 million people between the ages of 20 and
This high ratio was the root cause of pseudohypoxia (6).
79 were estimated to have diabetes in 2045, up from an
The current study aimed to evaluate the risk factors
estimated 463 million in 2019. Worldwide, diabetes
of DFU and investigate the serum level of hypoxia
claimed 4.2 million lives in 2019. Around 90% of
inducible factor 1 alpha as biomarker for incidence of
occurrences of diabetes worldwide are of type 2,
DFU among Egyptian type 2 diabetic patients.
making it the most common kind of the condition (2).
The main pathophysiological factor driving type 2
PATIENTS AND METHODS
diabetes, in addition to cell failure, is insulin resistance,
The study was conducted on 80 patients selected
which is frequently correlated with abnormal insulin
from DM Outpatient Clinic at Minia University
production (3). Diabetic foot ulcer (DFU) is one of the
Hospital in the period from May 2020 to December
most severe complications of diabetes based on the two
2020.
primary etiological factors of diabetic peripheral
All subjects were divided into two groups:
neuropathy and peripheral arterial disease (PAD),
Group I (diabetic foot) patients which included 40
which together account for the majority of causes of
diabetic foot patient with type 2 diabetes subdivided
non-traumatic lower-extremity amputations (LEA) and
according to Wagner Meggitt 1987 Classification (7)
raise mortality rates. The long-term outlook is rather
into grade (0) 10 diabetic patients with intact skin, grade
bleak following LEA's revelation, which is highly
(1) 10 patients with superficial skin ulcer, grade (2) 10
related to DFU, with a 3-year mortality rate ranging
patients with deep skin ulcer and grade (3) 10 patients
from 35% to 50%. The total 5-year death rate was
with deep skin ulcer associated with abscess or bone
considerably greater over the longer term, ranging from
involved. Group II patients (control group) included 40
53% to 100% for those who had any amputations to
healthy subjects (free of any acute or chronic medical
52% to 80% for those who had severe amputations (4).
disease).
Adaptive cellular responses to hypoxia are
Patients with type 2 DM with and without
governed by the transcription factor hypoxia inducible
diabetic foot were included in the study. Patients were
837
Received: 25/07/2022
Accepted: 27/09/2022
c:\work\Jor\vol901_123
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 843-851
The Utility of Serum Procalcitonin Level as an Early Diagnostic Biomarker for
COVID in Patients Presenting with ST-Elevation Myocardial Infarction
Post Primary Percutaneous Coronary Intervention
Mostafa Ibrahim Ibrahim, Yara Mostafa Mohamed,
Mohamed Awad Taher, Mohamed Ahmed Abdelrahman
Department of Cardiology, Facutly of Medicine, Ain Shams University, Egypt
*Corresponding author: Mostafa Ibrahim Ibrahim, Mobile: (+20)01006682917, Email: dr.mostafaibrahim86@gmail.com
ABSTRACT
Objectives: The aim of the study was to detect if serum procalcitonin could be used as an early diagnostic marker for
COVID in asymptomatic patients presenting with ST-segment elevation myocardial infarction and if procalcitonin is
related to the extent of myocardial injury after the infarction.
Patients and Methods: The study was carried out on 150 patients (age 53.39 ± 13.16) presenting to Ain Shams
University Hospitals with ST-segment elevation myocardial infarction (STEMI) and received the standard of care
management, which is primary percutaneous coronary intervention (PCI). The patients were assessed regarding the
demographic data, presence of any symptoms and signs of infection, risk factors, echocardiography and laboratory
measures. COVID PCR and procalcitonin were assessed for all patients.
Results: Out of all the asymptomatic patients presenting with STEMI whose COVID PCR turned out to be positive,
the procalcitonin was positive 24 and 48 hours post presentation with P value <0.001. There was high statistically
significant relation between positive procalcitonin and total leucocytic count (TLC) where there was a drop from a
median of 11/mm3 with range (4.5 19) /mm3 in negative procalcitonin to a median of 3.7 /mm3 with range (1.4 12)
/mm3 in procalcitonin positive patients. There was high statistically significant relation between positive procalcitonin
and rise of C-reactive protein (CRP) value where there was a rise from CRP median value from 12 mg/dL range (2
40) mg/dL in negative procalcitonin patients to 47 mg/dL range (14 163) mg/dL in positive procalcitonin patients.
Conclusion: There was a strong relationship between procalcitonin and COVID infection in asymptomatic patients
thus procalcitonin can be used as an early diagnostic biomarker for COVID infection in patients presenting with
myocardial infarction.
Keywords: STEMI, COVID, Procalcitonin.
INTRODUCTION
It is standard procedure to classify patients with
The most prevalent type of cardiac illness is
persistent chest pain or other symptoms indicative of
coronary artery disease (CAD). It arises from
ischemia and ST-segment elevation in at least two
atheromatous modifications in the blood arteries
contiguous leads as STEMI in order to facilitate rapid
feeding the heart. Acute coronary syndrome (unstable
treatment measures such reperfusion therapy [4].
angina,
NSTEMI,
STEMI),
asymptomatic
COVID cases have been increasing significantly
atherosclerosis, and stable angina are all clinical
and it was associated with a lot of CAD cases. Most of
diseases referred to as CAD [1].
the patients present asymptomatically but it's related to
One of the biggest causes of death globally is
increased risk of morbidity and mortality in these
coronary artery disease. According to the World
patients.
Health Organization (WHO), ischemic heart disease
In critically unwell patients, procalcitonin (PCT) is
caused almost nine million fatalities in 2016. The
recognised as a biological diagnostic sign for severe
mortality rate from CAD shows contrasting patterns in
sepsis or septic shock. The significance of
developed and developing nations. Ischemic heart
procalcitonin in patients with acute myocardial
disease-related death rates are declining in wealthy
infarction and those with acute coronary syndromes,
nations like the U.S. and the UK. Nevertheless, 16.5
that is, non-ST-elevation myocardial infarction or
million Americans over the age of 20 had coronary
unstable angina, is still controversial due to conflicting
artery disease in 2018, with 55% of those affected
evidence. There are conflicting findings regarding
being men. With rising mortality trends, the condition
procalcitonin rise in COVID-19 subjects [5].
of CAD is getting worse in emerging nations [2].
The presence of acute myocardial injury indicated
AIM OF THE WORK
by abnormal cardiac biomarkers in the presence of
Primary objective: To investigate the utility of serum
evidence of acute myocardial ischemia indicated by
procalcitonin as an early diagnostic biomarker for
the detection of an elevated cardiac troponins (cTn)
COVID in asymptomatic patients presented with
value above the 99th percentile is what is referred to as
STEMI.
myocardial infarction in clinical terms. If the values of
Secondary objective: To evaluate the association
cTn increase or decrease, the damage is deemed acute.
between procalcitonin release in the acute setting of
Provided the fourth accepted definition of myocardial
STEMI with the size and extent of myocardial
infarction (2018) [3].
infarction.
843
Received: 10/6/2022
Accepted: 11/8/2022
c:\work\Jor\vol901_124
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 852-856
Evaluation of The Outcomes of Intra-Operative Colonic Lavage in
Non-Elective Colonic Resection and Primary Anastomosis for Sigmoid Volvulus
Sherif Albalkiny, Mohamed Elsayed Seifalyazal, Gamal Fawzy*
Department of General Surgery, Faculty of Medicine, Ain Shams University, Egypt
*Corresponding author: Gamal Fawzy, Mobile: (+20) 01220495554, E-Mail: dr.gamalfawzy@yahoo.com
ABSTRACT
Background: Management of acute sigmoid volvulus was documented using a variety of surgical techniques. It has
been established that mechanical bowel preparation is not required for elective colorectal surgery. To lower the risk of
post-operative infectious complications and anastomotic dehiscence, one-stage primary resection and anastomosis of
left sided colon blockage with on-table antegrade colonic lavage are becoming more and more popular.
Objective: The aim of the current study was to assess the safety of single stage resection and anastomosis in the
treatment of acute left sided colonic blockage brought on by acute sigmoid volvulus without intraoperative colonic
lavage. Patients and methods: This study was conducted in the Department of Surgery, Ain shams University
Hospitals (Cairo, Egypt) between June 2018 till June 2021. It included 37 patients who presented with acute sigmoid
volvulus and managed by colonic resection and primary anastomosis then furtherly classified into two groups based
on the usage of antegrade colonic lavage to evaluate their outcome. Results: Preoperative characteristics of the 2
studied groups were comparable. In terms of mortality, general morbidity, or significant morbidity, there was no
difference between the 2 studied groups. Operative time was significantly higher in Group I where Intra-operative
Antegrade Colonic lavage (IOACL) took place, which could be attributed to the extra step of setting the lavage system
and colonic irrigation time. Of the studied 37 patients, superficial wound infection occurred in 12 patients and 3 of
them progressed to develop complete wound dehiscence, however; neither required further surgery as no disruption
and managed conservatively with antibiotics and wound dressing. Conclusion: Colonic resection and primary
anastomosis can be used to safely treat left-sided colonic blockage brought on by acute sigmoid volvulus without the
need for mechanical bowel preparation.
Keywords: Left sided colonic obstruction, Sigmoid volvulus, Resection, Primary anastomosis, Intraoperative colonic
lavage.
INTRODUCTION
The majority of patients are very young and
The sigmoid colon twisting around its mesentery
healthy, which increases the likelihood that they will
is known as a sigmoid volvulus and could be attributed
be able to recover from the condition and its surgical
to abnormal narrow attachment of its root to the
side effects. This is reflected in the low mortality rates
posterior abdominal wall which in turns results in
following emergency surgery for acute volvulus (4-6).
close approximation of its two limbs and predispose to
As long as patient does not have features
its twist around its mesenteric axis. In these vulnerable
suggestive for peritonitis, endoscopic detorsion is the
patients, lack of dietary fibers and chronic constipation
preferred initial approach for sigmoid volvulus.
could be precipitating factors for volvulus. Twisting
Endoscopic reduction is being effective in reducing the
usually occurs counterclockwise with variable degree
volvulus in about 7798% of patients. Additionally, it
of torsion ranging from 180º to 540º (1-3). The most
is less invasive procedure than emergent colectomy
frequent type of volvulus often occurs around the
with lower mortality rate. Even so, endoscopic
mesenteric axis and is located 1525 cm away from
detorsion has recurrence rates ranging between 7 and
the anus, making sigmoidoscopic inspection possible
67% (3,15,17-19).
(1-3).
Moreover, emergency endoscopic decompression
Elderly people older than 70 who have a history
could not be an available facility out of hours in most
of persistent constipation or who have underlying
of the developing countries. Therefore, it is advised to
neuropsychiatric illnesses are the most often afflicted
think about a colectomy following a successful
group (4-15), if prompt intervention is not done, serious
endoscopic reduction (3,12,17,19), which may be followed
complications such as intestinal gangrene and
by a primary anastomosis with or without proximal
peritonitis might progress and result in death.
diversion or resection with end colostomy (Hartman's
Around 10-50% of bowel blockages worldwide,
Procedure) (11). There is insufficient high-quality
including in Latin America, Africa, Eastern Europe,
evidences to favor one operational strategy over
Russia, the Middle East, and India, are caused by
another.
sigmoid volvulus, compared to only 2-3% in the
Most surgeons would like to conduct initial
United States (11-14).
anastomosis on mechanically cleansed bowel as a
It was shown that sigmoid volvulus patients tend
general, established criterion for safe colonic resection
to be younger and have less morbidities than what was
and anastomosis. On-table antegrade colonic lavage is
previously suggested in previous reports, in a sizable
intended to clear and decompress the proximal blocked
population-based analysis of individuals who
colon in order to reduce abdominal distension,
underwent surgery correction for the condition (16).
promote abdominal closure, and enhance colonic blood
852
Received: 25/07/2022
Accepted: 27/09/2022
c:\work\Jor\vol901_125
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 857-862
Assessment of Motor Skills in Autism Spectrum Disorders
Eman Fathalla Gad1, Samia Attwa2, Dina Tharwat Mohammed Ali3*
1Associate Professor of Pediatrics, 2Professor of Pediatrics, 3M.B.B.CH, Faculty of Medicine, Assuit University
Corresponding authors: Dina Tharwat Mohammed Ali, E-mail: dfouad973@gmail.com
ABSTRACT:
Background: Motor deficits are common and extensive in neurodevelopmental disorders, autism spectrum disorder in
particular (ASD). Additionally, motor deficiencies are probably the cause of difficulties with social communication,
which may be the first sign of atypical development in ASD.
Objective: The purpose of this study was to examine the degree of mobility impairment in kids with autism spectrum
disorders (ASD).
Patients and methods: A cross-sectional study was carried out in Assiut University Child Hospital. All children with
autism from the age of 3 years to 18 years in Neurological Outpatient Clinic in Assiut University Pediatric Hospital
diagnosed using the Movement Assessment Battery for Children (M-ABC) were included.
Results: There was significant difference between improvement after physiotherapy (Not yet, No improvement and
Improved) and Medical treatment (Antipsychotics). There was highly significant difference between improvement after
physiotherapy (Not yet, no improvement and improved) and compliance, and there is no significant difference between
improvement after physiotherapy (Not yet, no improvement and improved) and outcome.
Conclusion: The physical health of children with ASD improved as a result of the physiotherapy sessions, including
agility, coordination, usable skills, and powerful, quick legs. Additionally, it became simpler to exercise in a group, at
home, or in private sessions with a professional.
Keywords: Autism spectrum disorder, motor control, motor function, cross sectional study, Assuit University.
INTRODUCTION
Motor deficits are common and extensive in
The purpose of this study was to examine the degree of
neurodevelopmental disorders, particularly autism
mobility impairment in kids with autism spectrum
spectrum disorder (ASD). In contrast to the other
disorders (ASD).
developmental
categories,
however,
self-care
behaviours including feeding, dressing, and using the
PATIENTS AND METHODS
restroom and sensori-motor development are still
A cross-sectional study was carried out in Assiut
understudied, daily living abilities, which we shall refer
University Child Hospital. Patients with autism from
to as self-care abilities, can be challenging for some
the age of 3 years to 18 years in Neurological Outpatient
ASD youngsters (1).
Clinic in Assiut University Pediatric Hospital were
Autism is a complicated neurobehavioral illness
included.
marked by inflexible, repetitive behaviours as well as
difficulties
with
social
interaction,
language
Inclusion criteria: All children with autism from the
development, and communication. ASD is the name
age of 3 years to 18 years diagnosed using the
given to this ailment nowadays due to the wide range of
Movement Assessment Battery for Children (M-ABC).
symptoms. It covers a wide range of signs, abilities, and
Exclusion criteria: Children younger than three years
degrees of impairment. The degree of ASD can range
old, those with neurological diseases, and those who
from a minor impairment that only slightly restricts
have cerebral palsy.
otherwise normal life to a catastrophic disability that
may necessitate institutional care (2).
Methods:
The best reasons for these problems are not
Full clinical history: including age, sex, residence,
intellectual disability (intellectual developmental
consanguinity, similar conditions in family.
disorder) or general developmental delay.Intellectual
handicap and autism spectrum condition frequently co-
Detailed
examination
including
vital
signs,
occur, therefore social communication must be below
anthropometric measures, systematic examination.
the level anticipated for general developmental maturity
in order to identify both illnesses (3).
Movement skills measured their movement using the
Independent living depends on daily living skills
Movement Assessment Battery for Children (MABC).
(DLS), which cover matters like maintaining personal
Exam taking is advised by the European Academy of
hygiene, preparing meals, and managing money. In
Childhood Disability. The Movement Assessment
contrast to their cognitive talents, many people with
Battery for Children (MABC-2) standard exam was
autism spectrum disorder struggle with everyday living
used to collect data, which is the most complete
skills, according to research (4).
diagnostic tool yet developed for evaluating motor
activity and identifying developmentally conditioned
857
Received:18/07/2022
Accepted:20/09/2022
c:\work\Jor\vol901_126
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 863-868
Outcome of Infant Regurgitation Diagnosed by Rome Criteria
Yosra M Awad1, *, Mostafa EL-Hodhod1, Marwa El Deeb1, Nehal Soliman2 and Yasmin AF Aly1
1Department of Pediatrics, Faculty of Medicine, Ain Shams University.
2Ministry of Health and Population, Egypt
*Correspondence: yosraawad@med.asu.edu.eg. Egypt. Mobile number: (+20)1001831590, ORCID: 0000-0002-5315-9774
ABSTRACT
Background: Infant regurgitation is the most prevalent functional gastrointestinal disorder in infancy. Knowing the
benign outcome of such condition helps to decrease the anxiety of parents and unnecessary prescriptions by physicians.
Objectives: The aims of the current work were to detect the outcome of infant regurgitation among Egyptian infants
diagnosed by Rome criteria and to detect its prevalence among the surveyed population.
Patients and Methods: A prospective cohort study enrolling 280 healthy infants 1-4 months diagnosed as infant
regurgitation according to Rome criteria by fulfilling a questionnaire and undergoing examination. Parents were
reassured and educated then both were repeated after 3 months. According to the outcome, infants were divided into
symptomatic infants, who were either partially improved or not- improved at all and asymptomatic infants who had
stopped regurgitation.
Results: The prevalence of regurgitation was 20.3% among the surveyed 1380 infants. On follow up 42.9% of infants
became asymptomatic while 49.6% partially improved and only 7.5% didn't improve. Weight was properly gained for
all patients except 3 who had failure to thrive, however that was not correlated with the outcome of regurgitation. Proton
pump inhibitors were prescribed for 7.7% of cases, however, increasing age was the only predictor of total improvement
after 3 months follow up with odds ratio=2.45 and confidence interval (1.57-3.84).
Conclusion: Infant regurgitation diagnosed according to Rome criteria seems to be normal behavior in early infancy
which resolves by time, just requiring parental, reassurance, and follow up, while no interventions are needed.
Keywords: Infants; Regurgitation, Proton pump inhibitors, Gastrointestinal diseases; Functional; Gastroesophageal
reflux.
INTRODUCTION
Infant regurgitation must meet the following
Regurgitation is defined as the flow of refluxed
two requirements, according to the Rome
gastric content into the oropharynx. In infants, it is
diagnostic criteria, in otherwise healthy infants between
crucial to differentiate between the physiologic and
the ages of three weeks and twelve months:
pathologic reflux. Most infants with physiologic
regurgitation occurring twice daily for three weeks or
regurgitation are healthy, happy (happy spitters), and
longer without any feeding or swallowing issues, failure
having normal growth and development without
to thrive, abnormal posturing, apnea, retching, or
underlying predisposing factors and no pharmacologic
hematemesis, and the absence of any other signs (10).
treatment is typically necessary (1).
It is crucial for healthcare professionals to
On the other hand, the movement of gastric
understand the natural history of infant regurgitation to
contents into the esophagus, either with or without
manage infants and offer parents evidence-based
regurgitation
and
vomiting,
is
known
as
guidance (5).
gastroesophageal reflux (GER) (2). Reflux is the most
The primary objective of the current study was
prevalent functional gastrointestinal disorder in the first
to detect the outcome of infant regurgitation among
year of life, accounting for 25% of the appointments
Egyptian infants diagnosed by Rome criteria and
with pediatricians and other health professionals (3,4).
secondary aim was to detect the prevalence among the
The natural progression of reflux in infants is
surveyed population.
between birth and 4 months of age (5). Then usually
outgrow this phenomenon by their first birthday (6),
PATIENTS AND METHODS
however a small proportion (5-9%) of all infants with
This prospective cohort study included a total of
regurgitation have gastroesophageal reflux disease
280 infants with regurgitation that were diagnosed
(GERD) (5,7).
based on Rome IV criteria, visiting the General
GERD develops when GER leads to
Pediatric Outpatient Clinic, Ain Shams University
troublesome symptoms that interfere with daily
Hospitals. This study was conducted between
functioning and/or the occurrence of complications; as
December 2021 to May 2022.
discomfort/irritability - failure to thrive - feeding refusal
Legal guardians/parents were asked to fill in a
- dystonic neck posturing (Sandifer syndrome),
questionnaire to assess infant regurgitation according to
hematemesis - dysphagia/odynophagia, apnea spells -
Rome criteria and infants were included if they were
brief resolved unexplained events - asthma recurrent
1-4 months old, full term, healthy and fulfilling Rome
otitis media and recurrent pneumonia linked with
criteria for infant regurgitation defined as presence
aspiration (2). Additionally, others have added choking,
of regurgitation at least 2 times per day for at least 3
gagging, and coughing with feeds (8,9).
weeks (10).
863
Received:18/07/2022
Accepted:20/09/2022
c:\work\Jor\vol901_127
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 869-874
Assessment of Heat Stress Exposure among Outdoor
Cleansing Workers in Helwan University
Kholod Sayed Mohammad1, Sahar Ahmad Shafik2*, Mayada Taha Mahmoud1
1 Department of Community Health Department, Faculty of Nursing, Helwan University, Egypt
2 Department of Community Health Department, Faculty of Nursing, El-Fayoum University, Egypt
*Corresponding author: Sahar Ahmad Shafik, Mobile: (+20) 01062225020, ORCID: 0000-0003-3247-4823,
E-Mail: Sas19@fayoum.edu.eg
ABSTRACT
Background: Heat stress is considered a well-established phenomenon from extreme heat exposure for long time
without taking safety measures. Heat stress is determined by various symptoms, such as fatigue, nausea, vomiting,
dizziness, and giddiness. Objective: The current study aimed to assess heat stress exposure among outdoor cleansing
workers in Helwan University.
Patients and methods: Design: Descriptive research design. Sample: A convenience sample for consists of 100
outdoor cleansing workers that had been worked outdoor in Helwan University, Egypt. Setting: The study was
conducted in outdoor at Helwan University. Tools: Data were collected by two tools; the 1st tool included
demographic characteristics, workers` knowledge about heat stress, and workers` reported practice regarding heat
stress, and the 2nd tool included standardized observational checklist for heat stress risk assessment.
Results: Up to 80% of workers were exposed to sun burn and 90% of them were exposed to sun stroke in the last 12
months. Also, they had poor level of knowledge, inadequate reported practices regarding heat stress with highly
statistically significant differences between correlation of total knowledge, total reported practice and standardized
observational checklist for heat stress risk exposure. There was a highly significance correlation between workers`total
knowledge and workers` total reported practice, together with a highly significance correlation between workers` total
knowledge, workers` total reported practice and standardized observational checklist for heat stress risk exposure.
Conclusion: Continuous health education program for outdoor cleansing workers regarding prevention of heat stress
is essential.
Keywords: Heat stress, Outdoors workers, Cleansing workers.
INTRODUCTION
reaction to occupational heat stress exposure is thought
Heat stress is regarded as a well-known
to be influenced by personal factors, including age.
phenomenon that results from prolonged exposure to
According to research, older adults are less able to
excessive heat without taking appropriate precautions.
adjust to fluctuations in body temperature than
The effects of heat stress, which are considered a
younger adults, which renders them more susceptible
worldwide problem that transcends socioeconomic
to heat exhaustion. This is attributed to a number of
level, include lower worker productivity on seasonal
factors that affect their capacity to regulate their body
timeframes, incapacitation, illness, and death, and
temperature, such as decreased aerobic capacity,
weekly to sub-daily timescales. It happens when the
decreased sweating rate, decreased stroke volume,
body is unable to naturally release extra heat into the
decreased cardiac output, decreased skin blood flow,
environment and the thermal balance cannot be
as well as potential changes in body fluid distribution
maintained. In 2021, the American Conference of
and thirst perception (4).
Governmental Industrial Hygienists (ACGIH) warned
Inadequate health care, a lack of safety training
employees that they shouldn't be allowed to operate in
regarding the use of semipermeable or impermeable
hot surroundings if their interior temperature is more
protective clothing, poor supervision, limited access to
than 38 °C (1).
cooling techniques and hydration supplies, inadequate
There has been prior research linking working
on-site restroom and resting facilities, a lack of rest
people's exposure to hot environments to heat-related
periods, and productivity incentives are organizational
health effects such respiratory, heart, and renal
factors that may increase the risk of occupational heat
illnesses. Even in healthy people, heat stress has the
stress (piece-rate pay, or payment per amount of work
potential to produce acute kidney damage through
done). Other variables include social/economic ones
volume depletion. Numerous heat-related symptoms,
including low levels of education and decreased
including exhaustion, headaches, muscle cramps,
knowledge, poverty and low incomes, a lack of health
weakness,
nausea,
vomiting,
tachycardia,
insurance, subpar housing, and a lack of job
hyperventilation, and chest pain that may be mild or
opportunities. Conditions related to the job, such as
severe depending on severity, ataxia, hypotension,
extreme temperatures, a lack of shade or air
syncope, and momentary changes in mental status, can
conditioning, exposure with nephrotoxins, and hard
all be signs of heat stress (2,3).
exercise while assuming the wrong posture. Climate
It is well known that depending on individual
elements include droughts, heat waves, high humidity,
circumstances, outdoor workers' tolerance or reaction
and rising temperatures (5).
to heat exposure varies. An individual's physiological
869
Received: 03/08/2022
Accepted: 04/10/2022
c:\work\Jor\vol901_128
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 875-878
Role of Topical Brimonidine in The Treatment of
Dermatological Diseases: Review Article
Heba Hassan Ali Muhammad*, Manal Mohamed Elsayed, Mohamed Ibrahim Elghareeb
Department of 1Dermatology, Venereology and Andrology, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Heba Hassan Ali Muhammad, Mobile: (+20) 0115 308 9855, E-Mail: dr.hebahassan91@gmail.com
ABSTRACT
Background: Topical Brimonidine is approved by FDA for the treatment of rosacea-associated erythema. It has anti-
inflammatory action, in additional to its vasoconstrictive activity, it preventes leucocyte recruitment via inhibition of
transendothelial cells migration. Briominidine has been studied for many indications rather than rosacea with positive
results. Objective: Review of the literature on the effectiveness of topical brimonidine in the treatment of various
dermatological diseases.
Methods: A comprehensive search was conducted in PubMed, Google Scholar, and Science Direct for information
on Topical Brimonidine dermatological diseases. However, only the most current or comprehensive study from May
2011 to November 2022 was considered. The authors also assessed references from pertinent literature. Documents
in languages other than English have been disregarded since there are not enough resources for translation.
Unpublished manuscripts, oral presentations, conference abstracts, and dissertations were examples of papers that
were not considered to be serious scientific research.
Results: Mild, temporary skin-related adverse effects have been reported with 0.33 percent brimonidine topical gel.
Maximum erythema reduction may occur 36 hours after application, while some patients report seeing results as
early as 30 minutes. Conclusion: Combination therapy with brimonidine gel and other treatments for face papules
and pustules is safe and does not enhance the risk of adverse outcomes.
Keywords: Topical Brimonidine, Seborrehic Dermatitis, Combined Therapy.
INTRODUCTION
of participants in the two pivotal studies lasting one
Rosacea is a chronic skin disorder that causes
month and up to nine point one percent of participants
redness, dilated blood vessels, papules, pustules,
in the long-term safety study lasting one year reported
phymatous changes, and sometimes even eye
an increase in the severity of their erythema and/or
involvement. Common signs and symptoms are
flushing (3).
divided into four categories by the National Rosacea
Rosacea patients with moderate to severe
Society (NRS) Expert Committee in 2002:
erythema had an optimal dosing regimen of
erythematotelangiectatic
(ETR),
papulopustular
brimonidine that was identified after two randomized,
(PPR), phymatous (PHY), and ocular (1).
double-blind, vehicle-controlled investigations were
Rosacea causes face redness in more than 40
conducted. The effectiveness of three different topical
million people throughout the world. The NRS
brimonidine gel doses was studied. For 12 hours,
estimates that 16 million American adults have rosacea
brimonidine was able to significantly reduce the
symptoms at some point in their lives. It is believed
redness. At 0.5% concentration, researchers saw the
that the incidence of rosacea is on the rise in the United
most benefit; it was also well tolerated (4).
States, but this may be due to the country's ageing
The FDA has approved BT for topical use in the
population (1).
treatment of erythema associated with rosacea (5).
Facial erythema, papules, and pustules are just
The objective of the current study was to review
some of the symptoms that can appear at the same
the effectiveness of topical brimonidine in the
time, making rosacea treatment more complicated. The
treatment of various dermatological diseases.
best results for a patient with several rosacea
A comprehensive search was conducted in
symptoms can be achieved with a multimodal
PubMed, Google Scholar, and Science Direct for
approach (2).
information on Topical Brimonidine dermatological
In order to decrease vasodilation and edema,
diseases. However, only the most current or
brimonidine, a highly selective alpha 2 agonist, binds
comprehensive study from May 2011 to November
to alpha 2 receptors on the vasculature and induces
2022 was considered. The authors also assessed
direct vasoconstriction of both small arteries and veins.
references from pertinent literature. Documents in
With this review, we hope to sum up the research on
languages other than English have been disregarded
brimonidine topical gel for the treatment of rosacea-
since there are not enough resources for translation.
related facial erythema in terms of its safety,
Unpublished
manuscripts,
oral
presentations,
effectiveness, and patient acceptability (3).
conference abstracts, and dissertations were examples
Clinical investigations with brimonidine tartrate
of papers that were not considered to be serious
(BT) found it to be effective and safe for the treatment
scientific research.
of facial erythema associated with rosacea for up to 1
Mechanism of action of Brimonidine:
year, with a rapid onset. Three percent to seven percent
875
Received: 25/07/2022
Accepted: 27/09/2022
c:\work\Jor\vol901_129
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 879-886
Hysteroscopy in the Evaluation of Recurrent First Trimesteric Miscarriages
Ahmed M. Abd El-Hamed*, Abd El-Mageed I. Abd El-Mageed,
Wasan Y. Alsaleem, Mohammed M. Al-Sherbiny
Department of Obstetrics and Gynecology, Faculty of Medicine, Ain Shams University, Cairo, Egypt
*Corresponding author: Ahmed Mohamed Abd El-Hamed, Mobile: (+20) 01095919811,
E-Mail: research.sh.2022@gmail.com
ABSTRACT
Background: Recurrent pregnancy loss (RPL) is one of the most painful and difficult areas of reproductive medicine
since the explanation is often unknown. RPL is caused by uterine factors (both acquired and congenital). Hysteroscopy
is the gold standard for evaluating the endometrial cavity because it allows direct sight of the endometrium.
Objective: This study aimed to evaluate the role of hysteroscopy in the assessment of cases with recurrent first
trimesteric miscarriage.
Methods: This prospective cohort study was conducted on 164 women with recurrent first trimesteric miscarriages,
who were referred to Early Cancer Detection Unit (ECDU) to undergo diagnostic hysteroscopy for various complaints.
Women were asked to attend postmenstrual within 3-6 months following abortion. Hysteroscopy was done under local
anesthesia. Before operation, all cases were subjected to full history taking, clinical examination and laboratory
investigations as random blood glucose level, serum thyroid stimulating hormone (TSH), serum prolactin,
anticardiolipin (IgG, IgM), follicle-stimulating hormone (FSH) and luteinizing hormone (LH).
Results: Abnormal hysteroscopic study was found in 53.0% of cases with recurrent first trimesteric miscarriages.
Acquired uterine abnormalities were found in 27.4% of cases and it was more common than congenital uterine
anomalies that were found in 25.6% of cases. The most common congenital uterine anomaly was uterine septum that
was found in 20% of cases, while the most common acquired abnormality was uterine polyp (s) that was found in 11%
of cases. 20% of these anatomical abnormalities were corrected hysteroscopically.
Conclusion: Hysteroscopy is safe, sensitive and reliable tool of diagnosis and could be performed at outpatient bases
without anesthesia.
Keywords: Hysteroscopy, Pregnancy loss, Recurrent first trimesteric miscarriages.
INTRODUCTION
adhesion) or congenital (such as Mullerian anomalies)
When a pregnancy spontaneously ends three times
(5). Eight to ten percent of women who experience
in a row, either before 20 weeks of pregnancy or before
recurrent miscarriage have Mullerian defects, with
the foetus weighs 500 g, the condition is known as
uterine septum being the most frequent. The majority
recurrent miscarriage (1). Recurrent pregnancy loss has
of the flaws can be fixed (6).
a significant impact on a couple's psycho-social status.
High rates of conception are reported following
Recurrent pregnancy losses can occur in up to 3% of
hysteroscopic metroplasty in septate uteri or
women, and in about 50% of those cases, the
hysteroscopic cutting of intrauterine adhesion, with a
underlying cause is idiopathic (2).
postoperative conception rate of 87% (7). This work
The aetiology of recurrent pregnancy loss can be
aimed to evaluate the role of hysteroscopy in the
divided into potentially treatable and currently
assessment of cases with recurrent first trimesteric
untreatable etiologies based on their treatment
miscarriage.
potential. There are several possibly curable causes,
including structural flaws, endocrine issues (luteal
PATIENTS AND METHODS
phase
deficiency),
thrombotic
pregnancies
This prospective cohort study was carried out on
(thrombophilia or autoantibodies), and immunological
164 women with recurrent (3 or more), first trimester
issues
(immunoglobulins
and
immunization).
miscarriage planned to undergo office (diagnostic)
Idiopathic etiologies and genetic anomalies are the
hysteroscopy to assess the uterine cavity. They
situations that are now incurable (3).
attended to Ain shams University Maternity Hospital
Hysteroscopy is quite helpful in interpreting
Early Cancer Detection Unit through the period from
ambiguous results from other diagnostic modalities.
July 2018 to December 2018.
Additionally, it improves accuracy in the evaluation of
intrauterine anomalies and allows direct visualisation
Inclusion criteria: Women with normal transvaginal
of the cervical canal and uterine cavity (4).
ultrasound scan, lupus anticoagulants, anticardiolepin
Uterine malformations can be acquired (such as
antibodies, complete blood count, sedimentation rate,
submucous myomas, endometrial polyps, and
progesterone level in the luteal phase were enrolled in
879
Received: 25/07/2022
Accepted: 27/09/2022
c:\work\Jor\vol901_130
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 887-893
Novel Study of the Effect of Bilobetein Compound and Silver Nano Particles of
Ginkgo Biloba as Folate Antagonists by Inhibiting Enzyme Dihydrofolate
Reductase in Iraqi Patients Serum of Small Cell and Adenocarcinoma Lung Cancer
Hiba J. Hussein and Nijoud F. Yousif AL-Saarag
Department of Chemistry / Biochemistry Laboratory, College of Education for Pure Science,
Ibn Al-Haitham,University of Baghdad, Iraq
Corresponding author: Nijoud F. Yousif AL-Saarag, Email: nijud.f.y@ihcoedu.uobaghdad.edu.iq, Mobile: +9647905158320
ABSTRACT
Background: The most common and deadly cancers are lung cancer. There are no symptoms or indicators in its early
stages. In study silver nanoparticles of Ginkgo biloba herb were synthesized and prepared solutions of different
concentration of this nanoparticles compound, solution of different concentrations of the bilobetein compound which is
the main compound in the ginkgo biloba herb.
Objective: The purpose of this study was to prepare silver nanoparticles of ginkgo biloba herb and to study the effect of
this compound at different concentration as an antifolate, through its reduction of the enzyme DHFR concentration
Patient and Methods: This study was divided into three groups as following: thirty samples of blood serum from men
and women as a control group with age range 23-45 years, thirty samples of blood serum from men and women of small
cell lung cancer patients with age range 45-80 years and finally, thirty samples of blood serum from men and women of
adenocarcinoma lung cancer patients with age range 45-80 years.
Results: The 4 ppm concentration of the nanoparticles solution gave the best reduction in enzyme concentration in patients
of small cell and adenocarcinoma lung cancer compared to control (465.94 ± 238.74 and 700.09 ± 324.59 vs 1680.38 ±
345.51 pg/ml). 8 ppm concentration showed reduction of enzyme concentration in small cell and adenocarcinoma lung
cancer compared to control of 586.62 ± 225.57 and 1131.23 ± 415.33 vs 1860.06 ± 163.22 pg/ml.
Conclusion: This study concluded the bilobetein and silver nanoparticle of Ginkgo biloba had the ability in preventing
growth of cancer cells by reducing the DHFR concentration in sera of small and adenocarcinoma lung cancer patients.
Keywords: Lung cancer, DHFR, Bilobetein, GinkgoBiloba.
INTRODUCTION
Dihydrofolate reductase (DHFR) (EC 1.5.1.3) is a
Cancer is a fatal illness in which normal body cell
vital enzyme in biochemistry and pharmaceutical
proliferation is constrained and aberrant alterations
science (9). The importance of this family of drugs is
occur at an uncontrolled rate (1). At this time, lung cancer
shown by the fact that dihydrofolate reductase inhibitors
in the globe, accounts for 23% of all cancer-related
are utilized as antibacterial, antimalarial, antifungal, and
fatalities (2, 3). Squamous-cell lung cancer (15 %20 %)
anticancer drugs.? The maintenance of tetrahydrofolate
together with non-small cell lung cancer are the most
(THF) and its derivatives, which results in the production
common kinds of lung (NSCLC, 80%85%). Primary
of purine and thymidylates, is regulated by DHFR, which
lung cancer is mostly treated clinically by chemotherapy,
is essential for healthy cellular development and
surgery, and radiation (4, 5).
proliferation (10). The folate pathway, which uses the
An ancient plant species known as ginkgo biloba is
enzyme dihydrofolate reductase (DHFR) to catalyze the
regarded to have a number of health advantages for
conversion of dihydrofolate to tetrahydrofolate utilizing
living things (6). It is chemically diverse and includes a
NADPH- a crucial cofactor for the manufacture of
lot of bioactive components. Ginkgo biloba has been
purines, thymidylate, and a number of amino acids- has
shown to have a wide range of therapeutic and
been a key target in the fight against cancer (11). The
pharmacological properties, including anticancer,
success of antifolate drugs used to treat cancer by
antidementia, antidiabetic, antiobesity, antilipidemic,
blocking DHFR, so depleting THF and decreasing DNA
antimicrobial, antioxidant, antilipid peroxidation,
synthesis and cell proliferation, highlights the
antiplatelet,
anti-inflammatory,
hepatoprotective,
significance of this response (12).
antidepressant,
antiaging,
immunomodulatory,
In the past, methotrexate (MTX) has been used to
antihypertensive, and neuroprotective effects (7).
target the folate metabolic pathway and is a crucial part
Bilobetin, a naturally occurring chemical obtained
of the therapy of cancer, including lung, breast, head and
from Ginkgo biloba, has a wide range of
neck, and osteosarcoma. Inhibiting de novo pyrimidine
pharmacological actions, including those related to anti-
and purine production, which leads to cell death, is how
oxidation, anti-cancer, antibacterial, antifungal, anti-
anti-folate medicines combat folate-dependent enzymes.
inflammatory, antiviral, and promoting osteoblast
MTX is now utilized in chemotherapy (13). The purpose
formation (8).
of this study was to prepare silver nanoparticles of
887
Received: 19/09/2022
Accepted: 26/11/2022
c:\work\Jor\vol901_131
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 894-900
Serum Vitamin D Deficiency in Idiopathic Preterm Labor: Case Control Study
Ahmed M. Zeinhom1, Ahmed F. Kamal*2, Mohamed H. Mostafa1, Mai Magdy Abdel Wahed3, Laila A. Farid1
1Department of Obstetrics and Gynecology, Faculty of Medicine, Ain Shams University, Cairo, Egypt
2Department of Obstetrics and Gynecology, Al Fayoum General Hospital, Egypt
3Department of Clinical and Chemical Pathology, National Research Center (NRC), Giza, Egypt
*Corresponding author: Ahmed Fouad Mohamed Kamal, Mobile: (+20) 01222148471, E-Mail: drfouad8585@gmail.com
ABSTRACT
Background: Preterm labor (PTL) is the most common cause of neonatal death worldwide. In Egypt, the average rate
of preterm labor is estimated to be 14.7%. Objective: This study aimed to evaluate the relation between maternal
vitamin D deficiency and idiopathic preterm birth.
Patients and Methods: This case-control study was conducted on 160 pregnant women; 80 women with PTL as cases
and another 80 women with term birth as controls, who were admitted to the Obstetrics and Gynecology Department
in Ain Shams University Maternity Hospital.
Results: Using ROC curve, serum 25(OH) D level 32 ng/ml was significantly associated with PTL (p = 0.001), with
moderate sensitivity of 80% and low specificity of 47.5%.
Conclusion: Preterm delivery was significantly associated with vitamin D 32.0 ng/ml. Although serum 25(OH) D
deficiency is a significant risk factor, but it cannot be considered a diagnostic tool in predicting PTL.
Keywords: Preterm labor, Vitamin D deficiency, Pregnant women.
INTRODUCTION
production of inflammatory cytokines that contribute
Every year, 15 millions of infants are born
to spontaneous preterm delivery, such as tumour
preterm, worldwide (1). Unknown factors that increase
necrosis factor-alpha (TNF- ) and Interleukin-1, 6
the chance of spontaneous preterm labour include low
(IL-1, 6) (10). Additionally, several research revealed
socioeconomic status, little education, genitourinary
that pregnant women with vitamin D deficiency
infections,
numerous
pregnancies,
cervical
produced more inflammatory cytokines like TNF-
incompetence, intense manual labour, prior abortion,
(11). In order to preserve myometrial quiescence,
and prior preterm labour (2).
vitamin D may also lower the chance of premature
Some studies stated that intra-amniotic microbial
delivery (10).
infections or inflammation and premature cervical
Preeclampsia, gestational diabetes, preterm
changes are the most important causes of preterm
delivery, intrauterine growth restriction, spontaneous
labor. The mechanism of preterm labor may be due to
abortion, caesarean section, maternal depressive
complement activation caused by micro-organisms
symptoms, and low birth weight babies are just a few
invasion (3).
of the harmful outcomes for mothers and their unborn
Due to changes in the vagina's microbial habitat
children that have been linked to vitamin D deficiency
during pregnancy, ascending vaginal or cervical
in numerous studies (12). However, other research has
infections are believed to be the primary cause of the
not discovered a connection between low vitamin D
majority of intra-amniotic infections (4).
level and preterm labour or premature membrane
Maintaining appropriate blood levels of calcium
rupture (13).
and phosphate, which are necessary for bone
mineralization, muscle contraction, nervous system
PATIENTS AND METHODS
activity, and cellular function, is facilitated by vitamin
This case-control study was conducted on 160
D (5). Additionally, vitamin D has potent immuno-
pregnant women who were admitted to the Obstetrics
modulating characteristics that may support the
and Gynecology Department in Ain Shams University
development of a healthy maternal immune response
Maternity Hospital during the period from December
to the placenta. Studies examined its function in
2019 to January 2021, allocated into 2 groups:
ensuring normal placenta implantation by controlling
- Cases: 80 pregnant women who delivered their
particular target genes (6, 7). Vitamin D is also found to
babies between 28 weeks and 37 weeks of
have a role in production of sex steroids during
gestation (preterm labor).
pregnancy (8).
- Control: 80 pregnant women who delivered their
Vitamin D is well recognized for its antioxidant
babies at term, with no obstetric complications.
activity, immune-modulatory, anti-fibrotic and anti-
inflammatory effects, as it regulates the production and
Inclusion criteria: Primigravida women aged between
function of cytokines, neutrophil degranulation
20 and 35 years old with BMI between 5th percentile
products and antimicrobial peptides such as
and 95th percentile for age.
cathelicidin, preventing microbial invasion, reducing
Exclusion criteria: Multigravida. Rupture of
the risk of infection (9). It works by lowering the
membranes. Maternal vaginal bleeding in 1st or 2nd
894
Received: 25/07/2022
Accepted: 27/09/2022
c:\work\Jor\vol901_132
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 901-903
Impact of Physiotherapy on Vital Signs and Blood Gases in COVID-19 Patients
Marwa Elhelali Elsherbeni1*, Saad Elsayed Flefil2, May Elsherbiny Badr3, Mona Elhelaly Elsherbeny4
1 Department of Physical Therapy for Internal Medicine and Geriatrics,
Faculty of Physical Therapy, Horus University, Egypt
2 Department of Topical Medicine, 3 Department of Anesthesiology, Surgical and Pain Management, 4 Department of
Medical Biochemistry and Molecular Biology, Faculty of Faculty of Medicine, Mansoura University, Egypt
*Corresponding author: Marwa Elhelali Elsherbeni, Mobile: (+20) 01100031764, E-Mail: marwahelali@ymail.com
ABSTRACT
Background: The severe acute respiratory syndrome (SARS), the Middle East respiratory syndrome, and the common
cold are all diseases that can be brought on by the coronavirus family of viruses (MERS). A disease epidemic that began
in China was linked to a novel coronavirus in 2019. A person's quality of life is impacted by Corona Virus Disease 2019
(COVID-19), which also raises the rate of morbidity and mortality. The chance of developing a major disease from
COVID-19 rises with age in older adults. A major sickness may be more likely to strike those who already have
underlying medical issues.
Objectives: The purpose of the current study is to objectively evaluate the effect of physiotherapy therapy on COVID-
19 patients.
Patients and methods: A total of 60 COVID-19 patients were included, with ages ranging from 4655 years, and were
divided into two age-and-sex-matched groups. They were divided into two groups; A and B (intervention and control),
of an equal number of patients, each 30. Both groups received their COVID-19 medical treatment. In addition, group A
received a physiotherapy protocol, 3 times per week for 2 weeks as a total period of treatment. Vital signs and blood
gases were measured before and after the study. Results: There was a statistically significantly higher post-intervention
O2 saturation and PaO2 in group A vs. group B, and a statistically significantly higher post-intervention PaCO2 in group
B vs. group A. There was no statistically significant difference in all other parameters (systolic blood pressure, diastolic
blood pressure, HCO3, PH, heart rate, or respiratory rate).
Conclusion: For COVID-19 patients, the physiotherapy therapy PT protocol is an effective, noninvasive, and safe
method.
Keywords: COVID-19, Physiotherapy therapy, Blood gases, Vital signs.
INTRODUCTION
cytokine storm, and with early detection comes early
Hospitalizations for pneumonia with multi-organ
care that can save many lives (5).
illness brought on by the coronavirus disease 2019
(COVID-19) pandemic have been reported to have
Due to the persistent and severe inflammation seen
increased significantly over night (1). Due to its
in COVID-19, sedentary lifestyles and inactivity are
widespread infectivity and high rate of contagion, the
associated with a higher risk of hospitalization and
disease was given the designation coronavirus disease
mortality. People are more susceptible to the most
2019 (COVID-19) by the World Health Organization (2).
severe types of COVID-19 when they have certain
Coronavirus, which is a member of the Nidovirales
diseases (6).
order of the Coronaviridae family, is divided into four
Many evidence-based care strategies for chronic
genera: -, -, -, and - CoV. - and - CoVs. Only
illnesses, especially those involving cardiac issues,
mammals can contract - and CoVs, yet CoVs mostly
include physical therapy as a crucial component.
infect birds. The Middle East respiratory syndrome-
Therefore, it would make sense to provide long-
related coronavirus (MERS-CoV), SARS-CoV, -
COVID-19 patients who have other chronic diseases
CoVs (229E and NL63), -CoVs (OC43 and HKU1),
physiotherapy (7).
and CoVs (229E and NL63) are among the human
Pre-post treatment aerobic capacity and
coronaviruses (5). The COVID-19-causing CoV is -
endurance, health status, dyspnea-related impairment,
CoV in the same subgenus as the SARS virus, but in a
and cardio-respiratory function all benefit with physical
distinct clade, according to the genomic and phylogenic
therapy. Additionally, all post-COVID-19 patients saw
analyses (5). The virus was identified on January 7 as a
an improvement in health status and a general decrease
CoV with >95% similarity to the bat CoV and >70% (3).
in impairment brought on by dyspnea at the 2-year
The admission oxygen saturation, respiratory rate,
follow-up (8).
glucose, and diastolic blood pressure (with/without age)
The purpose of the current study is to objectively
multivariate regression model showed promising
evaluate the effect of physiotherapy therapy on COVID-
predictive capacity and may offer a practical, affordable
19 patients.
method for early prognostication of patients admitted
with COVID-19 in resource-constrained settings (4).
PATIENTS AND METHODS
Regular arterial blood gas monitoring can aid in the
A total of 60 patients were chosen from the
early discovery of respiratory injury, silent hypoxia, and
Mansoura Chest Hospital and Mansoura University
901
Received: 25/07/2022
Accepted: 27/09/2022
c:\work\Jor\vol901_133
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 904-913
Determination of Neopterin and Biopterin in Dried Blood Spot by Tandem
Mass Spectrometry in Classic and Atypical Hyperphenylalaninemia
Nadia Salama*1, Radwa Gamal2, Osama Zaki2, Ashraf Khalil1, Manar Obada1, Gamalat El Gedawy1
1Department of Biochemistry and Molecular Diagnostics,
National Liver Institute, Menoufia University, Menoufia, Egypt
2Department of Human Genetics, Ain Shames University, Cairo, Egypt
*Corresponding author: Nadia Salama, Mobile (+20)01009711622, Email: nadia_salama2@yahoo.com
ABSTRACT
Background: Tetrahydrobiopterin is a coenzyme of phenylalanine hydroxylase and other enzymes essential for the
synthesis of tyrosine and other neurotransmitters. Despite proper nutritional regulation of blood phenylalanine levels,
tetrahydrobiopterin deficiency results in progressive neurologic illness.
Objective: The study aims to optimize a mass spec-dependent assay for quantitative measurement of biopterin and
neopterin as distinctive markers of the atypical phenylketonuria due to tetrahydrobiopterin deficiency.
Patients and methods: The study enrolled 46 patients with typical hyperphenylalaninaemia, 14 atypical cases, and 50
healthy children as a control group. Quantitative measurements of biopterin, neopterin, phenylalanine, and tyrosine
were performed by ultra-performance liquid chromatography-mass spectrometry in the dried blood spots of patients
and control samples.
Results: Validation of the analytical protocol was performed at a biopterin and neopterin concentration range from 0
to 100 nmol/l. The regression coefficients for the linearity of the calibration curves exceeded 0.98. The lower limit of
detection of biopterin and neopterin ranged from 1.5 to 2.5 nmol/l. The intra-day and inter-day precision and accuracy
ranged from 96% - 105%, and from 97% - 110%. The mean recoveries were 105 ± 7% for biopterin and 106 ± 9% for
neopterin. The short and long-term stability of the stored samples was seven days at room temperature and 12 weeks
at -20 °C. Biopterin and neopterin were significantly higher in the classic group compared to the atypical and control
group (p < 0.05), with their level being in the order classic > control > atypical group. Phenylalanine levels had a
significant positive correlation with biopterin and neopterin levels in classic phenylketonuria (p < 0.05).
Conclusions: The performance of the developed assay for biopterin and neopterin in the dried blood spot by ultra-
performance liquid chromatography-mass spectrometry was accurate and precise thus, provide a legitimate diagnostic
tool for cases of atypical phenylketonuria.
Keyword: Tetrahydrobiopterin, Neopterin, Biopterin, Hyperphenylalaninemia, Liquid chromatography-mass
spectrometry.
INTRODUCTION
(plasma Phe 600-1200 mol/l), and mild PKU (plasma
Tyrosine
(tyr),
a
precursor
to
the
Phe 120-600 mol/l). About 50% of instances of PKU
neurotransmitters dopamine and norepinephrine in the
are classified as classical, 30% as moderate, and 20%
central nervous system, is in insufficient supply if
as mild. Only 2% of those with hyperphenylalaninemia
phenylalanine (Phe) cannot be converted to tyrosine
had a PAH gene mutation rather than a deficiency in
(tyr). Because of a shortage or absence of the essential
BH4 production or recycling [7].
amino acid phenylalanine (Phe), phenylketonuria
Five separate hereditary disorders that mirror
(PKU)
is
an
autosomal
recessive
illness.
PKU with increased phenylalanine levels and the
Tetrahydrobiopterin (BH4), a cofactor for the enzyme
potential for neurological damage despite early
phenylalanine hydroxylase (PAH), causes the
treatment are caused by the inability to synthesis or
condition known as atypical PKU [1].
renew the PAH cofactor BH4. Without the requirement
If PKU is not treated, it leads to gradual and
for a Phe-restricted diet, the administration of synthetic
permanent brain damage. During the first few years of
BH4 quickly returns plasma Phe levels to normal [8].
life, the brain is particularly vulnerable to the
Patients with hyperphenylalaninemia (HPA)
neurotoxic effects of increased Phe. Elevated Phe
experience a depletion of catecholamines and serotonin
disrupts brain tissue's myelination, synaptic sprouting,
because BH4 is a necessary cofactor for PAH, tyrosine-
and dendritic pruning [2]. Preventing mental retardation
3-hydroxylase, and tryptophan-5-hydroxylase in
and serious neurological consequences such seizures
addition to all three isoforms of nitric oxide synthase
and spasticity is possible with PKU screening,
(NOS), the key enzymes in the biosynthesis of
diagnosis, and therapy during the newborn period [3-6].
dopamine and serotonin [912].
The most prevalent inborn metabolic mistake,
Although sufficient dietary control of blood
PKU, is most prevalent in Ireland, Eastern Europe, and
phenylalanine levels is maintained, BH4 deficiency is
North America [1]. Based on the plasma Phe level upon
a serious condition that causes gradual neurologic
diagnosis, PKU is divided into three categories: classic
deterioration. BH4 is a possible therapeutic target for
PKU (plasma Phe >1200 mol/l), moderate PKU
904
Received: 01/08/2022
Accepted: 02/10/2022
c:\work\Jor\vol901_134
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 914-919
Prevalence of H. Pylori Infection among Patients with
Acute Myocardial Infarction
Amira K. El-Alfy1, Ahmed R. Mohamed1, Noha Abdelrazek Eldeeb*1, Ahmed Bendary2,
Asmaa A. Elfallah3, Mahmoud Rizk1
Departments of 1Internal Medicine, 2Cardiology and 3Clinical Pathology,
Faculty of Medicine, Benha University, Qalyubia, Egypt
*Corresponding author: Noha Abdelrazek Eldeeb, Mobile: (+20) 01274440453, Email: noha.eldeeb2050@gmail.com
ABSTRACT
Background: Infection with Helicobacter pylori (HP) is the most prevalent infection worldwide, particularly in
underdeveloped nations. It is reported to be associated with many extra gastrointestinal manifestations.
Objective: The current work aimed to study the prevalence of HP infection among patients with acute myocardial
infarction (AMI). Patients and Methods: This cross-sectional study included STEMI and NSTEMI patients admitted
with AMI in the CCU of the Cardiology Department at Benha University Hospital, Egypt.
Results: The prevalence of HP among the studied patients was 72%. Our study showed that those with positive HP
Ig-G had considerably lower triglycerides than those with negative HP Ig-G. No significant differences were observed
regarding hemoglobin, TLC, platelets, serum creatinine, blood urea, ALT, AST, total cholesterol, HDL, and LDL. In
patients with positive HP Ig-G, significant negative correlations were observed between ejection fraction (EF) and
blood urea, serum creatinine, and AST.
Conclusion: In this study, HP is related to the incidence of MI. The elimination of HP prevents the onset of CAD and
associated consequences.
Keywords: Prevalence, HP, Infection, Acute Myocardial Infarction.
INTRODUCTION
PATIENTS AND METHODS
Currently, the most prevalent risk factors for
This cross-sectional study included STEMI and
coronary
heart
disease
(CHD)
caused
by
NSTEMI patients admitted with AMI in the CCU of
atherosclerosis are dyslipidemia, diabetes, smoking,
the Cardiology Department at Benha University
and hypertension [1]. For many years, monocytes and
Hospital, Egypt.
macrophages have been recognized as components of
The study was done after being approved by the
atheromatous plaque. The involvement of an active
institutional ethical committee and informed consent
inflammatory process in the etiology of atherosclerosis
was obtained from all participants included.
in coronary circulation is developing rapidly [2].
The inclusion criteria were patients with age 18
The Helicobacter pylori (HP) infection is the
years old, who were admitted with acute myocardial
most prevalent infection worldwide, especially in
infarction (STEMI and NSTEMI).
underdeveloped
nations.
Other
gastrointestinal
The exclusion criteria included severe renal failure
symptoms have been linked to HP infection, according
(creatinine >2 mg/dL), anemia, hepatic failure,
to Yokota et al. [3]. Several signs point to a connection
neurological or endocrine diseases, previous HP
between persistent infections, atherosclerosis, and
infection treatment, and malignancies.
vascular disease. The prevalence of inflammation as a
cardiovascular risk factor and the existence of HP in
All participants were subjected to full history
extra-digestive illnesses motivated researchers to study
taking including [Age, gender, BMI, HTN history,
the role of HP in atherosclerosis progression. There
Stroke, Cardiac diseases and cardiac failure, DM,
was a significant incidence of active HP infection
smoking (Patients who had quit smoking for fewer
among patients with myocardial infarction, which may
than 10 years were categorized as smokers), CCU
be a modifiable risk factor for upper gastrointestinal
admission, and renal insufficiency].
bleeding [4].
Given that HP infection has emerged as a
Clinical examination including [Biochemical
potentially modifiable risk factor for UGIB and early
parameters, thorough Complete blood picture, ESR,
termination of DAPT in patients with AMI, we
CRP, Total cholesterol, LDL, HDL, TG, liver, and
believed that examining the incidence of HP infection
kidney function tests, ECG, and ECHO].
in a group of patients with AMI would be of
Trained
research
assistants
gathered
considerable interest. This might be considered a step
demographic information and the use of medicines
forward in proving the feasibility of Hp testing as part
having known effects on atherogenesis.
of the standard therapeutic therapy for AMI patients.
STEMI was defined according to the 2017 ESC
This may stimulate the continued use of DAPT, so
STEMI guidelines [6], and NSTEMI was defined
optimizing its advantages [5].The present work aimed
following the 2020 ESC guidelines [7]. The evaluation
to study the prevalence of HP Infection among patients
of a MI is comprised of three components: clinical
with acute myocardial infarction.
symptoms,
ECG
abnormalities,
and
cardiac
914
Received: 21/07/2022
Accepted: 23/09/2022
c:\work\Jor\vol901_135
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 920-927
Interaction Between Maternal Chrysin Intake and Development of
Adrenal Gland in Rat Fetus during Organogenesis
Sahar A. Sabry
Department of Biological and Geological Sciences, Faculty of Education, Ain Shams University, Cairo, Egypt
Corresponding author: Sahar A. Sabry, Mobile: (+20) 01204427241, E-Mail: sahar_ahmed@edu.asu.edu.eg
ABSTRACT
Background: Chrysin is a flavone that occurs naturally in plants and possesses antioxidant and anti-inflammatory
effects. Objective: This study was carried out to examine the effect of chrysin on the adrenal cortex of maternally
treated rat fetuses. Material and methods: Twelve pregnant rats were assigned into two groups (6 rats each). The first
group acted as a control and received a vehicle 1% w/v Tween 80 (the drug's solvent) (GDs 7-14), whereas rats of the
second group were treated orally with chrysin (50 mg/kg body weight/day) daily from day 7 till day 14 of gestation.
Animals were sacrificed, and samples of the adrenal glands were taken, processed, and prepared for the histological
and ultrastructural examination. Results: The three cortical zones, Zone glomerulosa, Zone fasciculata, and Zone
reticularis in the cells of the adrenal cortex sections from maternally treated rat foetuses showed cytoplasmic
vacuolation. Some of these cells' nuclei showed indications of karyolysis. Cortical cells had clear alterations at the
ultrastructural level, including cavitated and deformed mitochondria as well as dilated smooth and rough endoplasmic
reticular membranes. Accumulation of lipid droplets and lysosomes was seen in the vacuolated cytoplasm. These cells'
nuclei had karyolysis visible. Conclusion: It appears that oral administration of chrysin caused damaging effects on
adrenocortical cells of maternally treated rat fetuses. Therefore, it should be taken into mind and viewed with great
worry that chrysin, although one of the flavonoids, should be utilized with caution during pregnancy.
Keywords: Fetus, Estrogen, Adrenal cortex, Chrysin, Histology, Ultrastructure.
INTRODUCTION
their fetuses; nevertheless, antioxidants may harm the
Plant flavonoids have recently piqued both scientif
fetuses.
ic and public attention due to claims that they provide
The adrenal cortex is a crucial mammalian
health benefits (1). Chrysin is a naturally occurring
endocrine organ that produces a variety of hormones.
flavone that is frequently present in plants. Its anti-
Pregnancy must be maintained to encourage fetal
inflammatory and antioxidant properties have been
growth and nervous system development (10).
researched (2).
Additionally, it is crucial for the fetus's growth and
Most research indicated that chrysin inhibits
development after delivery. The adrenal cortex's
aromatase activity. Aromatase, also known as
improper functional growth will result in an abnormal
cytochrome P450, had a significant influence on cell
production of steroid hormones, which will lead to the
growth and the cell cycle and allowed for the
development of associated disorders (11).
production of excess estrogens from testosterone.
Despite the previously mentioned therapeutic
Because of their enhanced protein stability and lower
benefits of chrysin, the developmental period at which
bioavailability, chrysin solid lipid nanoparticles allow
exposure takes place is a significant matter; for
for long-term therapeutic delivery (3). According to a
example, its usage during pregnancy is an important
study by Balta et al. (4) chrysin has a therapeutic
subject that requires further investigation. So, the study
impact on liver fibrosis brought on by carbon tetra
tried to illustrate whether the beneficial impacts of
chloride (CCl4). Also, Chrysin has high bioavailability
chrysin as proven in adults extend to fetuses or not by
in the low gastrointestinal tract so it is effective in
focusing on the embryonic development of one of the
treating conditions affecting the ileum and colon such
most essential organs, the adrenal glands of the
as cancer and local infections (5). Chrysin not only
fetuses. To our best knowledge, there were scarce
provides a defense against interstitial fibrosis and renal
studies that demonstrated the possible harmful effects
impairments brought on by Cyclosporine A (CsA) (6),
of chrysin exposure during pregnancy. Therefore, this
but also inhibits D-gal-induced oxidative stress,
investigation aimed to explore the potential
inflammation, apoptosis, and ovarian damage (7),
undesirable outcomes of chrysin exposure during
suggesting that chrysin may play a role in the
pregnancy on the histological and ultrastructural
prevention of premature ovarian failure.
characteristics of the adrenal gland of maternally
Physiological changes during pregnancy, along
treated rat fetuses.
with the demands of a growing human fetus, such as
increased metabolic demands, and lack of essential
MATERIALS AND METHODS
vitamins and minerals might be harmful to both
Mature Wistar albino rats (Rattus norvegicus) utilized
parties' health (8). There is a strong correlation between
in this study were obtained from Theodor Bilharz
maternal malnutrition and the mortality and morbidity
Research Institute (TBRI), Imbaba, Giza, A.R. Egypt.
of fetuses (9). Pregnant women may turn to consume
The Wistar rats were 150160 g in weight on average.
nutritional supplements, vitamins, and antioxidants in
Males and females were maintained in separate plastic
an attempt to enhance their health and the health of
cages, each containing two rats, to avoid
overpopulation. They were kept in the laboratory for
920
Received: 21/07/2022
Accepted: 23/09/2022
c:\work\Jor\vol901_136
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 928-936
Study on The Bioactive Components of Atriplex halimus L. and Evaluation of
Their Anticancer Effect on Liver Cancer Cells
Ali Hasanain Alhamadani 1 , Enas abdul Kareem jabbar 2 , Alla N.Al-Waheeb 1
1 Department of Biology, College of Science, University of Thi-Qar, Thi-Qar, Iraq.
2 Basic Medical Science, College of Nursing, University of Thi-Qar, Thi-Qar, Iraq.
Corresponding author: Ali Hasanain Alhamadani, E-mails: Ali.hasanen@mu.edu.iq
Mobile: 009647813318533 , ORCID ID: 0000-0002-9704-7862
ABSTRACT
Background: Liver cancer is one of the most prevalent and fatal malignancies in the human digestive system, killing
over 500,000 people each year worldwide.
Aim of the work: This study was to analyze for the first time the phytochemical composition of Atriplex halimus L.
by High-Performance Liquid Chromatography technique and to evaluate its anticancer activity on primary cell culture
of human liver carcinoma by MTT assay and compared it with a chemotherapy drug.
Method: Cancer cells were treated with a concentration of AHE, Cisplatin, and a combination of them. Also, cell
viability and morphological changes, Superoxide Dismutase, and Catalase enzyme activity were measured.
Results: The results showed two types of flavonols, quercetin, and kaempferol identified. The MTT assay shows the
highest cytotoxicity on cancer cells at concentrations of 100 and 200 µg/ml for all treatments. Superoxide dismutase
enzyme showed an increased level (P = 0.001) while catalase enzyme showed decreased level (P = 0.032) in treated
cells compared to the untreated cell.
Conclusion: Our findings suggest that A. halimus possesses antioxidant and anticancer properties, which are possibly
due to flavonoids existing in this plant, and could be a potential candidate for the development of drugs for the
management of liver cancer cells.
Keywords: Atriplex halimus, Liver Cancer cell, HPLC, SOD, Catalase.
INTRODUCTION
Some studies highlight the cytotoxic activity
The liver is the largest glandular organ that
of the methanolic extract of A. halimus, which had an
performs several crucial functions to keep the body
antiproliferative effect and was highly cytotoxic on
free from toxins and harmful substances. (1,2)
cell lines (MCF-7) and (HepG2) Neima and Abou-
75% of occurrences of liver cancer globally
Eisha (10). On the other hand, this extract did not
are of the most frequent kind, hepatocellular
impair the proliferation of normal cell lines.
carcinoma (HCC). The second leading cause of cancer
Numerous studies have found plant species utilized in
death worldwide and the seventh most prevalent
traditional medicine in developing nations that have
cancer overall is primary liver cancer Ferlay et al. (3) .
shown anticancer effects .(11,12,13,14)
Asia and Africa have the highest rates of incidence in
The present study is a novel study of
the world. China has the most cases due to a high rate
phytochemical analysis of A. halimus by HPLC
(18.3 per 100,000) and the largest population in the
technique to evaluate its cytotoxic effect on the
world, However, Mongolia has the highest incidence
primary cell culture of human liver carcinoma and
of liver cancer at 93.7 per 100,000 people (4).
assess the anticancer activity of A. halimus extract.
Chemotherapy and radiotherapy are among
the current treatments. Chemotherapy can put patients
MATERIALS AND METHODS
under a lot of stress and damage their health. As a
Plant Collection and Extraction
result, there is a focus on using alternative cancer
Fresh plants of Atriplex halimus L. were
treatments and therapies. (5)
collected as a whole plant in April 2022 from the west
Atriplex halimus is a perennial shrub that is
of Al-Samawa City, Iraq. The plant was identified in
halophytic and thrives in dry and semi-arid climates.
the Biology Department, Thi-Qar University, Iraq.
It is an excellent species for landscaping in arid and
The Powder of the whole plant (50gm) was macerated
salt-affected areas because of its resilience to severe
with 250 ml of 80 % methanol using an ultrasonic
salinity and drought, where it provides valuable feed
extractor (20 kHz, power 100w) for 30 min, followed
for livestock. Heuzé et al. (6) , OEP (7). It can grow
by putting it in a shaker incubator for 24 hours at room
from Europe to Northern Africa, western Asia, and W.
temperature.
Iraq and the NE, as well as the Arabian Peninsula
Flavonoids Isolation from A. halimus
Ghazanfar (8). Depending on how well it has adapted
The methanol soluble fraction (Fr I) was then
to the extreme climatic conditions through
extracted with second fractionation (Fr II) by adding
morphological, anatomical, and physiological
an equal volume of hexane (100 ml) to the methanol
changes. The leaves of the plant are used by native
extract and shaking it in a Buchner funnel for four
herbalists in Arabic countries to cure rheumatism,
hours. However, the lower layer of the solvent was
diabetes, and heart conditions Said et al. (9)
isolated, and then an equal volume (100 ml) of ethyl
928
Received: 21/07/2022
Accepted: 23/09/2022
c:\work\Jor\vol901_137
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 937-942
Detection of Main Barriers for Adverse Drug Reactions Reporting in
The Middle East Countries: Review article
Mohammed Mahdi H. Abdul Hussein*, Jubran K. Hassan
Department of Clinical Pharmacy, College of Pharmacy, University of Basrah, Iraq
*Corresponding author: Mohammed Mahdi H. Abdul Hussein, Mobile: 009647725579153, E-mail: smmh91@gmail.com
ABSTRACT
Background: For years, specialists have been interested on the verge of documentation of adverse drug reactions
because of its great importance. The countries of the Middle East have also kept pace with this mission and developed
in the past years. Like any other project, this documentation process is accompanied by several problems that will
negatively affect the objectives set in this area.
Objective: The aim of the current study is to know the main barriers regarding the process of adverse drug reactions in
the Middle East area.
Patients and methods: In October 2022, a manual search of the literary databases PubMed and Google Scholar has
done. The 102 articles were manually screened. Studies that have been published between 2012 and 2022 were eligible.
Results: From the 102 publications that underwent manual screening, 26 research articles from 12 different countries
qualified for inclusion in the study. Lack of enthusiasm, a professional atmosphere for the conduct of
pharmacovigilance, a general lack of knowledge and awareness concerning pharmacovigilance and not enough time for
reporting are the main barriers for adverse drug reactions.
Conclusion: According to the results, the lack of knowledge or awareness of pharmacovigilance practices and the
absence of mechanisms that assist recording in terms of enough time, motivation, or the environment as a whole are the
two most significant causes of underreporting.
Keywords: Adverse drug reaction, Barriers, Pharmacovigilance, health care providers, Review, University of Basrah.
INTRODUCTION
as a result of the numerous evident morbidities and the
The use of medicines is an inextricable part of human
deaths they produce. If pharmacists and other healthcare
life and we see clearly with the development of new
workers pay great attention to the information on the
diseases and health problems, the indications for the use
side effects of the medications given to patients, we can
of medicines have become more important and besides,
prevent ADRs. Understanding ADRs helps reduce the
the use and discovery of therapeutic substances to be in
irrational usage of unsuitable medication. Consequently,
line with the need of humans to fight these diseases.
there is a critical need to raise pharmacists' and
Accordingly, with the widespread use of medicines in
prescribers' understanding of ADRs and medication
the world, also there has been a proliferation of adverse
monitoring Omer et al. (4).
drug reactions (ADRs) associated with the use of those
Healthcare providers need to be particularly aware of
drugs. World Health Organization (WHO) has provided
pharmacovigilance. Pharmacy and medicine students
a definition of ADR, which is as follows: "a negative,
must get thorough instruction on how to recognize,
unanticipated reaction to a medicine that happens at
avoid, and report ADRs. The healthcare providers'
dosages typically used in humans for illness prevention,
undergraduate training is the ideal period to increase
diagnosis, treatment, or altering physiological function".
their
understanding
of
and
aptitude
for
Edwards (1).
pharmacovigilance Omer et al. (5).
The term of pharmacovigilance (PV) is another
The under-reporting of ADRs by them, however, is
important concept has taken a documented association
a concern in many nations, including the middle-east
with the ADRs since years ago and it is mean: "the
nations. Lack of awareness and expertise of methods to
science and actions related to the evaluation, detection,
recognize and report ADRs may be used to explain this.
comprehension, and prevention of negative drug-related
The aim of the current study is to know the main barriers
effects or any other issues Adheed et al. (2).
regarding the process of adverse drug reactions in the
Due to the importance of the topic, the study of PV
Middle East area.
at the levels of knowledge, attitude and practice is very
useful. To find out more about the importance of
PATIENTS AND METHODS
documentation of adverse drug reactions it is enough to
Search protocol
know that ADRs appear in 10% of outpatients, causing
A manual search was conducted on the literature
approximately 5-10% to be admitted to hospital
databases PubMed and Google Scholar in October 2022,
Aljadhey et al. (3).
using
following
key
terms
and
sentences:
ADRs are regularly seen in the routine operations of
Pharmacovigilance, adverse drug reaction, adverse drug
pharmacies and hospitals, both privately and publicly
reactions, barriers, marries to pharmacovigilance,
held. The healthcare system faces financial difficulties
Middle East.
937
Received: 21/7/2022
Accepted: 23/9/2022
c:\work\Jor\vol901_138
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 943-947
The Association of Leptin Levels in Iraqi Women with
Newly Diagnosed Thyroid Dysfunction
1 Haider Ridha Mohammed Saeed, 1 Sura A.Abdulsattar, 2 Abdilkarim Y.Al-Samarriae
1 Mustansiriyah University/ College of Medicine /Department of chemistry and Biochemistry
2 National Diabetic Center for Treatment and Research/Mustansiriyah University.
Corresponding authorl: Haider Ridha Mohammed Saeed
Email: haidersaeed@uomustansiriyah.edu.iq. Phone: +9647712321428
ABSTRACT
Background: Leptin changes were observed in thyroid dysfunction patients, yet the evidence is inconsistent.
Objective: This study aimed to find the correlation between leptin and thyroid hormone with lipid profile in Iraqi
women who have recently been diagnosed with thyroid dysfunction.
Subjects and Methods: A case-control study that was conducted at Chemistry and Biochemistry department, Medicine
College in cooperation with National Diabetes Center (NDC), Mustansiriyah University during the period from January
2021 to February 2022. One hundred thirty two (132) samples were included in this study. All participants were women
and aged between (21-54) years. They were divided into three groups: (44) subjects served as a control group, (44)
patients with newly diagnosed hyperthyroidism and (44) patients with newly diagnosed hypothyroidism.
Results: The levels of serum leptin have been elevated in the patients who have newly diagnosed hypothyroidism (p
0.001) and declined in patients that had newly diagnosed hyperthyroidism (p 0.0010) when compared to control group.
Patients with hyperthyroidism had low levels of triglycerides, cholesterol, high density lipoprotein, very low density
lipoprotein and low density lipoprotein, while patients with hypothyroidism had high levels of triglycerides,
cholesterol, high density lipoprotein, very low density lipoprotein and low density lipoprotein. No correlation between
leptin and thyroid hormones with lipid profile in both hypothyroidism and hyperthyroidism. Conclusion: Leptin levels
were high in patients with hypothyroidism, while were low in hyperthyroidism. No correlation between leptin and
thyroid hormones with lipid profile.
Keywords: Hyperthyroidism, Hypothyroidism, Leptin.
INTRODUCTION
adipose tissue interchange (6). Adipose tissue function
A hypermetabolic state that is characterized by
could be affected by thyroid dysfunction, which
the increase in the expenditure of resting energy, loss
contributes to the growth of metabolic diseases.
of weight, lower levels of cholesterol, elevated
Additionally, people with thyroid dysfunction have
gluconeogenesis, and improved lipolysis, is aided by
changes in their lipolysis (7).
hyperthyroidism, a condition in which there is too much
Previous studies point to a connection between
thyroid hormone. Conversely, hypothyroidism, or low
leptin and thyroid hormones. TSH could induce leptin
levels of the thyroid hormone, has been related to the
release from adipose tissue while leptin can stimulate
hypometabolism, which is distinguished by low resting
thyroid-stimulating hormone secretion (8, 9).
energy
expenditure,
gain
of
weight, low
According to studies, hyperthyroidism patients
gluconeogenesis, elevated levels of the cholesterol, and
also have altered profiles of adipokines (such as resistin,
low lipolysis (1).
adiponectin, and leptin, among others) in addition to
Thyroid hormones and adipokines have
aberrant circulating levels of TSH and TH (10).
physiological effects in addition to glucose and lipid
Additionally, adipocytes show high numbers of
metabolism, like controlling energy expenditure (2).
TH and TSH receptors that operate similarly to thyroid
Adipokines are a diverse of biologically active
receptors, indicating that TH could play a role in
materials that are released by adipose tissue in
controlling adipocyte functions (11).
paracrine, autocrine, and endocrine processes (3).
Therefore, adipokine secretion, which contributes
Adipokines, including resistin, adiponectin, leptin, and
to lipid metabolic disorders, could be impacted by
fibroblast growth factor 21, among others, have been
thyroid dysfunction.
demonstrated to play a significant role in
Leptin elevates levels of thyroid hormone (12). It
controlling energy expenditure and lipid metabolism in
impacts on metabolism of thyroid by adipocytes; leptin
some ways (4). Leptin is a protein with 146 amino acids
and thyroid stimulating hormone had a positive
that adipocytes excrete when there is an increase in fat
association could occur due to this direct effect of TSH,
mass. It is a crucial atom in feed-in circle that controls
it might also affect thyroid- axis in acute way.
balance of energy. Leptin has two functions: it reduces
Leptin taking inverts the fasting-induced
appetite and increases fat burning by improving energy
suppression of hypothalamus pituitary- thyroid axis at
utilization (5). As adipokine that is released by the
the central level by expression of upregulating TRH in
adipose tissue, leptin regulates glucose and lipid
the hypothalamus (13). This study aimed to find the
metabolism
along
with energy
homeostasis.
correlation between leptin level and thyroid hormone
Consequently, it appears that thyroid function and
943
Received: 26/7/2022
Accepted: 28/9/2022
c:\work\Jor\vol901_139
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 948-952
Harmonic versus Cold Steel Dissection Tonsillectomy, A Comparative Study
Nawres Jawad Alshlah 1, Mohammed Fadhil Mohammed 2, Muthanna Saleem Abdulameer3
1. Imam Alsadiq general teaching hospital, Babylon, Iraq.
2. Al Najaf teaching hospital, Najaf, Iraq.
3. Hammurabi College of Medicine, University of Babylon.
Corresponding author: Nawres Jawad Alshlah, drnawrasalshalah@gmail.com,
ORCID: 0000-0002-3150-8953. Tel: 009647716229835
ABSTRACT
Background: Tonsillectomy is one of the most common operations performed in otolaryngology departments, various
techniques used for this purpose including dissection method and powered instrumentation like electrocautery, harmonic
scalpel, radiofrequency techniques, laser technique and coblation technique.
Objective: This study aimed to compare the intraoperative time, intraoperative bleeding and post. Operative pain among
patients underwent harmonic and cold steel dissection techniques.
Patients and Method: This was prospective randomized study p erformed in AL-Hilla Teaching Hospital. It included fifty
patients scheduled for tonsillectomy for chronic tonsillitis from July 2016 to October 2017. Harmonic tonsillectomy (HT)
was done on right side and traditional tonsillectomy on left side by same surgical team.
Results: Patients reported significantly less intraoperative bleeding (HT mean was 4.8 ml, while CDT mean was 64.7), less
operative time (HT mean was 4.76 min., while CDT mean was 10.1 min) and less postoperative pain (from 0,3,7 and 14
postoperative days HT means pain score were 1.68, 3.6, 1.64 and 0.65 respectively and CDT means pain score were 5.8,
4.5, 2.4 and 0.78 respectively) on the harmonic scalpel tonsillectomy side compared with the Cold steel dissection
tonsillectomy side. In the day 11 to 14 pain difference disappeared and reached plateau phase. There was no post
tonsillectomy bleeding among the 50 patients.
Conclusions: Harmonic scalpel tonsillectomy reduces discomfort, intraoperative hemorrhage, and postoperative morbidity.
Harmonic scalpel tonsillectomy is effective, although the handpiece is disposable.
Keywords: Harmonic, Cold steel, Dissection, Tonsillectomy, Comparative study.
INTRODUCTION
Infectious and inflammatory diseases of the
Neck Surgeons developed SIGN recommendations
pharynx, tonsils, and adenoids are a major cause of illness
that advocate tonsillectomy in children and adults based
and medical costs in children. Tonsillectomy and
on current information, clinical observation, and clinical
adenoidectomy are common surgeries done on children.
audit. Tonsillitis causing painful throats, a year of
Clinical research has shed light on many parts of
symptoms and sore throats that inhibit proper functioning
paediatric otolaryngology, such as the effects of
(6-8). The risks and benefits of surgery must be weighed.
adenotonsillar hypertrophy on obstructive sleep apnea
The frequency of episodes should be considered. US
and its effects, the microbiologic flora of the tonsils and
health insurance companies recognize AAO HNS
adenoids and their role in chronic adenotonsillar
guidelines. Guidelines propose tonsillectomy for children
hypertrophy, and the relationship between adenotonsillar
with 'three or more tonsil and/or adenoid infections per
hypertrophy and craniofacial growth (1). Tonsillectomy is
year despite acceptable medical care (9), tonsillectomy
a common head-and-neck treatment.
procedures constantly evolve. Before about ten years ago,
Surgery helps children with persistent sore throats.
the most common surgery was a dissection tonsillectomy,
Fewer get tonsillectomy with adenoidectomy for airway
which was first described by Edwin Pynchon in 1890. To
congestion (2). Celsus wrote in De Medicina that tonsil
stop bleeding, ties or diathermy were used. Since then,
'induration' may be eliminated with a fingernail. If this
there have been a lot of new ideas about how to use
wasn't practicable, they may be hooked and dragged out
dissection tools to reduce pain and bleeding after surgery.
using a "bistoury." Once Morrel McKenzie 2's snares and
The basic ideas behind a tonsillectomy haven't changed.
'guillotines' popularised the operation in Victorian
Current trials don't show that any of these
England. Sir Felix Semon (1849-1921) removed the
procedures is clinically better than the others, so we
tonsils of numerous of Queen Victoria's grandchildren (3-
definitely need a large multicenter trial. Before these
5). Tonsillectomy may prevent recurring acute tonsillitis,
procedures are extensively used, cost-effectiveness must
but not other sore throats. Before tonsillectomy, history
be addressed (10).
and clinical exam should confirm recurrent tonsillitis and,
Post-tonsillectomy analgesia lacks evidence. In
if possible, differentiate it from widespread pharyngitis.
multiple trials, 70% of children given postoperative
The British Association of Otolaryngologists Head and
analgesics suffered pain. Two hours preoperatively, they
948
Received: 26/07/2022
Accepted:28/09/2022
c:\work\Jor\vol901_140
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 953-956
Assessment of Serum Copper in Patients with Anemia after Bariatric Surgery
Ayman Fathy1, Esam N. Mohammed1, Aliaa A. Y. Ateya1, Samia Hussein*2
Departments of 1Internal Medicine, Hematology Unit and 2Medical Biochemistry and
Molecular Biology, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Samia Hussein, Mobile: (+20) 01062725981, E-Mail: samiahussein82@hotmail.com
ABSTRACT
Background: Bariatric surgery interferes with food absorption, which may cause deficiencies in certain elements and
complications. Copper deficiency after bariatric surgeries may be misdiagnosed, which may cause serious diseases.
Objective: The current study aimed to investigate the significance of serum copper level in the early detection of
anemia related to bariatric surgery.
Patients and methods: This study included 50 participants from both sexes divided into 25 anemic patients after
bariatric surgery and 25 healthy individuals. Full history taking and complete clinical examination were performed for
all participants. Laboratory investigations included hemoglobin (Hb) measurement, serum copper measurement, and
iron parameters including serum iron, ferritin, total iron binding capacity (TIBC), and transferrin saturation.
Results: There was a highly statistically significant decrease in Hb, serum iron, copper, and ferritin levels after
bariatric surgery while transferrin level and TIBC were significantly higher in cases than their controls (P <0.001 for
each), while transferrin level and TIBC were significantly higher after bariatric surgery compared to controls (P
<0.001 for each). There were highly statistically significant positive correlations between copper level and each of
serum hemoglobin (r= 0.726, P=0.03) and iron level (r=0.986, P <0.001), while there were significant negative
correlations between copper level and each of transferrin level (r=-0.617, P=0.005) and TIBC (r=-0.520, P=0.008).
Conclusion: Copper deficiency after bariatric surgery is associated with iron deficiency anemia. So, copper
supplement in addition to iron supplement after bariatric surgery is necessary to avoid the occurrence of anemia.
Keywords: Serum Copper, Anemia, Bariatric Surgery.
INTRODUCTION
Treatment with copper rapidly improved the
Copper is an essential trace element and a
hematological abnormalities. Thus, copper deficiency
component of multiple proteins and metalloenzymes
after bariatric surgeries may be misdiagnosed resulting
which perform important metabolic functions [1]. It is
in serious diseases [8].
involved in the formation of RBCs, absorption, and
The current study aimed to evaluate the
utilization of iron. So, hypocupremia is considered a
significance of serum copper level in the early
cause of hematological problems like anemia, and
detection of anemia related to bariatric surgery.
bone and neurological manifestations [2]. Copper
deficiency can be represented as microcytic,
PATIENTS AND METHODS
normocytic, or macrocytic anemias [3].
This case-control study was conducted in the
The main sites of absorption of copper in humans
Clinical Hematology Unit, Internal Medicine
are the stomach and proximal part of the small
Department, Zagazig University, and the Medical
intestine, but absorption can be impaired after upper
Biochemistry and Molecular Biology Department,
gastrointestinal surgery [4]. Bariatric surgery became a
Faculty of Medicine, Zagazig University.
popular solution for morbid obesity [5]. Bariatric
The study included 50 participants from both sexes
surgery includes multiple procedures such as gastric
divided into 25 anemic patients after bariatric surgery
bypass surgery, biliopancreatic diversion with
and 25 healthy individuals.
duodenal switch, and sleeve gastrectomy. All of them
The age of the included participants was more than
aimed to reduce stomach size, and decrease the
18 years. Patients with known hematological diseases
absorption of food in obese patients [6].
were excluded from the study.
Unfortunately, Bariatric surgery interferes with the
Complete history taking including drug history and
absorption of certain nutritional elements, causing
complete clinical examination was performed for all
serious nutritional deficiencies and complications.
participants. Measurement of hemoglobin (Hb), serum
Some of these nutritional elements are already
copper, serum iron, ferritin, total iron binding capacity
screened for after surgery, including protein, vitamin
(TIBC), and transferrin saturation was performed.
B12, vitamin D, calcium, and iron. Others that are not
routinely screened for include B vitamins, fat-soluble
Ethical consent:
vitamins, and minerals such as copper and zinc [7].
The study got approval from the Institute
In many cases of copper deficiency with
Review Board, Faculty of Medicine, Zagazig
documented hematological abnormalities (anemia),
University (ZU-IRB#4740\25-7-2018). All study
symptoms were related to iron or vitamin B12
participants provided written informed permission
deficiency. If patients failed to respond to ordinary
after being informed of our research's goals. The
treatments, severely low copper levels were detected.
Declaration of Helsinki for human beings, which is
953
Received: 25/07/2022
Accepted: 27/09/2022
c:\work\Jor\vol901_141
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 957-964
A Health Education Program for Mothers to Prevent Burn in Early Childhood
Hagar Marzouk Abo El Enin Elsayed1, Sahar Ahmed Shafik2*, Mayada Taha Sabea1
1 Department of Community Health Department, Faculty of Nursing, Helwan University, Egypt
2 Department of Community Health Department, Faculty of Nursing, El-Fayoum University, Egypt
*Corresponding author: Sahar Ahmad Shafik, Mobile: (+20) 01062225020,
ORCID: 0000-0003-3247-4823, E-Mail: Sas19@fayoum.edu.eg
ABSTRACT
Background: Burn is considered one of the most dangerous domestic home injuries in early childhood stage that
causes different harmful effects. Objective: The current study aimed to evaluate the effect of health education
program for mothers to prevent burn in early childhood.
Subjects and methods: Design: A quasi experimental design was conducted. Setting: The study was conducted at
Maternal and Child Health Center in Menouf City. Sample: Convenience sample of 167 mothers from the previously
mentioned Maternal and Child Health Center. Tools: Structured interview questionnaire composed of three parts;
mothers demographic Characteristics, mothers' knowledge about burn, and mothers' reported practices to prevent
burn at early childhood. Results: Before program implementation about 60% of mothers had poor knowledge score
about burns. On the other hand, 90% of mothers have good knowledge score at immediate post health education
program implementation (P= 0.001). Only 30% of mothers reported done practice before program, and improved to
70% after the health educational program (P= 0.001). Conclusion: Continuous health educational programs for
mothers to enhance their knowledge and practice about burn prevention are needed.
Keywords: Health Education Program, Mothers, Burn, Early childhood.
INTRODUCTION
how to care for their child, improving mothers'
Burns are tissue damage caused by heat,
knowledge of home injuries, particularly burn
overexposure to sunlight or other radiation, chemical
definition, causes, risk factors, ways of prevention, and
or electrical contact, or other reasons. Burns might
safety measures, and it's essential to teach them the
result in minor medical difficulties or significant
proper first aid after burn. The availability of health
medical problems. The burn therapy is determined by
services helps the community health nurse do her duty
the site and extent of the damage. The majority of
efficiently, and community home visits might
sunburns and mild burns may be treated at home.
contribute to the promotion of health and the
Severe or extensive burns necessitate immediate
avoidance of sickness (4).
medical attention. Some patients will need follow-up
Because bacteria can enter any broken skin, burn
care as well as therapy at specialized burn centers.
injuries can result in complications of any degree.
First aid after a burn improves results and decreases
However, third- and fourth-degree burns have the
issues (1).
highest risk of complications, including scarring,
Early childhood burn injuries are common due to
infection, dehydration, low body temperature
young children's limited understanding of burn
(hypothermia), contractures, muscle and tissue
protection, first aid, and injury recognition. In addition,
damage, low self-esteem, emotional distress, and
because young children's visceral organs, particularly
psychological distress because burn scars can
their immune and respiratory systems, are still
negatively impact a person's self-confidence or self-
developing, this may cause more severe symptoms and
esteem, especially when they are present (5).
outcomes than in older children. According to the
Burn injuries are a leading cause of mortality and
World Health Organization (WHO), burns and scalds
disability worldwide. To better study burn injuries
are the sixth most common cause of sickness and death
globally, the World Health Organization (6) established
in young children worldwide, particularly in
the Global Burn Registry (GBR). There were 800.640
impoverished nations (2).
pediatric and adult patients from 20 different countries,
Because they create and shed heat more quickly
of which 42 percent were children (018 years old)
than adults, young children are considerably more
from middle-income nations. Scald burns accounted
sensitive to changes in the weather. Because they are
for 62% of childhood injuries, whereas flame burns
usually too busy playing and having a good time to
accounted for 14%. Despite the fact that more than half
notice when they are getting too hot before issues
of pediatric patients (52% of whom had significant
arise. Mothers must shield their children from the sun's
burns with 15% or more of their total body surface
rays, from heat, and from hot objects that may burn
area) and 48% of whom underwent surgery for wound
them. Educating and educating moms in burn first aid
healing while they were hospitalized, 23% of pediatric
helps to lessen the negative consequences and
patients had critical care capability that was
problems associated with burns (3).
"restricted" (6).
The community health nurse (CHN) plays a
Around 250,000 individuals in Egypt get severe
significant role in the prevention of burns in young
burns annually, and around 90,000 of them pass away
children by focusing on a number of key areas,
within the first six hours of their injuries due to
including health education for first-time mothers on
inadequate first assistance, making Egypt the country
957
Received: 02/08/2022
Accepted: 03/10/2022
c:\work\Jor\vol901_142
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 965-970
Ovulation Induction Techniques in Women with Polycystic Ovary
Syndrome: A Review of literature
Gamal Abo El Serour, Amal Mohammed El Shahat,
Mariam Lotfy Mohammed, Mohammed Mamdouh Youssef Saleh*
Obstetrics and Gynecology Department, Faculty of Medicine, Suez Canal University, Egypt
Corresponding author: Mohammed Mamdouh Youssef Saleh, Mobile: 01101199222
ORCID: https://orcid.org/0000-0001-8370-4772, Email: dr.moh.saleh.89@gmail.com
ABSTRACT
Background: Amenorrhea, oligomenorrhea, and irregular uterine bleeding are a few of the many clinical signs of
anovulation, which is fairly prevalent. Anovulation can result from a number of mechanisms. Polycystic ovarian
syndrome (PCOS), which has clinical repercussions and is the most prevalent chronic anovulatory illness, affects 6 to
10% of people worldwide. While a variety of factors may eventually lead to PCOS, a number of therapeutic strategies
have been documented in the literature, frequently without addressing the underlying reason. Ovulation Induction (OI)
is a series of methods used by PCOS-afflicted women who want to get pregnant but are unable to do so naturally.
Aim: The current review discusses OI in PCOS-affected women, with an emphasis on their effectiveness and
application. Development: Cochrane Central Register of Controlled Trials, PubMed/MEDLINE, and EMBASE, up to
November 2022, search by keyword of "Polycystic Ovarian Syndrome" and "Ovulation Induction".
Conclusion: The likelihood of a good pregnancy outcome in PCOS patients receiving OI should be able to be
determined by clinicians, taking into account age, body weight, the various protocols employed, and the length of
infertility. A recommendation to a specialised fertility clinic for in vitro fertilisation would be a good backup plan if the
aforementioned therapies don't succeed in conceiving a child. Future research should evaluate the results of the various
OI techniques outlined above and stratify the efficiency of laparoscopic ovarian drilling in comparison to current medical
therapy.
Keywords: Ovulation, Anovulation, Induction, Clomiphene, Letrezole, PCOS, laparoscopic ovarian drilling, Review.
INTRODUCTION
Women with PCOS who are seeking fertility
The inability to get pregnant after six months for
treatment should first consider changing their lifestyles
women over 35 and after a year for women under 35
and losing weight. Up to 70% of obese women fit the
who are not using contraception is referred to as
criteria for PCOS, compared to 918% of all women of
infertility. Epidemiological data show that 10% to 15%
reproductive age (4).
of all couples will struggle to conceive the optimal
When compared to PCOS patients who are not
number of children (secondary infertility) or have
obese, obese PCOS patients have an increased risk of
primary infertility (1).
the disease's metabolic and psychological side effects in
Over 70 million couples experience infertility
addition to its impact on fertility. With a delivery rate
globally, with most of them living in underdeveloped
per initiated cycle of about 22%, intracytoplasmic
nations. When compared to Western society, emerging
sperm injection (ICSI) is becoming more widely used
nations endure the negative effects of childlessness to a
worldwide. Data from almost 2,500 ART clinics from
greater extent. The most frequent cause of infertility in
58 to 61 countries between the years 2008, 2009, and
poor nations is bilateral tubal blockage brought on by
2010 are included in the report. More than 4,461,300
sexually transmitted diseases and infections contracted
ART cycles were performed over the course of the three
during pregnancy, a condition that may be treated by
years, leading to an estimated 1,144,858 births globally
assisted reproductive technology (ART). In developing
(5).
nations, new reproductive technologies are either
The aim of this study is to review the ICSI
unavailable or extremely expensive (2). The World
outcome among PCOS patients treated with letrozole-
Health Organization (WHO) reports that female
gonadotropins, clomiphene citrate-gonadotropins, or
infertility accounts for 37% of reasons for infertile
gonadotropins only for controlled ovarian super-
couples, male infertility for 18%, and both male and
stimulation.
female for 35%, according to a survey conducted in
wealthy countries. 5% of couples experience
INFERTILITY
unrecognised infertility. Ovulatory disorders (25%),
A healthy preovulatory oocyte is released, sufficient
endometriosis (15%), pelvic adhesions (11%), tubal
spermatozoa are produced, the gametes are transported
obstruction (11%), other tubal abnormalities (11%), and
normally to the ampullary region of the fallopian tube
hyperprolactinemia (7%) were the most often
(where fertilisation takes place), and the cleaving
discovered contributing variables. According to certain
embryo is then transported into the endometrial cavity
studies, ovulatory abnormalities account for more than
for implantation and development. These events are all
half of the causes (3).
necessary for reproduction to occur (6). The causes of
infertility might be either male or female. Aproximately
965
Received: 02/08/2022
Accepted: 03/10/2022
In vivo antimicrobial activity of Matricaria chamomilla extract against Pathogenic Bacteria induced skin infections in Mice
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 971-976
GC-MS Analysis and Antimicrobial Activity of Essential Oil from
(Cymbopogon citratus) against Pathogenic Bacteria
Atheer A. Khashan *, Sawsan Qahtan Taha, Mohammad Jadaan Saad
College of Pharmacy university of Anbar, College of Medicine university of Anbar,
College of Medicine, university of Anbar
*Corresponding author: Atheer Abdulhameed Khashan, Mobile: (+964)7906655477,
Email: ph.alatheernet@uoanbar.edu.iq
ABSTRACT
Introduction: Our plant under research, Cymbopogon citratus, commonly referred to as lemon grass and a member of
the family fabaceae, is one of those potential medicinal plants. It is known as a medicinal plant and is significant in
various uses, particularly pharmaceutical usage due to the presence of the active compounds represented by terpens,
phenols, alkaloids, etc. Our plant under study is one of these significant medicinal plants. Objective: In this work,
lemongrass was harvested from the desert of the Anbar Region and then extracted using a Clevenger device to produce
oil. To identify the phytoconstituents found in the Cymbopogon citratus plant, this study was done.
Materials and Methods: The sample was identified by GC-Mass, which indicated the presence of 2-Methyl-Z, 13-
octadecadienol with percentage 39.86%. Alkaloids, phenols, tannins, and flavonoids were also present, however cardiac
glycosides and saponins were not. Results: We isolated certain pure phytopharmaceuticals, which may then be employed
as a lead molecule to create a new drug with potent therapeutic effects. The antibacterial activity of lemon grass oil on
microorganisms has been investigated utilising the well diffusion method to battle pathogenic bacteria and zone of
inhibition of growth with widths of 22 mm.
Conclusion: Using the well diffusion method, the antibacterial activity of lemongrass oil on microorganisms has been
investigated in order to battle pathogenic bacteria and zones of inhibition of growth with diameters of 22 mm.
Keywords: Cymbopogon citrates, Clevenger apparatus, Antibacterial activity, GC-Mass.
INTRODUCTION
Natural products, primarily from plants, were
(Southwest Asia) is native to South India, but is grown in
explored by people in the treatment of different diseases
dense crops in many parts of the world (9).
for thousands of years (1). Trado-medicine has been a
PATIENTS AND METHODS
global topic in the last decade and plays an important role
Collection: Dry Cymbopogon citratus leaves were
both in healthcare and the global economy (2).
purchased from a local market in Anbar.
It is a matter of global significance. Medicinal
Clevenger apparatus method (Hydrodistillation):
plants have recently held their pivotal position in many
The Clevenger apparatus was named for its inventor,
people's universal health care schemes. In developed
Joseph Franklin Clevenger, who had printed it in 1928.
nations where commercial medication has a lengthy and
There are a few versions. The most famous is a part of a
continuous tradition of use (3). Due to increased demand
particular glassware, as can be seen above the rotund
worldwide for medical products from medicinal plants,
bottom flask. The flask, of an inconstant dimension,
herbal plants manufacturers have been using the best
contains both the heated water and the plant to be
extraction process to see and unlock their chemical
harvested. Steam rises in the mixture of the condenser and
compounds (4). The main aims of this research were to
the condensate fall into the narrow burette on the right.
evaluate the quality of active substances and to determine
Oil floats on the bath, and is eventually extracted to the
the chemical composition of essentials lemongrass oils
hot flask over the diagonal conduit. After a few hours of
grown in southern Delta conditions in the Nile region
extraction, the amount of the oil can be determined
(Bilbeis, Sharqia, Egypt). Cymbopogon citratus is the
directly together in the burette (10).
scientific name of lemongrass. The name Cymbopogon
derives from the Greek phrases 'kymbe' (boat) and 'pogon'
Culture preparation:
(barley), which refer to a flower spike arrangement (5), a
Streptococcus sp. was obtained from Al-Ramadi Hospital
genus of approximately 55 grass species (6). Whereas the
and centrifuged at 3000 rpm, twice washed and re-
term lemon-scented leaves derive in the ancient Latin (7).
suspended in 0.1 per cent pepton water, loop of 24-hour
Lemongrass is a genus of Poaceae grass. It is a
surface development on NA slope of bacterial isolate,
herb with a fragrance that is known in Egypt, the Arab
which is transported individually to 5 ml of brain heart
Peninsula, and tropical Africa of the North and West (8).
infusion broth (PH 7.6) and incubated for 24 hours at 37
Tropical perennial herbs with green, long and slates
°C. The turbidity was changed to meet that of the
leaves from 60-120 cm high with a good fragrance and
Mcfarland tube (108 CFU/ml).
flavor, spontaneously emerging worldwide, mostly in
Antibacterial screening test of extracts using disk
tropical and savannan areas. Lemongrass, barbed wire
diffusion method:
grass, silky heads, lemongrasses, chadedartigalongue,
The disk diffusion check was conducted by normal
tanglad, hierbaluisa or gavatichaha, and many others are
protocol. On the entire surface of Muller-Hinton agar
the common names of this grass. Cymbopogon citratus
(MHA), the inoculum suspension of bacterial insulates
971
Received: 26/07/2022
Accepted: 28/09/2022
c:\work\Jor\vol901_144
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 977-982
Expiratory Muscle Training Versus Functional Electrical Stimulation on
Pulmonaryand Swallowing Functions in Covid-19 Patients
Samia W. Diab*1, Nagwa M. Badr1, Eman K. Ibrahim2, Asmaa M. Mohamed1
1Department of Physical Therapist, of Physical Therapy for Cardiovascular /
Respiratory Disorders and Geriatrics, Faculty of Physical Therapy, Cairo University, Giza, Egypt
2Department of Chest Diseases, Faculty of Medicine, Cairo University, Giza, Egypt
*Corresponding author: Samia W. Diab, Mobile: (+20)01094762028, E-Mail: soodiab1994@gmail.com
ABSTRACT
Background:Coronaviruses are viruses that cause reductions in pulmonary and swallowing functions. The need for this
study has been developed to apply a comparison between expiratory muscle strength training and functional electrical
stimulation for the abdomenandneck in acute COVID-19 patients with dysphagia, aiming to determine the most effective
technique to improve cough peak flow, peak expiratory flow, swallowing, and arterial blood gases. Objective:To
determine the impact of electrical stimulation and expiratory muscle strength training on the pulmonary and swallowing
functions in individuals with COVID-19. Methods:This clinical trial study included sixty patients with COVID-19, of
both sexes, aged from 20 to 45 years,from El-Menshawy General Hospital, Tanta, Gharbia Governorate, Egypt, who
were randomly chosen and divided into two equal groups equal. Expiratory muscle strength training was given to group
A as one session per day, 30 minutes for each session, five times a week for four weeks.Group B received neck and
abdominal functional electrical stimulation. Traditional dysphagia therapies, as well as chest physiotherapy, are
administered to both groups. Results: After treatment, there was a significant difference between the two groups in
terms of pH and PCO2 (p< 0.001). Additionally, there was a significantly higher SaO2, PEF, and GUSS in group B
following therapy compared to group A (p< 0.001). Conclusion:Functional electrical stimulation had a greater impact
on pulmonary and swallowing functions in COVID-19 patients than expiratory muscle strength training.
Keywords: Covid19, EMST 150, Dysphagia,Electrical stimulation,Pulmonary function.
INTRODUCTION
swallowing function. EMT can be expected to be used
More than 24 million people globally have been
as a therapeutic strategy to lessen respiratory difficulties
impacted by the coronavirus that causes severe acute
because it improves airway clearance and lowers the
respiratory
syndrome
(SARS-CoV-2).
Infected
risk of aspiration(5).
individuals with the COVID-19 virus may develop
Pharyngeal electrical stimulation (PES) is a
severe acute respiratory syndrome and other multi-
rapid
and
reliable
therapy
for
dysphagia.
organ system disorders, necessitating extended periods
Neuromuscular stimulation is used to treat the sensory
of recuperation. Although many COVID-19 patients
afferent pathways that are causing pharyngeal
present in acute care hospitals with dysphagia, the
dysfunction to enhance swallowing function. PES has
importance of swallowing rehabilitation in these
been shown to help people with dysphagia recover safe
patients has not been reported(1).
swallowing following severe COVID-19(6). For
Variable levels of swallowing impairment may
pharyngeal electrical stimulation, an electrode catheter
occur in non-intubated patients, and these impairments
that resembles a nasogastric feeding tube is employed
are probably closely related to changes in pulmonary
(PES) (7).
respiratory function and virus-direct neural damage.
The study aimed to determine the impact of
Patients' ability to recover from COVID-19 may be
electrical stimulation and expiratory muscle strength
hampered, which could have an impact on their health
training on the pulmonary and swallowing functions in
outcomes(2).After a protracted stay in the intensive care
individuals with COVID-19.
unit (ICU), endotracheal intubated patients have
complained about swallowing problems. However, it is
SUBJECTSANDMETHODS
still unknown if the intubation, the viral infection itself,
Studydesignandpopulation:
or both are to blame for the dysphagia(3).
This clinical trial study included sixty patients with
Dysphagia is one of the many signs and
COVID-19, of both sexes, aged from 20 to 45 years,
symptoms that COVID-19 may produce. However,
from El-Menshawy General Hospital, Tanta, Gharbia
swallowing impairment can occur in varying degrees in
Governorate, Egypt, who were randomly divided into
non-intubated patients as well. These impairments are
two equal groups.
most likely caused by alterations in pulmonary
Expiratory muscle strength training was given to group
respiratory function and virus-directed neuronal
A as one session per day, 30 minutes for each session,
lesioning activity. There is a significant possibility that
five times a week for four weeks. Group B received
patients receiving invasive ventilation will develop
neck and abdominal functional electrical stimulation.
swallowing problems(4).Expiratory muscular training
Traditional dysphagia therapies, as well as chest
(EMT), which increases pharyngeal muscle contraction,
physiotherapy, are administered to both groups.
enhances not only the coughing function but also the
Ethical consent:
977
Received: 26/07/2022
Accepted: 28/09/2022
c:\work\Jor\vol901_145
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 983-993
The Predictive Role of Serum C16 Ceramide and C24
Dihydroceramide in Patients with Hepatocellular Carcinoma
Amira Gamal1, Manar Obada1, Maha Elsabaawy2, Ashraf Khalil1*, Marwa Helal1
1 Department of Biochemistry and Molecular Diagnostics, National Liver Institute, Menoufia University, Egypt
2 Department of Hepatology and Gastroenterology, National Liver Institute, Menoufia University, Egypt
*Corresponding author: Ashraf Khalil, Mobile: (+20) 483352455, Email: ashkalil2010@gmail.com
ABSTRACT
Background: Ceramides are structural long-chain lipid molecules essential for cell architecture, with many biological
functions involving cell proliferation, inflammation, apoptosis, and cell death. Ceramides have a diverse role in
carcinogenesis depending on their chain length, metabolism, and localization. Disturbance in ceramide metabolism has
been observed in many cancers such as head and neck, colorectal, lung, and liver. Objective: The current study aimed
to use a high-performance liquid chromatography-tandem mass spectrometry analytical method for the measurement of
C16 ceramide and C24 dihydroceramide in the serum of patients with hepatocellular carcinoma and chronic liver
cirrhosis and to verify their potential role as markers of hepatocellular carcinoma.
Patients and methods: This case control study enrolled 100 patients diagnosed with hepatocellular carcinoma and
chronic liver cirrhosis (n= 50 each) and 50 healthy subjects as a control group. Serum samples were subjected to
separation of ceramides by ultra-performance liquid chromatography and quantitative detection and measurement by
tandem mass spectrometry. The assay method allowed accurate measurement of C16 ceramide and C24
dihydroceramide at a serum concentration <2.5 ng/ml. Results: The calibration curves' linearity had regression
coefficients >0.98, with intra-day and inter-day precision and accuracy ranging from 89%-102%. C16 ceramide and
C24 dihydroceramide were significantly higher in hepatocellular carcinoma and chronic liver cirrhosis patients than in
healthy subjects (P<0.05). Their serum levels were not different in liver cirrhosis and hepatocellular carcinoma (P>0.05)
but showed an increasing trend to be higher in hepatocellular carcinoma. Both ceramides did not correlate with the
clinical parameters of hepatocellular injury as Child-Pugh score, BCLC stage, or the burden of tumor of all
P>0.05. Conclusion: Quantitative measurement of C16 ceramide and C24 dihydroceramide by tandem mass
spectrometry is an accurate and precise method for laboratory workup in patients with chronic liver cirrhosis.
Keyword: C16 Ceramide, C24 Dihydroceramide, High-performance liquid chromatography-mass spectrometry,
Hepatocellular carcinoma, Chronic liver Disease, Case control study, Menoufia University.
INTRODUCTION
mechanism that leads to the production of ceramides.
The development of hepatocellular carcinoma
This pathway is more complicated and contains a
(HCC) is a multistep, complex process associated with
number
of
enzymes,
including
ceramidases,
genetic modifications and genomic alterations
dihydroceramide synthases, and sphingomyelinases.
presumably related to the underlying risk factors [1,2].
Complex sphingolipids are broken down in the
The risk factors for developing HCC vary with the
lysosomes and plasma membrane into sphingosine,
geographic distribution, e.g., in Egypt and Japan are
which can then be converted back into ceramide by
infection with hepatitis C virus (HCV), in China are
ceramide synthases [9,10].
hepatitis B virus (HBV) infection, in Europe and USA
The pathway that is chosen to be engaged in
is infection with HCV, non-alcoholic fatty liver disease
order to produce ceramide may be influenced by a
(NAFLD), and alcoholic liver disease (ALD) [3].
variety of stimuli, for example, heat shock proteins and
Cirrhosis of the liver, consumption of aflatoxin
certain chemotherapeutic drugs can both activate the de
B1, smoking, and diabetes mellitus are additional risk
novo pathway [11]. Ceramides play a variety of
factors [1,2]. Patients who have underlying liver disease,
biological roles in cellular differentiation, proliferation,
disturbance in ceramide metabolism have been reported
trafficking, cell cycle arrest, autophagy, and apoptosis
[4]. Ceramides (Cer) are a class of molecules with more
[12-14]. Depending on the length of their fatty acid chains,
than 200 species of different chain lengths identified in
ceramides may either promote or prevent tumour
various tissues [5]. Ceramides can be synthesized de
growth [15]. In preclinical models, the ceramide
novo in the endoplasmic reticulum from serine and
pathways develop into a viable target for several
palmitoyl-Co A via a multistep process involving the
anticancer medications due to their capacity to trigger
action
of
several
enzymes
as
serine
apoptosis [6,16].
palmitoyltransferase, dihydroceramide synthases, and
Long-chain ceramides have been linked to
dihydroceramide desaturase [6,7].
advanced carcinogenesis often, and it has been
Sphingomyelinases, which are triggered by
proposed that they may serve as cancer biomarkers for
TNF-, Fas ligands, and oxidative stress, may
early diagnosis [16]. Depending on the fatty acyl chain
hydrolyze sphingomyelin in the endo-lysosome to
they possess, the members of the ceramide and
generate ceramides [8]. The salvage process, also known
dihydroceramide families differ from one another. High
as the sphingolipid-recycling pathway, is the third
serum concentrations of C16Cer, C18Cer, C18:1Cer,
983
Received: 28/07/2022
Accepted: 30/09/2022
c:\work\Jor\vol901_146
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 994-1000
Age-Dependent Computer-Assisted Sperm Analysis of
Buck Semen Supplemented with Different Antioxidants
Norhan Hamdy Nasr1, Nehal A. Abu Elnaga1, Mervat Ahmed AbdRabou2, Nasser Ghanem 3*
1Zoology and Entomology, Department, Faculty of Science (Girls), Al-Azhar University, Cairo, Egypt
2Biololgy Department, College of Science, Jouf University, P.O. Box: 2014, Sakaka, Saudi Arabia
3 Animal Production Department, Faculty of Agriculture., Cairo University, Giza, Egypt.
*Corresponding author: Nasser Ghanem, Email: nassergo@agr.cu.edu.eg,
Mobile Phone: +01002986157.
ABSTRACT
Background: Sperm cryopreservation is necessary for genetic sharing on a national and international scale.
Objective: This study aimed to examine, after treatment with various antioxidants, the link between buck age and sperm
quality using the computer-assisted sperm analysis (CASA) method.
Material and methods: Collected semen from 16 younger and 14 older New Zealand rabbit bucks. The obtained semen
was assessed by the CASA system using ejaculates with at least 70% progressive motility. Separated semen samples
into eight liquors and diluted (1:1 v/v) with rabbit semen extender supplemented with all antioxidant combinations
(melatonin (M), L-carnitine (LC), cysteine (Cys), LC+M, M+Cys, LC+Cys, and LC+Cys+M) and untreated group.
Results: The casa's characteristics were higher in young than older bucks. In comparison to controls, which recorded
the lowest values, the addition of antioxidants increases total and progressive sperm motility in all experimental groups
significantly. All experimental group's antioxidant supplementation levels and the control group were significantly
lower than fresh pooled semen. Additionally, all CASA parameters increased compared to the control group when buck
semen was supplemented with different antioxidants.
Conclusion: In contrast to younger bucks, administering several antioxidants (LM, LS, MS, and LMS) has a more
substantial positive effect on sperm motility and CASA parameters in older bucks. Thus, age has a substantial role in
defining semen's quality. Additionally, treatment with either a single (L, M, and S) or a combination of antioxidants
enhances buck semen's motility and CASA properties (LM, LS, MS, and LMS).
Keywords: Bucks; CASA; Antioxidants; Melatonin; L-carnitine; Cysteine.
INTRODUCTION
sperm damage, significantly lowering its fertilization
Because commercial hybrid lines account for the
ability [11].
majority of the world's rabbit meat output, the relevance
Deterioration of the cell membrane may be
of rabbit breeds chosen for their ability to provide meat
due to both short-term (liquid) and long-term (frozen)
has considerably declined [1]. FAO recommendations
storage of semen [12]. The mature sperm cells lack a
have incorporated most rabbit breeds into national
major cytoplasmic component carrying antioxidants to
strategies to safeguard genetic resources [2]. Semen
combat the harmful effects of lipid peroxidation (LPO)
cryopreservation is a helpful tool for protecting animal
and reactive oxygen species (ROS). Their membranes
species when it comes to assisting the storage of
include a high concentration of unsaturated fatty acids.
gametes in a gene bank using the ex-situ in vitro
Therefore, during the freezing and thawing processes,
procedure [3,4].
free radicals such as hydrogen peroxide, superoxide
Rabbit cryopreserved sperm has primarily been
anion, and hydroxyl radicals can cause structural
employed for experimental purposes due to reduced
damage to sperm membranes, making sperm cells
fertility/prolificacy outputs [5]. In contrast, rabbit
extremely vulnerable to LPO [12,13].
artificial insemination (AI) is often performed for a
Increased ROS generation during cryopreservation
short period with fresh or cooled semen [6,7]. Changes in
is related to lower post-thaw viability, sperm function,
sperm
cell
integrity
are
detected
during
motility, and fertility [10]. The term "responsibility"
cryopreservation and are ascribed to intracellular ice
refers to the act of determining whether or not a person
formation, and cry-protectant[8].
is responsible for his or her actions. They found that the
One of the critical structures altered by
quality of post-thaw spermatozoa improved when
cryopreservation is the sperm plasma membrane [9],
compared to controls using standard andrological
where reactive oxygen species (ROS) formation rises,
testing [14, 15].
and antioxidant levels decrease during sperm
Antioxidants applied before freezing may
cryopreservation and thawing. The water volume of
prevent the harmful impacts of oxidative stress [16]. The
cells was dramatically affected by freezing and thawing.
scavenging of free radicals, which can result in the lipid
Furthermore, spermatozoa lose most of their cytoplasm
peroxidation of sperm plasma membranes, is a crucial
at the end of development and lack significant
role of antioxidants [17]. Furthermore, antioxidants have
antioxidant-rich
cytoplasmic
components
[10].
been shown to improve the viability and motility of
Therefore, the cryopreservation procedure has severe
cryopreserved and liquid-stored sperm cells [18].
994
Received: 24/7/2022
Accepted: 26/9/2022
c:\work\Jor\vol901_147
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1001-1002
Atypical Presentation of Nursemaid's Elbow: A Case Report
Ahmed Kamal Mohamed1*, Hakim Ebrahim Mohammed Ali2, Ali Nawaz1
1 Emergency Department, NMC Royal Hospital Khalifa City, Abu Dhabi, UAE
2 Emergency Department, King's College Hospital London, Dubai, UAE
*Corresponding author: Ahmed Kamal Mohamed, Phone: +971508892247, Email: ahmed.kamal.ed33@gmail.com
ABSTRACT
Background: Nursemaid's elbow is a known orthopedic pediatric emergency that occurs between one and four years of
age. Axial traction of the extended arm when the forearm is pronated is the most frequently reported mechanism of infliction.
However, other mechanisms are mentioned in the literature.
Cases report: We report a case of pulled elbow in a four-month-old child. The mother reported that the child only rolled
over to her side. Conclusion: A high index of suspicion for pulled elbow should be kept in younger infants despite the
absence of the usual presentation.
Keywords: Nursemaid's elbow, Pulled elbow, Radial head subluxation, Axial traction, Case report.
INTRODUCTION
Nursemaid's elbow (radial head subluxation) is a well-
Based on the history, the suspicion of non-accidental
known pediatric orthopedic injury. Temper tantrum
injury was excluded.
elbow and pulled elbow are other names used for this
On examination, the child was sitting comfortably
condition (1). It commonly affects children aged between
in her mother's lap. She had her left arm in a partially
1 and 4 years old. The highest incidence of this injury is
pronated position with her elbow slightly flexed (15-20
among children aged two and three years (2,3). It is
degrees). The child's peripheral forearm circulation,
classically caused by axial traction on the extended arm
sensation, and motor activity \were not affected. When we
while the forearm is in a pronated position, causing the
tried to move her left elbow, the child cried. She also
radial head to be slipped under the annular ligament (1,4).
resisted supination, pronation, flexion, and extension of
The affected child typically presents keeping the injured
the affected extremity. No visible bruising, deformity,
arm in a semi flexed and/or pronated position (5) without
swelling, or discoloration of the arm was seen. No
evidence of swelling or deformity (4).
crepitus was detected. Tenderness was only detected over
The typical history for the axial traction mechanism of
the radio-humeral joint.
infliction is when the child is pulled by the outstretched
Despite the very young age of the child and the lack
arm to be lifted or to be prevented from falling. As long
of typical history, the diagnosis of a pulled elbow was
as there is no clinical symptoms and signs suggesting a
suspected. The manipulation maneuver was discussed
fracture, the patient history is often satisfactory to
with the parents, and a formal consent was taken
diagnose nursemaid's elbow without the need for
beforehand. The supination and flexion technique was
radiological
imaging.
However,
non-classical
performed with the baby's elbow at 90° with one hand,
mechanisms other than axial traction were also reported
and the other hand supinated the wrist and flexed the
including falls (6), playing rough, getting dressed, and
elbow. We got an audible click during the maneuver. The
accidentally having the hands get stuck in fixtures (5,7).
child was more comfortable, and she started mobilizing
Here, we report a case of a pulled elbow in a four-month-
her elbow actively within 2 minutes. She was observed
old child with atypical history and presentation.
for a period of 15 minutes, and she was subsequently
discharged from the emergency department with
CASE HISTORY
appropriate advice to her mother regarding mobilization.
A four-month-old baby girl's mother noticed that
A telephone follow-up was done after 2 weeks.
after the baby rolled over to her side, she started crying
and then she was unable to move her left arm. She held
Ethical Approval
that arm not wanting to move it. The mother did not know
An approval of the study was obtained from King's
what the precise site of the injury was. She thought it
College Hospital London, Dubai, UAE. The patient's
might be the shoulder or the wrist. The mother did not
guardians were informed that the case would be
give history of trauma, fall, or forced-pulling of the
published as case report, and this was accepted. This
affected arm. There was no delay in seeking medical help,
work has been carried out in accordance with The
and the child was brought within an hour of the
Code of Ethics of the World Medical Association
occurrence of the injury. There were no other reported
(Declaration of Helsinki) for studies involving
health problems or history of similar injuries in the past.
humans.
1001
Received: 27/7/2022
Accepted: 29/9/2022
c:\work\Jor\vol901_148
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1003-1006
Remember Kounis in the Emergency Department: A Case Report
Hakim Ebrahim Mohammed Ali1*, Ahmed Kamal Mohamed2, Ali Nawaz2
1 Emergency Department, King's College Hospital London, Dubai, UAE
2 Emergency Department, NMC Royal Hospital Khalifa City, Abu Dhabi, UAE
*Corresponding author: Hakim Ebrahim Mohammed Ali, Phone: +971503716210, Email: hakim.ali.ed@hotmail.com
ABSTRACT
Background: Anaphylaxis is a life-threatening allergic reaction. Epinephrine is the first-line treatment of this condition.
Kounis syndrome indicates the occurrence of acute coronary syndrome in a patient of hypersensitivity, allergy, or
anaphylaxis associated with mast cells and platelets activation. Epinephrine can be the etiology of myocardial infarction in
this setting.
Cases report: This report represents a case of a 58-year-old female who had myocardial infarction while being treated of
anaphylaxis in response to cefuroxime intake.
Conclusion: Emergency physicians should be aware of the possibility of myocardial infarction in anaphylactic patients to
properly manage it.
Keywords: Anaphylaxis, Kounis syndrome, Hypersensitivity, Case report.
INTRODUCTION
Anaphylaxis is an acute, serious, systemic allergic
The second possible etiology behind MI in the setting
reaction related to a variety of triggers, mechanisms,
of anaphylaxis is epinephrine. It is considered the first line
clinical presentations, and grades of severity (1). Several
of treatment in anaphylaxis (9). The different mechanisms
risk factors have been recognized for myocardial
suggested included coronary vasospasm, promotion of
infarction (MI); however, the differential diagnosis of this
platelet aggregation, and increase of thrombin-induced
condition in an anaphylactic patient is either an allergic
platelet fibrinogen binding (3).
acute coronary syndrome (ACS) known as Kounis
The time interval between epinephrine administration
syndrome or the effect of epinephrine treatment (2,3).
and the occurrence of acute MI is the main determining
Kounis syndrome refers to the occurrence of ACS
factor in the differential diagnosis. If the cardiac
including coronary spasm, acute myocardial infarction,
symptoms occur at the same time or shortly after
and stent thrombosis with mast cells and platelets
epinephrine administration, an epinephrine-related
activation in a patient experiencing hypersensitivity,
etiology is highly suspected. Kounis syndrome is more
allergy, or anaphylaxis (4).
likely if MI symptoms and ECG changes happened before
The pathophysiology behind Kounis syndrome
epinephrine administration (3).
involves mediators as histamine causing coronary
The challenging aspect of Kounis syndrome is that
vasoconstriction, platelet activation, inflammatory cell
managing ACS in the setting of anaphylaxis differs from
activity modulation, and cytokine production. Another
that of a standard acute MI. Treatment requires
suggested mechanism is activation of matrix-degrading
harmonizing the management of coronary vasospasm or
metalloproteinases by chymase and tryptase enzymes
thrombosis with allergy at the same time (8).
eventually leading to atherosclerotic plaques. There are
three described variants of Kounis syndrome: Type I that
CASE REPORT
involves coronary vasospasm in patients without pre-
A 58-year-old female attended the emergency room
existing coronary problems, type II that includes patients
complaining of sudden itching all over her body,
with pre-existing coronary plaques, and type III that
dizziness, vomiting and a fainting episode, one hour
involves coronary stent thrombosis (5).
following cefuroxime intake.
Kounis syndrome diagnosis is based on symptoms,
The patient had type 2 diabetes mellitus and
laboratory
findings,
electrocardiography
(ECG),
hypertension. On examination, the patient was sweaty,
echocardiography, and coronary angiography. It should
dyspneic, and with urticarial rash. Her vital data were as
be suspected in patients who present with chest pain or
follows: blood pressure 80/50 mmHg, pulse 105
angina-like symptoms in the presence of symptoms of
beats/minute, oxygen saturation 96% on room air, and
systemic allergic reaction (5).
temperature 36.8 C. Anaphylaxis was suspected, and the
Elevation of serum tryptase, histamine, cardiac
patient was given intramuscular epinephrine (0.5 mg),
biomarkers, and troponins is a clue for diagnosis (6). Till
intravenous hydrocortisone (200 mg), and one liter of
now, there are no guidelines for its management (7,8).
intravenous normal saline. The initial ECG showed
nonspecific changes (Figure 1).
1003
Received: 27/7/2022
Accepted: 29/9/2022
c:\work\Jor\vol901_149
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1007-1013
Short Segment with Index Vertebra Fixation versus Long Segment Fixation in the
Management of Thoracolumbar Fractures
Essam Mohamed Youssef, Samy Hassanin Mohamed, Asel Ali Alsadek*, Ahmed Ali Morsy
Department of Neurosurgery, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Asel Ali Alsadek, Mobile: (+20) 01014260617,
E-mail: Aselalialsadg@gmail.com
ABSTRACT
Introduction: The majority of musculoskeletal injuries around the globe are spine fractures. The thoracic and lumbar spine
account for 7590% of fractures of the spine.
Aim of study: To compare the radiological and clinical results of short segment with index vertebra fixation with those of
long segment fixation, in the cases of thoracolumbar fractures.
Patients and methods: This interventional comparative study included 40 patients with traumatic thoracolumbar fractures,
of these 20 patients underwent short segment open transpedicular posterior with index vertebral fixation and 20 patients
underwent long segment open transpedicular posterior fixation.
Results: The operative time in Short Segment with Index Vertebra Fixation (SSIVF) was 149 minutes taking considerably
less time than Long Segment Fixation (LSF) (195 minutes). Blood loss was significantly less in SSIVF (290.5 ± 94.88 mL.)
than in LSF (495.5 ± 110.76 mL). Regarding postoperative visual analogue scale (PVAS) pain was significantly lower in
SSIVF (2.25 ± 1.45) group than in LSF group (4.6 ± 1.79) and Oswestry Disability Index (ODI) was significantly lower in
SSIVF group (20.4 ± 12.1) than in LSF group (26.05 ± 13.45) follow-up after 12 weeks postoperatively. Angl of Kyphosis
measured by Cobb angle in LSF group (7.7 ± 2.030) correction was significantly best than in SSIVF group (9.3 ± 2.25)
Follow-up after 12 weeks postoperatively.
Conclusion: In comparison with LSF technique, the SSIVF technique yielded significantly better clinical and functional
outcomes for PVAS and ODI. Compared to the SSIVF procedure, the LSF technique greatly outperformed of radiological
correction of Cobb's angle at the most recent follow-up.
Keywords: Spine, Short Segment, Long Segment Fixation, Thoracolumbar Fractures.
INTRODUCTION
combination therapy using anterior and posterior spinal
A frequent type of spinal injury is thoracolumbar
techniques (7-9).
vertebral body fractures, with "burst type" fractures
Fixation with a long segment pedicle screw was
accounting for between 21% and 58% of all fractures of
historically the most popular technique, encouraging early
the thoracolumbar spine. Thoracolumbar burst fractures
ambulation and reducing kyphosis (a damaged vertebra
are particularly common in younger patients and may
and at least two levels above and below it). SSF
significantly affect their everyday physical activity. They
increasingly took its place because to concerns voiced
are commonly accompanied by neurological deficiencies
regarding the loss of motion segments with long-term
and kyphotic deformities. However, there is still
fixation of segments (the broken vertebra and one level
disagreement over the best way to treat this injury (1, 2).
above and below it) (10).
One of the therapeutic goals of the most effective
Many publications(915) did, however, observe
technique to treat thoracolumbar burst fractures is to open
substantial rates of early implant failure and corrective
up the spinal canal. Other treatment goals include
loss when using this fixation technique. Some authors [12,
correcting the kyphotic deformity, restoring spinal
13] made the claim that installing pedicle screws at the
stability and alignment, and correcting the kyphotic
fracture location would improve load distribution and,
deformity. The majority of authors feel that surgical
consequently, construct stability. Therefore, this study's
intervention is necessary to accomplish these desired
objective was to examine the radiological evaluation and
objectives in cases of burst fractures; nonetheless, there is
clinical results contrasted with long segment fixing in
ongoing debate about the best course of action (2-4).
patients with such broken thoracolumbar vertebrae. The
Roy-Camille et al. (5) first used pedicle screws to treat
use of short segment fixation in patients with such
thoracolumbar fractures. Transpedicular Short Segment
fractures has been shown to be more effective in treating
fixation was first described in 1963 and further developed
the fractures.
by Dick et al. (6) in 1985. Since then, other surgical
approaches
have
emerged.
Straight
anterior
PATIENTS AND METHODS
decompression through corpectomy and thoracolumbar
The study was performed in the Neurosurgery
burst fractures can be treated with posterior short segment
Department, Zagazig University Hospital during the
or long segment pedicle screw fixation, as well as
period from November 2021 to August 2022. This
interventional comparative study was conducted on 40
1007
Received: 27/7/2022
Accepted: 29/9/2022
c:\work\Jor\vol901_150
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1014-1018
Compliance with Standard Protocol for the Diagnosis of Barrett's
Oesophagus: Significance of The Complete Audit Cycle
Ahmed Elnabil-Mortada*1, Sherif Shabana2, Sherif Albalkiny1, Mohamed Elsayed Seifalyazal1
Departments of 1General Surgery and 2Gastroenterology, Faculty of Medicine, Ain Shams University, Egypt
*Corresponding author: Ahmed Elnabil-Mortada, Mobile: (+20) 01140509696,
E-mail: ahmedelnabil@med.asu.edu.eg
ABSTRACT
Background: The key to effective therapeutic endoscopic therapy is early dysplastic Barrett's oesophagus (BO)
alteration detection. Oesophago-gastro-duodenoscopy (OGD) technical proficiency is quickly attained, but the
diagnosis accuracy is still quite variable, especially in non-specialized endoscopic facilities.
Objective: We aimed to evaluate the quality of endoscopic diagnosis and the adherence to guidelines of BO in our
unit. Patients and Methods: A retrospective cohort analysis was done for 436 eligible endoscopic reports after
independent review for confirmation of BO. Cohorts represent the complete audit cycle during the period from
01/01/2018 till 01/07/2022. Group A represented first audit data, and group B represented re-audit data.
Results: A total eligible reports of 256 of BO in group A, and 180 reports in group B were reviewed. There was no
significant difference between the groups regarding the age (62.7 ± 13.5 and 60.1 ± 15.1 years), male sex (68% and 70
%), and endoscopist specialty respectively. Surveillance was the most common indication (32.4% vs 35.5%), followed
by Reflux (16.7% and 15%) in both groups respectively. Compliance with Prague, Paris, and Seattle protocol was
significantly higher in group B (P value 0.05). Lack of awareness of the new guidelines, surgeon specialty, older age
of the endoscopist, long segment of BO were the main factors of poor results in group A.
Conclusions: In the absence of local standard protocol for endoscopic diagnosis of BO, the adherence to the
guidelines was poor. Compliance with the guidelines after implementing new recommendations results in better
outcomes. It is important to complete the audit cycle to ensure that the quality improvement was achieved.
Keywords: Barrett's oesophagus, Barrett's surveillance, Prague Criteria, Seattle protocol, Paris classification,
Adherence guidelines.
INTRODUCTION
Table (1): PICOS criteria for the study
The most significant risk factor for the emergence
Parameter
Criteria
of adenocarcinoma is Barrett's oesophagus (BO),
Population
A total of 436 reports, which
which is characterized as the presence of metaplastic
mentioned word Barrett's weather
columnar epithelium, which endoscopically manifests
as indication, findings, or final
as salmon pink mucosa. Intestinal metaplasia (IM) is
diagnosis were included in our
not necessary for the diagnosis of Barrett's oesophagus
study.
according to current British recommendations [1].
Intervention
Diagnostic OGD.
Comparators
Group A: first audit data. Group B:
Current management of Barrett's oesophagus
re-audit data.
focuses mainly on surveillance to detect early low-risk
Outcomes
Demographic data, indication for
neoplastic lesions suitable for advanced endoscopic
OGD,
endoscopist
specialty,
therapies, Oesophagectomy is only still used in cases
compliance with Prague Criteria,
of high-risk and advanced carcinomas [2].
Paris classification, and Seattle
While it takes little time to become technically
protocol
were
compared
and
proficient in OGD, the grade of high-quality
statistically analyzed.
examination varies, and an unacceptable amount of
Study design
Retrospective cohort study between
endoscopies fail to detect cancer [3].
01/01/2018 till 01/07/2022.
In a recent systematic review and meta-analysis by
Roumans et al. [4] there was large variance between
Population: A total of 436 reports which mentioned
the studies regarding the adherence to Barrett's
the word Barrett's weather as indication, findings, or
esophagus surveillance guidelines worldwide?
final diagnosis were included.
We noted a great variability between endoscopists
Intervention: Diagnostic OGD.
in the description and reporting of BO in our unit, so
Comparators: Group A: represented first audit data
we aimed to evaluate the quality of endoscopic
between 01/01/2018 and 31/03/2020. We chose this
diagnosis and the adherence to guidelines of BO in our
period as 6 months after the standards of the British
unit.
Society of Gastroenterology (BSG) and Association of
Upper Gastrointestinal Surgeons of Great Britain and
PATIENTS AND METHODS
Ireland (AUGIS) were published in 2017 till the first
The
population,
intervention,
comparator,
COVID 19 national lockdown in March 2020. Group
outcomes, and study design (PICOS) framework were
B: represented re-audit data between 01/04/2021and
used to plan this study (Table1). We conducted our
01/07/2022, started 6 months after first audit to give
study between 01/01/2018 till 01/07/2022.
1014
Received: 13/08/2022
Accepted: 14/10/2022
c:\work\Jor\vol901_151
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1019-1025
The Role of Chest Ultrasound Combined with Plasma Brain
Natriuretic Peptide in The Differentiation between Cardiogenic and
Noncardiogenic Pulmonary Edema
Magdy Mohammed Omar1, Mohammed Hussein Kamel1,
Shaimaa Mostafa El-Nahhas Wahdan*1, Asmaa Adel El-Fallah2, Shaimaa Magdy AboYoussof1
Departments of 1Chest Diseases and 2Clinical Pathology,
Faculty of Medicine- Benha University, Qalyoubia, Egypt
*Corresponding author: Shaimaa Mostafa El-Nahhas Wahdan, Mobile: (+20) 01025611515, E-Mail: shimaalnahas @gmail.com
ABSTRACT
Background: Pulmonary edema is a medical emergency that threatens life, and requires urgent management and
immediate hospitalization. Since there is no definite "gold standard" for diagnosing ALI/ARDS or cardiogenic
pulmonary edema (CPE), there is no technique or known biomarker that can be used to distinguish between the two
conditions. Combining clinical criteria with other proven diagnostic methods, such as BNP and chest ultrasonography,
can increase the predicted accuracy, assist in therapy, and enhance the results.
Objective: The purpose of this study is to assess how wel plasma brain natriuretic peptide (BNP) and chest
ultrasonography can distinguish between cardiogenic and noncardiogenic pulmonary edema.
Patients and methods: Lung US was applied to respiratory distressed patients In Benha University Hospital Chest ICU
and Emergency Department on 50 subjects through a cross-sectional prospective study. They were divided into CPE
group 20 cases) and NCPE group (20 cases) as wel as the control group (10 cases). Alveolar-interstitial syndrome
(AIS), absence or decreased lung sliding, sparing regions, subpleural consolidation, pleural line abnormalities, and
pleural effusion were among the pleuropulmonary symptoms that were targeted for detection by the LUS scan in both
groups. Plasma BNP levels were assessed in al groups.
Results: Consolidation is another sonographic finding in the Non-CPE group which represents 80% of cases and is
present in 5% only in the CPE group in our study. Pleural effusion is not a specific finding between the two groups but
it was higher among the cardiogenic group representing 65% while was 25% only among the non-cardiogenic group.
BNP was significantly higher in the CPE group (1031 pg/ml) than in the Non-CPE group (346.5 pg/ml) and controls
(63.5 pg/ml) (P <0.0001). BNP was valid for differentiation between CPE and non-CPE with a Cutoff point of >740
pg/ml (70% Sensitivity and 100% Specificity).
Conclusion: CUS in combination with BNP represents a useful tool for differentiating CPE from non-CPE. In
emergency settings, the benefits of their use outweigh the presence of limitations.
Keywords: CPE, non-CPE, Lung ultrasonography, Chest ultrasound, Brain natriuretic peptides.
INTRODUCTION
and hypoxemic respiratory failure brought on by cardiac
Pulmonary edema is a health emergency that
reasons in the emergency room and intensive care unit.
threatens life and needs urgent management and
Therefore, in these conditions, it might be the most
immediate hospitalization (1).
useful for excluding CPE (5).
It happens when one or more of Starling's forces
Transthoracic ultrasound is an easy, bedside, low-
change, which causes more fluid to migrate into the
cost, and lacks radiation tool that has proved its worth
alveoli. High pulmonary capil ary pressure is what
as a strategic instrument to be used directly after the
causes the aberrant fluid flow in cardiogenic pulmonary
clinical investigation in the emergency room, intensive
edema. Contrarily, noncardiogenic pulmonary edema is
care unit, operating room, and clinical routine (6). It has
brought on by many diseases in which alveolar protein
developed into an important point-of-care (POC) tool
and fluid buildup are due to causes other than increased
for the evaluation of a range of pulmonary and pleural
pulmonary capil ary pressure (2).
disease states, including pleural effusion, empyema,
History, signs, and symptoms may be enough to
pneumonia, pneumothorax, lung cancer, and pulmonary
determine the origin of edema clinical y, but in many
embolism (7).
other situations, particularly in a critical care scenario,
Since there is no definite "gold standard" for
the distinction between cardiogenic and noncardiogenic
diagnosing ALI/ARDS or CPE, there is no technique or
causes may be difficult. Because different treatments
known biomarker that can be used to distinguish
are available
depending
on
the underlying
between the two conditions. Combining relevant
pathophysiologic mechanisms, the diagnosis is crucial
biomarkers with clinical criteria and other techniques
(3). Brain Natriuretic Peptide (BNP) was the most often
may increase the prediction power, facilitate the
examined serum and pulmonary biomarker used to
management, and enhance results (4).
distinguish ALI/ARDS from CPE (4).
The purpose of this study was to assess the
BNP is released from the cardiac ventricles in
contribution of plasma brain natriuretic peptide (BNP)
response to an increase in heart wal tension. Rapid
and chest ultrasonography to the distinction between
measurement of BNP is a sensitive indicator of dyspnea
cardiogenic and noncardiogenic pulmonary edema.
1019
Received: 26/07/2022
Accepted: 28/09/2022
c:\work\Jor\vol901_152
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1026-1032
Levels of Serum Procollagen Type1 Amino Terminal Propeptide and
Cterminal Crosslinked Telopeptide of Type1 Collagen in Children and
Adolescents with Type 1 Diabetes Mellitus
Mohamed A. M. Afify, Alaa Hassanin, Rasha Eladawy*
Department of Pediatrics, Faculty of Medicine, Ain Shams University, Cairo, Egypt
Corresponding author: Rasha Eladawy Shaaban Elmetwally, E-mail: dr.rashaeladawy@med.asu.edu.eg
ABSTRACT
Background: In patients with type 1 diabetes mellitus (T1DM), accelerated bones turnover and bone loss are caused by
increased inflammation. The serum levels of the bones turnover markers (BTM), serum procollagen type 1 N-terminal
propeptide (P1NP) and serum C-terminal telopeptide of type I collagen (CTX), can help identify increasing bones fragility
in T1DM earlier on. Objective: The aim of the study is to measure the levels of BTM in children with T1DM, specifically
serum P1NP and serum CTX, and to look into the relationships between BTM and indicators of glycemic control and
diabetics micro-vascular problems.
Patients and methods: A total of 40 pediatric and adolescent T1DM children were compared with a control group of
healthy control, age- and sex-matched participants. HbA1c, fasting lipids profiles, microalbumin in urine, fasting serum
P1NP, and serum CTX concentrations were measured in the laboratory.
Results: P1NP and CTX concentrations in the sick group were statistically significantly higher than those in the control
group (p<0.001), according to the findings of our research. LDL-C and TDD of insulin, which rose in the uncontrolled
sample, were determined to differ significantly between participants with HbA1c 7% and participants with HbA1c 7%
(p<0.001 and p=0.008, respectively), although there was no differences in the levels of serum P1NP and CTX between the
two samples. Conclusion: In younger T1DM children, serum concentrations of P1NP and CTX may offer predictive
information on bones health. To demonstrate that oxidative stress causes major changes in the activities of bone production
and resorption, more research should be conducted.
Keywords: BTM, P1NP, CTX, bone turnover, diabetes complications, type 1 diabetes, case control study, Ain Shams
University.
INTRODUCTION
Another possible mechanism is that poorly
A metabolic disorder known as type 1 diabetes
controlled T1DM is associated with ongoing cellular
mellitus (T1DM) is defined by the autoimmune
oxidative stress. Previous studies have shown that
destruction of pancreatic beta-cells, which results in a lack
exposure to chronic state of oxidative stress due chronic
of insulin release and the emergence of hyperglycemia (1).
hyperglycemia could result in tissue damage and
It is one of the most prevalent autoimmune
abnormal responses in the body's antioxidant defenses (5).
illnesses among children and teenagers, and its prevalence
Free
oxygen
radicals
in
diabetes
namely;
is growing globally (2).
malondialdehyde, high total serum cholesterol, and
Patients with diabetes either type 1 or 2 diabetes
reactive hydrogen peroxides are responsible for the
were found to have an increased bone fragility despite
pathophysiology of several micro-vascular complications
higher or even normal bone mineral density (BMD) (3).
of T1DM through lipid peroxidation, DNA damage, and
For type 1 Diabetic patients, the higher risk of fractures
mitochondrial malfunction. Presence of free oxygen
has been attributed to a number of factors, notably
radicals result in oxidation of proteins, lipids, and nucleic
alterations in bones microarchitectures, bones marrow
acids and production of toxic products leading to tissue
features, and the balancing of bone turnover. In order to
damage and dysfunction. Moreover, oxidative stress can
calculate
bone
production
and/or
resorption,
produce an unbalance between proteolytic enzymes and
bones turnover indicators are examined. Serum
their inhibitors that results in progressive osteoporosis in
procollagen type 1 N-terminal propeptide (P1NP) is a
patients with T1DM. Previous studies on bone function in
significant marker included in our analysis that is
the presence of diabetes have shown that osteoblastic
recognized to be effective for estimating bones turnover,
differentiation was inhibited and osteoblasts damage and
while serum C-terminal cross-linked telopeptide of type 1
apoptosis were evident. Eventually therefore, oxidative
collagen (CTX) is a marker for bones resorption (4).
stress may be related to the pathogenesis of bone disorders
Chronic inflammation and increased levels of pro-
associated with diabetes (6).
inflammatory cytokines are responsible for bone turnover
In earlier clinical trials on bones turnover,
acceleration and bone loss in patients with T1DM.
fractures risks, and osteoporosis, the usage of P1NP and
CTX was advised. Variations in serum P1NP and serum
1026
Received: 24/7/2022
Accepted: 26/9/2022
c:\work\Jor\vol901_153
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1033-1039
Comparative Review of Outcomes between Enhanced View Totally
Extraperitoneal Technique with Inherently Divided Douglas' Line and
Totally Extraperitoneal Technique for Repairing Inguinal Hernia
Mohamed Elsayed Seifalyazal*, Mohamed Elnagar, Sameh Said Mohamed, Ahmed Elnabil-Mortada
Department of General Surgery, Faculty of Medicine, Ain Shams University, Egypt
*Corresponding author: Mohamed Elsayed Seifalyazal, Mobile: (+20) 01157327366,
E-mail: seifalyazl1976@gmail.com, seifalyazl1976@med.asu.edu.eg
ABSTRACT
Background: The inguinal hernia can be repaired using a variety of laparoscopic methods. The most popular
procedures are transabdominal preperitoneal (TAPP) and totally extraperitoneal (TEP). TEP technique is regarded
closet to ideal. However, it has limitations that inspired the evolution of e-TEP. This small e stands for enhanced or
extended view. Although the division of Douglas' line is not inherent to e-TEP technique, it offers a wider working
place for secondary ports. Objective: To compare extended view totally extraperitoneal repair with inherently divided
Douglas' line to totally extraperitoneal repair of inguinal hernia concerning operative time, ease of the procedure and
postoperative complications. Patients and Methods: This prospective cohort study enrolled 55 patients diagnosed
with inguinal hernia underwent laparoscopic repair between January 2019 and November 2021. Thirty-one patients
(56.4%) underwent e-TEP technique with inherently divided Douglas' line (group I) and twenty-four patients (43.6%)
underwent TEP technique (group II). Results: No significant difference was found between the two groups regarding
age, sex and body mass index. Overall complication rate was higher in TEP group than in e-TEP group. Mean
operative time, hospital stay, and pain score were less in e-TEP technique with inherently divided Douglas' line.
The number of used tacks, and early return to work were significantly different for favor of e-TEP group.
Conclusion: Enhanced view TEP technique with inherently divided Douglas' line is superior to TEP technique for
repairing inguinal hernia in providing a better visual angle and ergonomics with lower complication rates and shorter
operative time
Keywords: Hernia, Douglas' line, TEP, e-TEP.
INTRODUCTION
e-TEP technique has outstanding features such as:
Since the first published laparoscopic hernia
fast and easy creation of large extraperitoneal space,
surgery by Dr. Ralph Ger in 1982, many
flexible port placement, more tolerance to
endolaparoscopic techniques to repair inguinal hernia
pneumoperitoneum and better ergonomics (6).
have gained more advances in recent years (1), as
Although the division of Douglas' line is not inherent
transabdominal
preperitoneal
(TAPP),
totally
to e-TEP technique, it allows wider access to both
extraperitoneal (TEP), extended totally extraperitoneal
Retzius and Bogros spaces and provides more
(e-TEP),
laparoscopic
intraperitoneal
onlay
comfortable dissection of the critical view of
mesh (IPOM)
and
robotic
transabdominal
myopectineal orifice (5). e-TEP technique has its
preperitoneal (r-TAPP). Numerous research has
specific indications as short umbilicus-pubis distance,
compared TAPP with TEP methods. There was no
previous pelvic surgery, complicated hernia cases
discernible difference between the two procedures in
(sliding or large inguinoscrotal one), obese patient or
terms of perioperative complication rates, according to
post bariatric surgery. Finally, mastering e-TEP
the German hernia registry (2). Contrarily, register-
technique will open the door to encompass the repair
based studies conducted in Japan and Switzerland
of more complex cases of inguinal, incisional, ventral
revealed that the TEP group experienced greater
and lumbar hernias (8).
perioperative problems than the TAPP group (3).
The aim of the study was to compare extended
TEP technique has many advantages over TAPP as
view totally extraperitoneal repair with inherently
no penetration of the abdominal cavity, low risk of
divided Douglas' line to totally extraperitoneal repair
visceral or vascular injury and minimal risk of trocar
of inguinal hernia concerning operative time, ease of
site hernia. However, it has challenges such as field
the procedure and postoperative complications.
restriction caused by pneumoperitoneum due to
PATIENTS AND METHODS
peritoneal tears. In addition to bleeding, it is the
conversion factor that leads to e-TEP growth (4).
Population
Enhanced or extended view TEP concept was first
We conducted a prospective cohort study. Fifty-
developed in 2009 at Clinica Bautista, Colombia by
five eligible patients aged between 18 and 66 years
Dales for inguinal hernia repair (5). It is based on the
diagnosed with unilateral non-complicated inguinal
anatomical tenet that practically every point along the
hernia between January 2019 and November 2021 at
front abdominal wall can access the extra-peritoneal
Al-Jedaani Hospitals, KSA were included and divided
area (6). Later, Belyansky et al. (7) employed this
between two groups. We excluded any patients who
method in laparoscopic ventral hernia surgery.
were unfit for general anesthesia, diagnosed with
1033
Received: 13/08/2022
Accepted: 14/10/2022
Comparison between Torsemlde infusion, versus intermittent boluses and their impaction thoracic fluid Content in acute decompensated Heart failure critically ill patients
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1040-1048
Comparison between Torsemide Infusion Versus Intermittent Boluses and
Their Impact-On Thoracic Fluid Content in Acute Decompensated
Heart Failure Critically Ill Patients
Mohammed Abdel Monem*1, Tamer Waheed2, Alaa Hussein3, Deyaa Mohammed4
1Department Critical Care Medicine, Faculty of Medicine, Helwan University, Egypt
2Department of Nephrology, Faculty of Medicine, Helwan University, Egypt
3Department of Clinical Pharmacist, Faculty of Pharmacy, Helwan University, Egypt
4Department of Critical Care Nursing, Faculty of Nursing, Helwan University, Egypt
*Corresponding author: Mohammed Abdel Monem Saeed, Mobile: (+20) 01099292999, E-Mail: mohammedicu1@gmail.com
ABSTRACT
Background: It is still debatable whether loop diuretics should be given intravenously as boluses or continuously by
infusion while treating acute decompensated heart failure (ADHF).
Objective: We aimed to evaluate the differences between the two administration routes on the thoracic fluid content
(TFC), renal functions, urine output, electrolytes, haemodynamic parameters, echo cardiographic parameters,
incidence of atrial fibrillation and NYHA class.
Patients and methods: Eight hundred thirty patients admitted to the Critical Care Medicine Department, Faculty of
Medicine Helwan University, Egypt with acute decompensated heart failure (ADHF) were enrolled in the study; thirty
patients were excluded due to EF>40%, myocardial infarction within 30 days and baseline creatinine level > 4 mg/dl.
Torsemide 200 mg per day was given to the remaining 800 patients who continued in the study after 1:1
randomization to either continuous intravenous infusion (group I, 400 patients), or twice equal intermittently daily
doses (group II, 400 patients). No subsequent dose titration done all over the first 4 days.
Results: The delta TFC all through the four days were all statistically significant giving the superiority of the infusion
route over the twice daily regimen. While urine output was increased all through the four days, with significant
statistical difference in favor of the infusion group but creatinine level, urea level, creatinine clearance were all non-
significant statistically when comparing the two groups. The NYHA class started to be significant statistically from
the third and fourth days in favor of infusion group.
Conclusions: We concluded that torsemide infusion when compared to the torsemide twice equal dose in ADHF,
causes more decrease in TFC, symptomatic improvement with non-significant nephrotoxic effects.
Keywords: Torsemide, ADHF, TFC.
INTRODUCTION
that is more closely linked to intravenous boluses,
Heart failure is a major public health issue
along with enhanced neuro-hormonal activation and
across the world, with high morbidity, value, and
lower cardiac parameters (6). Continuous loop diuretics
expense. In affluent nations, it affects 1-2% of
infusion increases diuretic effectiveness and reduces
individuals, with the frequency rising to roughly 8.4%
diuretic toxicity by utilising lower dosages in post-
in the population over 70 (1).
cardiac surgery patients with heart failure. According
Patients with heart failure frequently take loop
to Felker et al. (7) there is no discernible difference
diuretics to treat congestion symptoms, increase
between continuous infusion and boluses in terms of
exercise tolerance, and lower mortality risk (2). As one
effectiveness and change from baseline renal
of the many negative effects of using diuretics,
functions.
hypotension (3), may develop as a result of the fast
Impedance cardiography (IC) is a non-invasive
intravascular
volume
reduction
and
direct
technique for ongoing hemodynamic monitoring that is
venodilatation brought on by diuresis (4). The use of
secure, repeatable, and appropriate for a variety of
loop diuretics results in the activation of the
heart failure patients (8). One of the important
sympathetic and renin-angiotensin-aldosterone nerve
hemodynamic characteristics that IC evaluates is
systems. Loop diuretics can cause hypokalemia as a
thoracic fluid content (TFC). TFC and chest wall
side effect that is associated with the use of loop
impedance are inversely correlated, meaning that when
diuretic administration, and neurohormonal activation
TFC rises, chest wall impedance falls. Chest
can trigger cardio-renal syndrome and renal hypo-
intravascular and extravascular fluid components and
perfusion caused by hypotension (5).
TFC are correlated (9).
The most effective way to provide intravenous
Regarding lowering TFC, clinical improvement,
loop diuretics is still up for debate, however standard
and safety, we aimed to evaluate intravenous
delivery methods include intravenous boluses or
torsemide treatment as a continuous infusion with
continuous infusions. Theoretically, the use of
intermittent boluses in patients with acute
continuous infusion may be more advantageous in the
decompensated
heart
failure
(ADHF).
counterintuitive rise in systematic vascular resistance
1040
Received: 21/07/2022
Accepted: 23/09/2022
c:\work\Jor\vol901_155
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1049-1052
Association of Microrna-153-3p Expression in Response to
Treatment with Imatinib in Patients with Chronic Myeloid Leukemia
Duaa Dhahir Abbas1, Haithem Ahmed Al-Rubaie2
1Al-Yarmouk Teaching Hospital, Al-Karkh, Baghdad, Iraq
2Department of Pathology, Col ege of Medicine, University of Baghdad, Iraq
Corresponding author: Duaa Dhahir Abbas, Email: duaa.dahir1986@gmail.com, Phone: 9647711609169
ABSTRACT
Background: It is thought that the susceptibility of chronic myeloid leukemic (CML) cel s to imatinib (IM) is increased
by high miR-153-3p expression.
Aim: To establish the association of miR-153-3p expression with treatment response to IM in CML patients.
Methods: Sixty CML patients were included and divided into two groups consistent with their response to treatment
whether sensitive or resistant to IM. Ten healthy normal participants were enrol ed as control group. RNA was extracted
from serum to work out miR-153-3p expression utilizing real-time quantitative reverse transcription polymerase chain
reaction. The primers were supplied by Macrogen Inc.
Results: 27 patients were sensitive to imatinib and 33 were resistant to imatinib. The ratio of male to female was
1.14:1. The bulk (58%) of patients were within the age range of 41-60 years. Weight and gender did not significantly
differ between the two patient groups. The mean patients' CT of miR-153-3p was significantly above the control group
and the sensitive group. The mean DCT value in resistant group was significantly above that of the sensitive group while
insignificantly above that of the control group. The mean DDCT in resistant group was significantly higher than that of
the sensitive group. The miR-153-3p expression showed significantly lower fold change than the sensitive group.
Conclusion: There is miR-153-3p expression downregulation in resistant CML patients indicating unresponsiveness to
treatment with imatinib.
Keywords: CML, Imatinib, MiRNA-153-3p, Response to treatment.
INTRODUCTION
been discovered that IM-resistant CML cel s exhibit
Thirteen percent of al leukemia cases are caused by
downregulation of the miR-153-3p, which has been
a malignant proliferative disorder cal ed chronic
linked to many different sorts of malignancies. By
myeloid leukemia (CML). Condition that developed
blocking the autophagy mediated by B cel lymphoma 2
from hematopoietic stem cel s and is identified by the
that is caused by up-regulation of miR-153-3p. IM
Philadelphia (Ph) chromosome and the presence of the
sensitivity was considerably boosted. Whereas down-
fusion gene BCR-ABL (1, 2). Tyrosine kinase inhibitors
regulating miR-153-3p mitigated these effects in IM-
(TKIs), such as imatinib (IM), are utilized as first-line
resistant CML cel s, and lowered the survival rate of
therapy since chemotherapy is considered the most
IM-resistant CML cel s (8).
effective treatment for CML (3). But the main obstacle
to successful treatment of the il ness is chemotherapy
PATIENTS AND METHODS
resistance (4).
This cross-sectional analysis examined 60 CML
Since blood cancers cannot be surgical y treated,
patients were enrol ed. Two groups of patients were
unlike solid tumors, as a result, it is vital to research the
selected sequential y according to their response to
mechanisms underlying treatment resistance in blood
treatment with IM according to the fol owing criteria:
malignancies and figure out how to combat it.
CML patients who are sensitive to IM after a
Approximately 22 nucleotides in length, microRNAs
minimum of 3 months without interruption of
(miRs) are a category of a short single-stranded non-
treatment, with their BCR-ABL1 transcript levels
coding RNAs that regulate the epigenetic state of certain
10%.
targets by modifying the translation of target genes or
CML patients who are resistant to IM and failed to
by cleaving mRNA (5). BCR-ABL1 expression is the
achieve complete hematologic response and BCR-
distinguishing molecular feature of CML and is hence
ABL1 transcript levels > 10% (IS) after three to six
the target for TKI treatment (6). Since some of the IM-
months of therapy or partial cytogenetic response
resistant patients had no mutations on the BCR-ABL1
after 3 to 6 months into a therapeutic regimen.
oncogene, resistance to IM and other TKIs has been
acknowledged as the main problem for CML treatment
Exclusion criteria:
and monitoring (7).
Patients who stopped or interrupted imatinib for any
Since miRs are powerful regulators, they may
reason, or taking drugs other than IM.
contribute to the emergence of drug resistance because
Ten normal healthy people were recruited as a
they regulate other genes involved in drug transport or
control group. From each patient and control, a sample
the activation of essential signal ing pathways in
of three mL peripheral blood was withdrawn and
addition to the gene's expression BCR-ABL1 (8, 9). It has
col ected in gel tube. Serum was separated by
1049
Received: 2/9/2022
Accepted: 28/11/2022
c:\work\Jor\vol901_156
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1053-1056
Study of The Effect of Metformin on Plasminogen Activator Inhibitor-1
(PAI-1) and Some Biochemical and Blood Parameters in Patients with
Type 2 Diabetes in Samarra City
Khalilda Khaleel Abdullah1, Muzayyan Fadhly Namik2, Iman Ismael Khaleel3
1Department of Biology, College of Education, University of Samarra, Samarra, Iraq
2Department of Biology, College of Education for Pure Sciences Tikrit University, Tikrit, Iraq.
3Department of Education Samarra, General Directorate of Salah al-Din Education, Ministry of Education
Corresponding Author: Khalilda Khaleel Abdullah, Email: khaleda.kh@uosamarra.edu.iq, Phone No: 009647731823466
ABSTRACT
Background: Metformin, an anti-hyperglycemic drug, treats type 2 diabetes with diet. It increases muscle glucose
consumption, maintains blood levels, and does not cause severe hypoglycemia.
Aim: To evaluate the effect of metformin on some plasminogen and cortisol variables and some hematological variables
represented in the percentage of compact red blood cells, hemoglobin concentration, total number of red blood cells,
and white blood cells in patients with type 2 diabetes.
Subjects and Method: 90 patients with type 2 diabetes and patients who used metformin treatment twice a day
continued for three months, six months, and one year were included, according to a questionnaire. After confirming the
status of type 2 diabetes through laboratory tests, samples were taken. They were divided into four groups according to
the period used in the treatment.
Results: The results indicated that treatment with metformin led to a significant decrease in the level of Plasminogen
Activator-1 (PAI-1) and cortisol hormones, in addition, to the decline in hematological indices, packed cell volume
(PCV), hemoglobin (Hb), red blood cells (RBCs) and white blood cells (WBCs) within works 2, 3 and 4 compared to
the control group.
Conclusion: Metformin may improve the risk of atherosclerotic disease that may occur due to diabetes by lowering
blood glucose, such as improving endothelial function, decreasing inflammatory activity, and decreasing blood
parameters during treatment, which may be related to anemia.
Keywords: Diabetes, Metformin, Plasminogen, PCV, Hb, WBC, RBC.
INTRODUCTION
number of erythrocytes increases or when the plasma
The number of oral agents used to treat patients with
volume decreases (5).
type 2 diabetes has increased significantly in recent
years, as these agents mainly reduce peripheral insulin
Hemoglobin (Hb): (Hb) has an essential effect on the
resistance (1).
transport of respiratory gases and is one of the main
The sugar regulator Metformin belongs to the
compounds that make up most of the components of
Biguanide group. Metformin has a strong and practical
erythrocytes (12 g/milliliter) in females. The decrease
effect on the treatment of diabetes. Its mechanism of
in Hb is an indicator of anemia. The increase in
action is to lessen blood glucose degrees by reducing
hemoglobin concentration usually occurs due to loss of
glucose manufacturing with the aid of the liver and
body fluids in cases of vomiting and acute diarrhea (6).
reducing the intestinal absorption of glucose. In
Erythrocytes contain between (200-300) hemoglobin
addition, it was found that metformin increases insulin
molecules. Hemoglobin transports 98.0% of oxygen (7).
sensitivity by increasing cell uptake of glucose and its
utilization. In addition, it also inhibits the activity of
White Blood Cells (WBC): Leukocytes represent the
mitochondria complex I and strongly affects the
essential elements in the body's integrated protective
treatment of diabetes (2).
system and are characterized by their ability to self-
Diabetes type 2 has normal insulin levels, but there
move as they migrate through tissues and have many
may be a harmful decrease in insulin levels or insulin
immune functions, and their number in a healthy adult
resistance (3). Since 2019, the World Health
human being ranges from 4000-11,000 cells per
Organization has indicated that there are 463 million
microliter (8).
people with diabetes worldwide, with type 2 diabetes
accounting for about 90% of cases and the same in
Red Blood cells (RBC): The function is to transport
women and men. In 2019, diabetes resulted in
respiratory gases (O2 and CO2) by attaching these gases
approximately 4.2 million cases of deaths worldwide (4).
to hemoglobin. The number of red blood cells in
females is 4-4.5 million cells/m3, and in males, 4-5
Packed cells Volume (PCV %): The volume of
million cells/m3; their number varies according to the
compacted blood cells in a healthy organism is
physiological conditions a person may go through. Red
proportional to the amount of hemoglobin and the
blood cells are formed in the adult in the red bone
erythrocytes, as the PCV value increases when the
marrow by the action of the hormone erythropoietin (9).
1053
Received: 27/7/2022
Accepted: 29/9/2022
c:\work\Jor\vol901_157
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1057-1062
Results of Using Modular Mega Prosthesis after
Proximal Femoral Tumor Resection
Wael Mansour Wafa*, Yasser Youssef Abed, Sallam Ibrahim Fawzy,
Mohamed Fathi Mostafa, Abed Abd El-Latif El-Negiry
Department of Musculo-Skeletal Oncology Unit, Orthopedic, Mansoura University, Dakahlia, Egypt
*Corresponding author: Wael Mansour Wafa, Mobile: (+20)01067565200, Email: drwaelmansour@gmail.com
ABSTRACT
Background: Proximal femoral replacement (PFR) is a commonly performed procedure to restore extensive bone
defects for different indications with variable reported outcomes.
Objective: This retrospective study aimed to assess the functional outcomes and complication rates of PFR with
MUTARS or Hipokrat modular femoral mega prosthesis after oncological resections and to highlight the overall
patient, limb, and implant survivorship.
Patients and methods: A total of 18 patients had PFR after oncological resection. 14 patients had bipolar
hemiarthroplasty (BHA) and 4 patients had total hip arthroplasty (THA). At the final follow-up, the patient's
functional outcome was assessed by Muscloskeletal Tumor Society score (MSTS) and Toronto Extremity Salvage
Score (TESS). Complications were recorded and classified according to the Henderson classification.
Results: The mean follow-up was 87.74 months (14-103 months). The mean MSTS and TESS score was 65.7 (range
23-97%) and 81 (range 56-98) respectively. Overall limb, implant, and 5-year patient survival were 94%, 94%, and
66% respectively. The overall complication rate was 39%; 11% instability, 17% periprosthetic fracture, 5.6%
infection, and 5.6% local tumor recurrence. Conclusion: PFR is a valid option for reconstruction of huge bone loss
after oncological resection of the proximal femur with acceptable longevity, functional outcome, and complication
rate with better BHA over THA reconstructive option for stability issues.
Keywords: Proximal femur, Tumor, Endoprosthesis, Sarcoma, Metastasis.
INTRODUCTION
most frequent cause of failure in multiple datasets(4).
Primary malignant and benign lesions as well
This study concentrates primarily on clinical,
as metastatic illness frequently occur in the proximal
oncological, and functional outcomes of PFR after
femur. It is the primary site for metastases after the
oncological resection with implant longevity and
spine and the third location for bone sarcoma after the
patient survivorship as secondary outcomes.
distal femur and proximal tibia (1).
Amputation was once the standard of care for
PATIENTS AND METHODS
bone sarcoma, but now, because of improvements in
A retrospective study was conducted, from
surgical skills and adjuvant therapies, limb salvage is
2014 to 2022, targeting patients who had proximal
possible. The gold standard for limb salvage now is
femoral modular mega prosthesis for oncological
broad local excision followed by reconstruction(2).
indications using prospectively collected data from the
Large defects in bone and soft tissue may be
registry for patients and their follow-up for a minimum
left behind after surgical removal of proximal femur
of one year at the outpatient clinic.
bone cancers. Following such excision, three main
Preoperative evaluation included radiographs
reconstructive alternatives are viable: a composite
and magnetic resonance imaging of the pelvis and the
biological reconstruction, an osteoarticular allograft,
proximal femur and computed tomography (CT) of the
and the use of a tumor prosthesis. The most common
lungs. CT-guided or open biopsy was obtained to
technique nowadays is endoprosthetic reconstruction,
confirm the pathological diagnosis. Pre and post-
which can be either modular or custom constructed.
chemotherapy and or radiotherapy regimens were
The femoral neck length, angle, and anteversion angle
decided by a multidisciplinary team, which included
may all be adjusted with the modular prosthesis. As a
an orthopedic surgeon, a histopathologist, a medical
result, it enables intraoperative adaptation to the
oncologist, and a radiation oncologist. Two patients
patient's specific defect(3).
(11%) were presented with pathological fractures.
Despite recent developments in the prosthetic
Surgical technique
PFR, there are still numerous obstacles to overcome
All patients were operated, under spinal
and conflicting data concerning implant failure. To
anesthesia enhanced with epidural catheterization,
achieve a large margin, it is frequently necessary to
using the posterolateral approach in the lateral
sacrifice crucial components including the joint
position, including the biopsy track. The gluteus
capsule, the greater trochanter where the gluteal
maximus was detached from its osteo-facial insertion
muscles attach, and the lesser trochanter where the
and reflected posteriorly exposing the sciatic nerve and
ileo-psoas muscle inserts, leading to joint instability(2).
short rotators of the hip, then the Gluteus Medius and
Between 1% and 37% of patients who have had
Minimus detached with a safety margin away from
proximal femoral replacement (PFR) with an
their tendinous insertion, except in a single patient the
endoprosthesis experienced hip instability, which is the
greater trochanter was preserved. The hip joint capsule
was opened longitudinally along its anterolateral
1057
Received: 01/08/2022
Accepted: 02/10/2022
c:\work\Jor\vol901_158
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1063-1068
Effect of Low-Level Laser with and without Shoulder Mobilization in
Treating Shoulder Impingement
Hind Mohammed El Mahdy Nasser Alsharief1,2, Osama Fekry Ahmed Al Balah1, Nader Ibrahim Elsayed3
1. Department of Medical Applications of Laser, National Institute of Laser Enhanced Sciences,
Cairo University, Giza, Egypt.
2. Department of Basic Science for Physical Therapy, Faculty of Physical Therapy,
Heliopolis University, Cairo, Egypt.
3. Department of Orthopedic Physical Therapy, Faculty of Physical Therapy,
Alhayah University in Cairo (AHUC), Cairo, Egypt.
Corresponding author: Hind Mohammed El Mahdy Nasser Alsharief,
Email: Hammarh.19@g mail.co m, Mobile: +201025050698
ABSTRACT
Background: Besides the traditional physical therapy interventions (infrared and strengthening exercises for scapular
and shoulder muscles), recently, low-level laser (LLL) and mobilization with movement (MMM) gained more attention
in the management of shoulder impingement syndrome (SIS).
Aim: To examine the effects of adding LLL to MMM in patients having SIS.
Design: A prospective double-blinded randomized trial.
Settings: Physical therapy outpatient clinic of Heliopolis University.
Participants: Forty patients complaining of unilateral shoulder impingement syndrome for not less than three months
and not more than twenty-four months were included.
Methods: The patients were randomly assigned to group A (n=20, received the active LLL, MMM, and the above-
mentioned traditional physical therapy interventions), and group B (n=20, received the same treatments as group A but
the LLL was sham). Al treatments were applied 3 times per week, for 6 successive weeks. The shoulder pain severity,
(assessed via visual analog scale, VAS) and shoulder range of motion (ROM) (flexion, abduction, and internal rotation).
Results: The within-group analysis revealed a significant enhancement in al parameters relative to the baseline (P <
0.05).
Conclusion: LLL could magnify the gained improvements in pain and ROM when added to MMM and traditional
physical therapy interventions in patients with SIS.
Keywords: Low-level laser; Mobilization with movement; Shoulder impingement syndrome.
INTRODUCTION
In middle age and older individuals, shoulder
Mobilization with movement (MWM) refers to a
problems are considered among the most frequent
manual therapy technique in which an external force is
cause of impairment due to musculoskeletal disorders
applied manual y by a physiotherapist in the pattern of
with a reported prevalence ranging between 7% and
sustained joint glide and active motion of the segment
25% of the general population (1).
at the same time to correct the fault position of the
Pain, restricted range of motion, and functional
patient which contribute to either bony or soft tissue
disabilities are the primary symptoms concerned with
lesions around the affected joint enhancing pain-free
shoulder disorders and cause limitations in the
ROM regarding biomechanical or neurologic impacts
performance of the activity of daily living (2).
(6).
Subacromial
impingement
syndrome
(SIS)
To the authors' knowledge, there is no previous
contributes to micro traumatic changes and soft tissue
study that compares the impact of LLLT either with or
injuries reported in (44%-65%) of patients attending the
without MWV techniques in patients with SIS and
orthopedic clinic and needing physical therapy
investigates the effect of LLLT in speeding up the
intervention for useful recovery (3).
healing process as wel as the recovery time.
Exercise programs, mobilization, acupuncture,
As a result, this research set out to evaluate the effic
heat, cold, and electrotherapy including low-level laser
acy of laser plus MWM versus laser alone in treating SI
(LLLT) are modalities used in the management of SIS
S patients. It was hypothesized that adding low-level
(4).
laser modality to mobilization with movement technique
Low-level laser or photo biomodulation went on to
may accelerate the healing process, decrease pain,
become one of the most effective modalities used to
maximize functional ability, and minimize recovery time
decrease pain and accelerate the healing process either
in patients with subacromial impingement syndrome.
in acute or chronic conditions, especial y in wavelength
ranged low-level laser is a nonionizing, noninvasive and
SUBJECTS AND METHODS
monochromatic beam, and its mechanism of action
Design
based on cel proliferation, protein and col agen
It is a randomized control ed trial; prospective study
synthesis (5).
that was performed From May 2022 to August
1063
Received: 2/8/2022
Accepted: 3/10/2022
c:\work\Jor\vol901_159
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1069-1074
Association of Monocyte to High-Density Lipoprotein Ratio with
Contrast-Induced Nephropathy in ST-Segment Elevation Myocardial Infarction
Patients Treated with Primary Percutaneous Coronary Intervention
Ahmed A. Emara, Ahmed A. Elhelbawy*, Neveen I. Samy
Cardiology Department, Faculty of Medicine, Menoufia University, Shibin El-Kom, Menoufia, Egypt
*Corresponding Author: Ahmed Abd Elsamie Elhelbawy, Mobile: (+20) 01017853369,
E-mail: ahmedhelbawy.com@gmail.co m
ABSTRACT
Background: Fol owing primary percutaneous coronary intervention (PCI), contrast-induced nephropathy (CIN) is
linked to higher mortality and morbidity. The monocyte to high density lipoprotein cholesterol ratio (MHR), which has
been used as a novel predictive marker in patients with cardiovascular and renal disorders, has been linked in several
studies to a number of negative cardiovascular outcomes.
Objective: The current study was conducted to explore correlation between monocyte to HDL ratio and CIN after
primary PCI in patients presented with ST-segment Elevation Myocardial Infarction (STEMI).
Patients and methods: A total of 80 patients with acute STEMI were included. Patients were differentiated into two
groups according to development of contrast induced nephropathy; Group (A) Patients who developed contrast induced
nephropathy, and Group (B) Patients did not develop contrast induced nephropathy. CIN was defined as either a 25%
increase in serum creatinine from baseline or 0.5 mg/dL increase in absolute value, within 48-72 h of intravenous
administration of contrast medium.
Results: A total of 16 (20%) patients developed CIN. MHR was significantly higher in CIN positive group [mean 0.0202
(range 0.009-0.0633) 108/mg] than non-CIN group [mean 0.0129 (range 0.0031-0.0307) 108/mg] with P-value = 0.003.
MHR was also significantly correlated with creatinine levels 48 hours after PCI (rs: 0.322, P: 0.004). ROC statistical
analysis showed that MHR >0.0131 was the best cutoff values for predicting contrast induced nephropathy with
sensitivity 76% and specificity 71.2%.
Conclusion: Higher MHR levels may predict CIN development after primary PCI in STEMI patients.
Keywords: Percutaneous coronary intervention, Contrast-induced nephropathy, High density lipoprotein cholesterol
ratio, Myocardial Infarction.
INTRODUCTION
people at risk for CIN, more objective measures are
One of the significant side effects of primary PCI
required.
that is linked to higher mortality and morbidity is
A new laboratory measure cal ed the monocyte to
contrast-induced nephropathy (CIN) [1,2,3]. To enable
HDL-cholesterol ratio (MHR) has a predictive
preventative actions and enhance therapeutic outcomes,
significance in renal and cardiovascular patients'
it is crucial to identify and intervene early in acute
disorders since it is associated with inflammation [14].
coronary syndrome (ACS) patients who are at a high
The current study was conducted to explore
risk of CIN.
correlation between monocyte to HDL ratio and CIN
In patients with ST-segment Elevation
after primary PCI in patients presented with STEMI.
Myocardial Infarction (STEMI) within 12 hours of the
start of symptoms, primary PCI is the preferable
PATIENTS AND METHODS
reperfusion technique, if it can be completed quickly
This is a case control study that included 80
(i.e., within 120 minutes of the STEMI diagnosis) by a
patients with acute STEMI admitted to Menoufia
skil ed team. When a patient presents late (12-48 hours
University Hospital and Nasser Institute Hospital who
fol owing the beginning of symptoms), a regular
underwent primary PCI from May 2019 to September
primary PCI approach should also be taken into account
2021.
[4,5,6]. As pathophysiological causes of CIN, it has been
According to the definition CIN [15] as a 25%
suggested that vasoconstriction, oxidative stress, free
increase in serum creatinine from baseline or a 0.5
radical damage, endothelial
dysfunction,
and
mg/dl increase in absolute value within 48-72 hours of
inflammation [7,8].Age over 70, nephrotoxic drugs,
intravenous injection of contrast media. Patients were
impaired left ventricular systolic function, chronic
divided into two groups and placed in the fol owing
kidney disease (CKD), and diabetes mel itus (DM) have
treatment groups: Patients in Group A experienced
al been identified as risk factors for the development of
contrast-induced nephropathy, but patients in Group B
CIN [9,10].
did not have such a condition.
There are several risk score models that have been
Because they had al been diagnosed with acute
created for CIN prediction. However, the majority of
STEMI, al research participants were eligible for
these models rely on characteristics that are unknown at
primary PCI. In the absence of LV hypertrophy or
admission [11,12,13]. To increase the early detection of
LBBB, the fol owing ECG abnormalities are indicative
1069
Received: 28/07/2022
Accepted: 30/09/2022
c:\work\Jor\vol901_160
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1075-1081
Bronchoscopic Cryotherapy in The Treatment of
Endobronchial Typical Carcinoid
Ahmed S. Fadaly1*, Amr El Sayed Tawfek1, Mamdouh Elsharawy1,
Mohammed Mehriz AboZaid2, Ahmed Mohamed Said2, Karim Elfakharany1
Departments of 1Cardiothoracic Surgery and
2Chest Diseases, Faculty of Medicine, Zagazig University, Zagazig, Egypt
*Corresponding author: Ahmed S. Fadaly, Mobile: (+20) 01272806252, E-Mail: ahmedfadalys@gmail.com
ABSTRACT
Background: Lung carcinoid tumors are low grade cancerous tumours that develop from neuroendocrine cel s that have
become more common recently. Endobronchial bronchoscopic cryotherapy has gained interest by cardiothoracic
surgeons as an alternative to the surgical bronchotomy.
Objective: The aim of the current study is to assess the efficacy of bronchoscopic cryotherapy in the treatment of
endobronchial typical carcinoid.
Patients and methods: A prospective control ed clinical trial included 30 patients presented with endobronchial typical
carcinoid from the January 2021 to the August 2022. Patients were randomly divided into two equal groups. Group A
included patients who had excision of the endobrochial mass using bronchscopic cryotherapy, and Group B included
patients who had excision of the endobrochial mass using open surgical bronchotomy. Fol ow up of the patients was
performed on regular basis clinical y, radiological y and by bronchoscopic evaluation.
Results: The Hospitalization period was shorter in Group A (6±2 hours), than in Group B (8±3 hours) showing a
statistical y significant difference. There was a high statistical y significant difference between both groups regarding
the postoperative scar presence (0 % in Group A vesurs 100% in Group B). Intraoperative and peri-operative data
showed a non-significant difference (p>0.05) between both studied groups.
Conclusion: Bronchoscopic cryotherapy is an efficient and safe procedure for the excision of endobronchial typical
carcinoid.
Keywords: Cryotherapy, Bronchotomy, Typical carcinoid.
obstructed bronchus by a malignant tumour. The use of
INTRODUCTION
extremely freezing temperatures in cryosurgery is to
Lung neuroendocrine tumours differ greatly from
remove aberrant or diseased tissue. This technique was
common carcinoid to smal cel lung carcinoma.
detected to be a cheap, an effective and a safe procedure
Carcinoid tumours are low grade malignant tumours of
in the re-canalization of the obstructed airway when
the lung that develop from neuroendocrine cel s (1).
compared to other costly procedures (3).
These cancers occur in less than 5% of al primary lung
Cryotherapy has significantly decreased the
tumours. The reported incidence of pulmonary
probability of local recurrence when used in early stage
carcinoid tumour has grown over the past three decades.
of non-smal cel lung cancer. However, bronchoscopic
Afro-American and Asian people are more likely to get
excision must be done in careful y selected patients with
these tumours. It is believed that the rise in disease
specific criteria (5,6). The aim of the current study is to
awareness is related to this rise in incidence (2).
assess the efficacy of bronchoscopic cryotherapy in the
According on mitotic number, architectural
treatment of endobronchial typical carcinoid.
disturbances, and necrosis status, carcinoid tumours are
categorized into typical and atypical subtypes. The most
PATIENTS AND METHODS
wel -differentiated and least physiologically aggressive
Study design and population:
variety of pulmonary neuroendocrine tumours is
This prospective randomized control ed clinical
thought to be typical carcinoid tumours of the lung.
trial was performed in 2 tertiary hospital centres
These tumours typical y develop slowly and seldom
(Zagazig University Hospitals and Al-Obour Hospital).
spread to other organs (2,3).
These hospitals are serving multiple health centres that
Currently, the ideal treatment for lung carcinoid
introduce the health services to about 12 million
tumours is surgical excision. But with al forms of lung
populations. The study was performed over 20 months
cancer, it is advised to spare the lung tissue as much as
from January 2021 to August 2022.
possible. Bronchscopic approaches were introduced as
Inclusion criteria were intraluminal typical
possible therapeutic options to excise the endobronchial
carcinoid with diameter <20 mm on computed
typical carcinoids in selected cases. The commonly
tomography scan, volume <5 cm3, smal base<1.5 cm2
used techniques are laser therapy, cryotherapy and
and without lymph node invasion or suspected
argon plasma coagulation (4,5).
locoregional metastasis.
Bronchoscopic cryotherapy has gained popularity
Exclusion criteria were atypical carcinoids, carcinoid
among surgeons. It showed efficacy in the re-
tumours that were peripheral y located, radiologically
canalization of the partial y and/or completely
1075
Received: 28/07/2022
Accepted: 30/09/2022
c:\work\Jor\vol901_161
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1082-1086
Predictors of Mortality in Hospitalized Patients with
COVID-19 Infection. A Single Center Follow Up Study
Rasha M. Emam, Elham A. Abdelghany, S. Rabea Shehata, Ali Omar Abdelaziz*
Department of Chest Diseases, Faculty of Medicine, Minia University, Minia, Egypt
*Corresponding author: Ali Omar Abdelaziz, Mobile: (+20) 01142741126, E-Mail: omran282@yahoo.com
ABSTRACT
Background: Coronavirus disease 2019 (COVID-19) is a condition brought on by severe acute respiratory syndrome
coronavirus 2 (SARS-CoV-2). It is a significant global cause of il ness and mortality. Finding modifiable risk variables
might help lower COVID-19 infection-related mortality. Objective: The aim of the current study to identify the factors
associated with mortality in patients admitted with COVID-19 in our Minia University Cardiothoracic Hospital.
Patients and methods: A total of 329 real-time polymerase chain reaction (PCR) confirmed COVID-19 infected
patients were subjected to complete history taking, general and local chest examination, and some laboratory
investigations (Total leucocytic count "TLC", lymphocyte count, serum ferritin, D dimer, C-reactive protein "CRP" and
Lactic Dehydrogenase "LDH"). Patients were fol owed up from admission to discharge. They were assessed regarding
need for non-invasive (NIV) or invasive mechanical ventilation (IMV) and duration spent on them if present and also
regarding length of hospital stay and mortality.
Results: The study showed that non-survivors had significantly higher age than survivors (P-value 0.0001).
Hypertension was more prevalent in non-survivor group (72.1%) than survivors (47.3%) (P-value 0.0001). Also,
Diabetes Mel itus was significantly found to be more in non-survivors (65.4%) than in survivors (41.8%) (P-value
0.0001). Moreover, comorbid cardiac disease was presented more in non-survivors (15.4%) than survivors (8.00%) (P-
value 0.036). Regarding laboratory parameters, significantly higher TLC, serum ferritin, D dimer, CRP and LDH and
lower lymphocytic count were observed in the non-survivor group (P-value 0.0001 for all). Regarding mechanical
ventilation use, more non-survivor patients required NIV and IMV with more days spent on them (P-value 0.0001 for
all). Conclusions: Older age, hypertension, DM, cardiac disease, higher TLC, serum ferritin, D dimer, CRP, LDH and
lower lymphocytic count are associated with higher mortality in COVID-19 infected patients. Also, need for mechanical
ventilation whether invasive or non-invasive is associated with higher mortality.
Keywords: COVID-19, Survivors, Non-survivor, Fol ow up study, Minia University.
INTRODUCTION
escalation of care for respiratory support, and targeted
Since its initial appearance in Wuhan, China in
use of possible antiviral or immunomodulatory drugs.
December 2019, the coronavirus disease 2019 (COVID-
Identification of modifiable risk factors al ows
19) has spread quickly around the world (1). The severity
al eviation of risk prior to infection.
of the outbreak and the extraordinary rates of
The aim of the current study to identify the factors
transmission led to the World Health Organization
associated with mortality in patients admitted with
classifying it as a pandemic (2).
COVID-19 in our Minia University Cardiothoracic
A large portion of the information describing the
Hospital.
traits and risk factors of patients for fatal il ness and
severe sickness comes from Chinese case series with
PATIENTS AND METHODS
unadjusted analysis. It is unclear whether such results
The current fol ow-up study was conducted in
can be applied to other populations. Through
Minia Cardiothoracic University Hospital, during the
multivariable analysis of 171 patients in Wuhan, older
period from January to August 2021.
age and D-dimer levels more than 1 g/ml were found to
Al patients (total 329 patients) who were
be independent predictors of hospital mortality (3). Heart
hospitalized with COVID-19 infection during the study
disease, hypertension, chronic lung disease, chronic
period were included in the analysis. Our cohort
renal disease, and other conditions have also been
included any patient above the age of 18 years old who
linked to severe il ness or mortality in China (4, 5). In
were admitted to our hospital and had a nasopharyngeal
addition to other chronic il nesses, in a study of 20133
swab tested positive for SARS-CoV-2 before to or
hospitalized UK patients, Docherty et al. also
during their stay.
discovered these characteristics as separate risk factors
Patients were subjected to complete history taking,
for mortality (6).
a thorough general and local chest examination, and a
Black and Asian ethnic groups are more likely in
few laboratory tests (total leucocytic count, lymphocyte
the UK to test positive and require hospitalization,
count, serum ferritin, D dimer, C-reactive protein, and
raising concerns about the danger of mortality from
lactate dehydrogenase). From admission through
Covid-19 in these communities (7). For effective patient
release, patients were monitored.
treatment, it's crucial to be aware of the risk factors for
Patients were fol owed up from admission to
COVID-19-related hospital mortality, including as
discharge. They were assessed regarding need for non-
clinical and col aborative decision-making, prompt
invasive (NIV) or invasive mechanical ventilation
1082
Received: 28/07/2022
Accepted: 30/9/2022
c:\work\Jor\vol901_162
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1087-1097
Diagnostic and Interventional Role of Magnetic Resonance Imaging and
Ultrasound in Painful Wrist Conditions
Nouran Abd Al Aziz Al Aswad*1, Samah Ahmed Radwan1, Mohamed Ahmed Esmail1,
Hanan Mohamed El-Saadany2, Atef Hammad Teama1
Departments of 1Radiodiagnosis and 2Physical Medicine, Rheumatology and
Rehabilitation, Faculty of Medicine, Tanta University, Tanta, Egypt
*Corresponding author: Nouran Abd Al Aziz Al Aswad, Mobile: (+20) 01120914330,
E-Mail: nouran.alaswad@med.tanta.edu.eg
ABSTRACT
Background: Ultrasound (US) is the best technique for imaging tendons as it al ows dynamic tendon examination.
Magnetic Resonance Imaging (MRI) can be utilized to enhance detection and evaluation of several wrist disorders.
Magnetic Resonance arthrography (MRA) is the modality of choice for triangular fibrocartilage complex (TFCC)
assessment. Objective: The aim of this work was to evaluate diagnostic and interventional management of MRI and
US in painful wrist conditions.
Patients and Methods: This prospective study was carried out on 50 patients aging from 12 to 66 years with wrist pain.
Al patients were subjected to MRI, MRA and US examination.
Results: US predicted bone fracture, ganglion cysts, late avascular necrosis, first, second, third, fourth and sixth
(extensor carpi ulnaris) compartment tendon involvement, flexor tendon injury, median nerve involvement, rheumatoid
arthritis and osteoarthritic changes.
Conclusions: US showed promising results regarding the examination of superficial bony and soft tissue structures of
the wrist. However, MRI is better for evaluation of internal wrist derangement. Ultrasound is also highly operator
dependent. MRA is highly accurate for the evaluation of TFCC and ligamentous injury of the wrist joint.
Keywords: Magnetic Resonance Imaging, Ultrasound, Wrist Conditions.
INTRODUCTION
Pain in the wrist can be either acute, occurring
This research aimed to compare the effectiveness of
suddenly after an accident, or subacute, occurring
MRI and US for diagnosing and treating painful wrist
gradual y over time, with or without an acute injury [1].
problems that required intervention.
The evaluation of patients with wrist and hand
discomfort might reveal a wide range of pathologic
PATIENTS AND METHODS
disorders. Tenosynovitis, trigger finger, De Quervain's
In this prospective study, we looked at 50
disease, and ganglion cyst are a few examples of these
patients, with ages ranging from 12 to 66 years old (34
disorders[2].
males and 16 females). During the 24 months from
The most accurate method of visualizing tendons is
January 2020 to May 2022, patients from the
ultrasound (US). Its ability to examine tendons in
Orthopedics and Physical Medicine and Rehabilitation
motion is a significant improvement over MRI [1]. US is
Departments at the Faculty of Medicine at Tanta
preferable to MRI and CT for evaluating peripheral
University Hospital were referred to the Radiodiagnosis
nerves because it provides more clear pictures [3].
Department for ultrasonography and MRI examinations
Tendon sheaths, which are used for injecting drugs
(with the exception of 5 cases, who were examined in
into joints, are useful in the treatment of many different
the Radiodiagnosis Department at Cairo University
conditions. Recent advances have made US a viable
Hospital).
imaging modality due to its low cost, high efficiency,
This research enrol ed participants who were
and lack of radiation [4]. So, as to direct less invasive
experiencing wrist pain.
percutaneous methods for the treatment of certain
Patients intolerant of contrast administration,
diseases [5,6].
particularly those with compromised renal functions,
The primary goals of US-guided interventional
patients who are claustrophobic, and patients who
therapies are symptom management and postponement
cannot have an MRI test due to a pacemaker, a critically
or elimination of surgical intervention [7].
positioned metal ic foreign body, or incompatible
Since MRI can distinguish between bone marrow,
vascular implants were excluded.
ligaments, tendons, cartilage, muscles, nerves, and
Orthopedic and Physical Medicine Departments
blood vessels, it can be used to improve the detection
at Tanta University Hospitals and, in 5 cases, at Cairo
and evaluation of numerous wrist disorders [8]. The
University Hospitals conducted thorough examinations
triangular fibrocartilage should be evaluated with a
and reviewed al available investigations for al patients.
magnetic resonance arthrogram (MRA) after
MR arthrography was conducted in 9 cases, and US
gadolinium-containing contrast material has been
guided operations were performed in 13 cases, al with
injected (TFC). TFC evaluations are best performed by
high resolution US examination, MRI (1.5 T)
MRA [9].
examination with or without IV contrast according to
the indications. When possible, we also compared our
1087
Received: 01/08/2022
Accepted: 02/10/2022
c:\work\Jor\vol901_163
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1098-1101
Dutasteride for Androgenetic Alopecia: Review Article
Mohammed Youssef M. Alzaid
Department of Dermatology, Alnakheel Medical Complex, Riyadh, Saudi Arabia
Corresponding author: Mohammed Youssef M. Alzaid, Mobile: 00966549059906, E-Mail: m_alzeed@hotmail.com
ABSTRACT
Background: The disorder known as androgenetic alopecia (AGA), which is androgen-mediated, is characterised by a
gradual loss of apparent scalp hair density. Dihydrotestosterone (DHT), which causes hair fol icles to gradual y shrink
and thin out, targets genetical y susceptible hair fol icles. Hair loss, which typical y starts at the hairline on both sides
of the forehead, eventual y causes the hair on top of the head to fal out. Dutasteride, a dual 5ARI, has been utilised in
the clinic to treat AGA, demonstrating a unique mechanism and potent therapeutic impact. For patients with AGA,
dutasteride could be an alternate therapy.
Objective: This article aimed to highlights the dutasteride for androgenetic alopecia.
Methods: PubMed, Google scholar and Science direct were searched using the fol owing keywords: Dutasteride, Hair
loss and Androgenetic alopecia. The authors also screened references from the relevant literature, including al the
identified studies and reviews, only the most recent or complete studies were included.
Conclusion: Dutasteride is now becoming popular treatment option in AGA, due to its good response for treatment
Androgenetic alopecia.
Keywords: Dutasteride, Hair loss, Androgenetic alopecia.
INTRODUCTION
gland, brain, dermis, and epidermis, among other
The most frequent cause of patterned hair loss in
places, but its purpose is stil unknown (12). When DHT
susceptible men and women is androgenic alopecia
binds to the androgen receptor, the hormone-receptor
(AGA). AGA is a polygenetic, complex il ness that
complex triggers the genes that cause the massive,
affects 4050% of Caucasian women and 80% of
terminal hair fol icles to gradual y diminish. The vel us
Caucasian men throughout life (1). Men's predominance
hairs that are the signature of AGA are produced as a
in Asian and African populations has decreased to
result of shorter anagen and smal er matrix sizes in
approximately 14% (2).
succeeding hair cycles (12). Finasteride is less effective
The most typical kind of hair loss in males is
than dutasteride, a second-generation 5 aR inhibitor,
known as male androgenetic alopecia (AGA). More
which only reduces DHT blood levels by 70%, because
than 90% of al male instances of alopecia are due to it
it has the ability to block both type I and type II
(1). When males who are genetical y prone to it are
isoenzymes (7).
exposed to androgens, it happens. AGA may have an
At 0.5 mg per day, dutasteride, an inhibitor of
adverse effect on a patient's quality of life and may
type I and type II 5 alpha-reductase, is approved for the
hinder their capacity for lead fulfil ing social and
treatment of symptomatic BPH. It is 100 times more
professional lives (3). AGA may also result in indirect
potent than finasteride in inhibiting type I 5 alpha-
physical injury, such as sunburn, from exposure to UV
reductase, while it is roughly three times as effective at
radiation and hair loss (3). Additional y, hypertension,
inhibiting type II 5 alpha-reductase (13). Finasteride
hypercholesterolemia, and myocardial infarction may
lowered serum DHT by 70% at a dose of 5 mg/d, but
al be made worse by AGA (4). The only therapies
dutasteride reduced blood DHT levels by more than
approved by the FDA are topical minoxidil and oral
90% at a dosage of 0.5 mg/d (13, 14). Despite only having
FIN, although their effectiveness is only moderate (40
a license to treat symptomatic BPH, dutasteride has
60%) (5).
been tested for the treatment of AGA. Dutasteride has
Circulating androgens, microinflammation, and
been shown in trials to dramatical y enhance scalp
endocrine abnormalities are some of the factors that
covering, minimise additional hair loss, and boost
contribute to the multifactorial, polygenetic condition
patient satisfaction when taken as the main medication
known as AGA (4-6). It drastical y lowers quality of life
for the treatment of AGA (15).
and frequently causes mental suffering. Fundamental y,
The class of medications known as 5-alpha-
the 5--reductase (5 aR) enzyme's Dihydrotestosterone
reductase inhibitors includes dutasteride that inhibits5-
(DHT) that is produced via the local and systemic
alpha-reductase enzyme activity. Dihydrotestosterone
conversion of testosterone, is the primary pathogenic
(DHT), an androgen hormone that has been associated
mechanism for AGA.
to male pattern hair loss, cannot be produced by your
Three isoenzymes, types I, II, and III, make up 5
body when you take this family of medications. The
aR (9). The key locations for type I are hair fol icles,
development of male sex traits including body and
sweat glands, and sebaceous glands, whereas the
facial hair depends heavily on DHT. The end outcome
primary sites for type II are the prostate and the male
of this is thin hair, a receding hairline, and hair loss
genitalia, including the inner root sheath of hair fol icles
around the crown (top of head). The most prevalent kind
(10, 11). Type III has been discovered in the mammary
1098
Received: 03/08/2022
Accepted: 04/10/2022
c:\work\Jor\vol901_164
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1102-1108
Study of Lipoprotein Lipase Gene Variants in Dyslipidemic Type-2 Diabetes Mellitus
Dina Aly Ezzat1 , Nevine Ezz El deen El Abd1, Engy Mahmoud Ahmed Mahmoud1 , Hend A El Sheimy2
1Department of Clinical and Chemical Pathology
2 Department of Internal Medicine
Faculty of Medicine, Cairo University
*Corresponding author: Dina Aly Ezzat, Mobile: 0111727555,
https://orcid.Org/0000-0003-3317-4210, Email: dina.ezzat@kasralainy.edu.eg
ABSTRACT
Background: Diabetic dyslipidemia is an important factor in the development of diabetic vascular complications. It may
be caused or aggravated by variants of the genes coding for enzymes and proteins involved in lipoprotein metabolism as
lipoprotein lipase (LPL).
Objective: To identify the genotype distributions of LPL (rs320) and (rs1801177) and to study its associative role in the
development of diabetic dyslipidemia in Egyptian patients.
Subjects & Methods: This cross-sectional case-control study was conducted on 200 subjects, 140 patients with T2DM and
60 sex- and age-matched control subjects. Lipoprotein lipase (LPL) gene variants (rs320 & rs1801177) were genotyped by
real-time PCR using the al ele discrimination by TaqMan assay.
Results: Diabetic patients with dyslipidemia had a higher frequency of TT (wild) genotype of LPL (rs320) in comparison to
non dyslipidimic patients (p=0.034). However, there was no difference between any of studied groups regarding LPL
(rs1801177) genotype distributions. Mutant variant of LPL rs1801177 gene of diabetic dyslipidemia group was associated
with increased triglycerides (TGs)
, cholesterol, low density lipoprotein cholesterol (LDLc) (p= 0.001), & decreased high density lipoprotein cholesterol
(HDLc) (p=0.004) .Also, mutant variant of LPL rs320 gene had higher levels of TGs, cholesterol, & LDLc levels (p=
0.011, 0.001, 0.001 respectively), and lower levels of HDLc cholesterol (p=0.001) in the same group.
Conclusions: Association was detected between LPL (rs320) & (rs1801177) gene variants and dyslipidemia in diabetic
patients. The interaction of LPL (rs320) and LPL (rs1801177) possibly plays a role in diabetic dyslipidemia.
Keywords: LPL, Real time PCR, Dyslipidemia, Diabetes mel itus.
INTRODUCTION
limits the removal of lipoproteins from the body, including
Type 2 diabetes mel itus (T2DM) is a chronic
those produced by endogenous sources like VLDL and
metabolic disease of high prevalence, characterized by
exogenous sources like chylomicrons [4].
hyperglycaemia with disruption of protein and lipid
Deficiency or dysfunction due to genetic
metabolism. T2DM is mainly caused by insulin resistance
variations of LPL resulted in various diseases as
among other factors. T2DM affects nearly 15.6 % of
atherosclerosis, obesity & diabetic dyslipidemia & insulin
Egyptians aged 20 - 79 years, hence it's considered as a
resistance. In T2DM, the increased TGs serum level and the
public health issue of great impact on morbidity, mortality
decreased HDL level is commonly related to dysfunction or
and health care resources [1]. T2DM patients are at
deficient LPL activity [5]. Variants of LPL found in 88
increased risk of vascular complications including
locations of DNA. Functional single nucleotide variation
cardiovascular disease (CVD), dyslipidemia is a key
affect whether synthesis or function of LPL including
factor for such aggravated risk [2].
(rs328), which is considered among the most important
Alterations in the characteristics of lipoproteins (both
variations of this gene [6]. The LPL (rs320) (minor al ele
quantitative and qualitative), genetic predispositions,
A/G) contributes to an improved lipid profile, it has a
lipoprotein metabolism degradation, and environmental
protective effect (low TG and LDL and high HDL).
factors are the primary causative agents of dyslipidemia in
Conversely, the existence of the common al ele (T) is
diabetes. Researchers have revealed that variants of genes
connected to atherogenic dyslipidemia with higher TG
coding proteins and enzymes involved in lipoprotein
blood levels [4].
metabolism may play a significant role the occurrence of
The purpose of this research was identification of the
diabetic dyslipidemia [3].
LDL (rs320) and (rs1801177) genotype distributions and
The gene of lipoprotein lipase (LPL) codes for a
studies its associative role in the development of diabetic
LPL protein made up of four hundreds and seventy five
dyslipidemia in Egyptian patients.
amino acids and is made up of 10 exons and 9 introns, found
in region 21.3 on the short arm of chromosome 8. (8p21.3).
SUBJECTS & METHODS
LPL hydrolyzes TG in circulating lipoproteins, which has
Our study was case-control one conducted over 6 months
an impact on serum levels of TG. This is the process that
from January 2021 to August 2022 including 200
1102
Received: 26/10/2022
Accepted: 27/12/2022
Patients and methods
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1109-1114
The Relationship between Antiphospholipid Antibodies and Silent Thrombosis
Detected by Duplex in Patients with Lymphoproliferative Neoplasms
Mohamed Abdelkader Morad ¹, Alaa Alnaggar ¹, Eman Ahmed Abdelaziz ¹,
Sahar Nassef ², Mervat Mattar ¹, Rasha Rawi *¹
Departments of 1Hematology Unit, Internal Medicine Department, 2Vascular Medicine Unit,
Internal Medicine, Kasr Alainy Faculty of Medicine, Cairo University
* Corresponding author: Rasha Rawi, Email: rasharawi@kasralainy.edu.eg, Mobile: (+20)1285885878,
https://orcid.org/0000-0001-6140-5376
ABSTRACT
Background: Numerous epidemiological research and investigations have been done discussing the connection
between malignancies and antiphospholipid antibodies. Several investigations have shown that hematological
malignancies may be related with the development of antiphospholipid antibodies but do not always enhance thrombotic
risk in these patients.
Objective: The aim of the current work was to evaluate the association of lymphoproliferative disorders and thrombosis
evident by duplex in clinically asymptomatic patients and how it relates to having antiphospholipid antibodies.
Patients and methods: Study was conducted on 46 patients with lymphoproliferative disorders diagnosed by either
lymph node biopsy or bone marrow aspirate, biopsy and immunophenotyping. Patients were recruited from Kasr Alainy
Clinical Hematology Department from July 2020 to May 2022. These patients performed duplex on mesenteric and
lower limb vessels to detect recent thrombosis or evidence of old thrombotic events. The patients were also investigated
for PTT, lupus anticoagulants (LA), antibodies of B2 glycoprotein I, anticardiolipin, complete blood picture (CBC), and
kidney and liver function tests.
Results: Mean age of the studied group was 51.17±13.22 years with 52.2% males and 47.8% females. Twelve (26.1%)
of patients showed evidence of thrombosis or remnant of thrombus and recanalization, all of them had no clinical
symptoms while the rest of the patients; 34 (73.9%) revealed no signs of thrombosis. There was no relation between the
positively found antiphospholipid antibodies and thrombosis in the studied population.
Conclusion: It could be concluded that there is evidence of increased thrombosis in patients with lymphoproliferative
disorders, but no statistically significant correlation in relation to lymphoproliferative diseases and antiphospholipid
antibodies.
Keywords: Duplex, Lymphoproliferative Neoplasms,Silent Thrombosis,Anti-Phospholipid antibodies.
INTRODUCTION
A
ntiph
ospholipid antibodies have been found in a wide
A diverse range of illnesses are included under
range of cancer patients. Numerous case reports and
lymphoproliferative disorders (LPD). They take place
analysis have shown that a subset of people with cancer
when the normal controls on lymphocyte proliferation
who have antiphospholipid antibodies also have
fail, causing the lymphoid cells to proliferate unchecked
thrombotic associations with APS (5).
and independently. This may result in extranodal areas
The immune system's creation of autoantibodies in
envolvement, such as the bone marrow, and
response to tumor antigens, or the synthesis of
occasionally can cause lymphocytosis and/or
monoclonal immunoglobulins with LA and ACL
lymphadenopathy (1) .
activity, and tumor cell secretion of ACL have all been
Patients with cancer, particularly hematological
proposed as mechanisms explaining the link between
cancers, can develop thrombosis,due to the malignancy
aPL and cancer (6). APL antibody levels do not appear
itself or treatment-related (2) . The synthesis of tissue
to reflect their pathogenicity, and the creation of APL
factors and other pro-coagulant chemicals, which
does not always raise the risk of thrombosis in
disrupt the endothelium balance between thrombosis
individuals with hematologic malignancies (6).
and anti-coagulation, is a part of the pathophysiology of
Patients suffering from cancer are already at a
thrombosis associated with malignancy(3).
significant risk of thrombosis, and this risk is increased
Antiphospholipid
antibodies
(APL)
are
when the patients are APL carriers because cancer can
autoantibodies directed towards complexes of anionic
act as the second hit that triggers thrombosis. However,
phospholipids and protein-phospholipid. It is associated
the occurence of APL-related complications is less
with antiphospholipid syndrome (4).
frequent in patients suffering from hematological
Antiphospholipid syndrome (APS) characterized
cancers and is even rare in patients with
by thrombosis of veins or arteries, recurrent abortion in
lymphoproliferative malignancies (7) .
women, and persistent laboratory evidence of
The study's goal was to look at the relationship
antiphospholipid antibodies. The most commonly
between lymphoproliferative diseases, thrombosis, and
identified APL antibodies are anticardiolipin (ACL),
antiphospholipid antibodies (LA, aCL IgG and IgM,
lupus anticoagulant (LA), and anti-2-glycoprotein I
and anti-2GPI IgG and IgM).
(anti-2GPI) (4).
1109
Received: 28/7/2022
Accepted: 30/9/2022
c:\work\Jor\vol901_166
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1115-1119
Highlights on Deferasirox Use and its Renal Toxicity in
Children with Beta Thalassemia Major
Hanan Abdelaziz Ahmed 1*, Khaled M Salama1, Ahmed M Kaddah1,
Rehab E Mohamed2, Mai M Abdelsalam1
1Departments of 1Pediatrics, 2Clinical and Chemical Pathology, Faculty of Medicine, Cairo University, Cairo, Egypt
*Corresponding author: Hanan A Ahmed. Mobile phone : (+20)1222215218. E-mail : hannan.abdelaziz@yahoo.com
ABSTRACT
Background: Thalassemia is a hereditary disorder due to imbalance between /-globin chains. This leads to early
hemolysis. It is of two type, and -thalassemia which is more sever needs lifelong follow up, treatment, by RBCs
transfusion, to compensate for the drop in hemoglobin. This leads to increased iron stores and overload, excess iron
deposited in different organs and kidneys. This leads to overproduction of free radicals; that causes organ damages.
Objectives: This study aimed to highlight the prevalence of renal injury in patients with -thalassemia major, comparing
subcutaneous and new oral iron chelating agents, and their effects on the renal functions.
Patients and methods: This case control and observational study included a total of 60 thalassemia major patients aged
between 5 and 24 years who were following up at the Hematology Outpatient Clinic, Department of Pediatrics, Cairo
University Hospitals. All patients were regularly transfused and receiving regular chelation program. Patients were
divided between three groups.
Results: There were no significant differences between the three groups regarding glomerular filtration rate (p> 0.05),
and between Deferiprone and Deferoxamine groups regarding the age, serum ferritin, serum cystatin C and urinary 2-
MG (p> 0.05). There were significant differences between Deferasirox group and both Deferiprone and Deferoxamine
groups regarding serum ferritin, serum cystatin C and Urinary 2-MG (p< 0.05).
Conclusion: Younger patients who are on iron chelation therapy with deferasirox needs regular assessment of renal
dysfunction markers as having relatively higher levels of serum ferritin, serum cystatin C and urinary 2-MG.
Keywords: Thalassemia, Deferasirox, nephrotoxicity,
INTRODUCTION
An autosomal recessive illness called beta
The included participants were divided into three
thalassemia is defined by an imbalance (reduction) in
groups; Group I (Deferasirox) included 14 patients
the production of the beta strand of hemoglobin, which
maintained on deferasirox, Group II (Deferiprone)
results in early hemolysis, significant anemia, and
included 27 patients maintained on Deferiprone, and
continuous, lifelong blood transfusions to enhance
Group III (control) included 19 patients maintained on
general health (1).
Deferoxamine.
Multiple organs, including the kidneys, experience
iron deposition because of frequent, repeated blood
Inclusion criteria
transfusions; hence, iron chelation therapy must be
Beta-thalassemia major patients aged from 5 to 24 years
initiated to reduce iron load and associated morbidity (1).
who were on regular blood transfusion and receiving
Thalassemia patients may experience renal
regular chelation programs.
dysfunction as of DFO side effects, iron deposition in
the kidney, or other causes such as lipid peroxidation,
Exclusion criteria
stress oxidation, generation of free radicals, and
1- Patients with history suggestive of recurrent urinary
thrombosis (2,3) release free radicals and thrombosis (3).
tract infections.
The aim of the current work was to highlight and
2- Patients who had any chronic kidney disease or
detect the early renal involvement and the value of new
chronic systemic illness.
bio markers of renal involvement, for example serum
3- Patients with history of any nephrotoxic drug use.
cystatin C and urine 2-microglobulin (2-MG) (4,5).
All the patients enrolled in the study were subjected
MATERIALS AND METHODS
to the following:
This case control and observational study included
Comprehensive history taking with stress on: History
a total of 60 thalassemia major patients aged between 5
including personal items like age, sex, duration, and
and 24 years who were following up at the Hematology
volume of blood given as well as type of iron chelation
Outpatient Clinic, Department of Pediatrics, Cairo
therapy and the figure of mean serum ferritin levels of a
University Hospitals. All patients were regularly
1-year period prior to the study.
transfused and receiving regular chelation program.
Comprehensive general and local examination
This study was conducted between May, 2016 and May,
Laboratory investigations including:
2017.
1. Blood samples for hematological, biochemical,
and metabolic tests including total bicarbonates,
1115
Received: 23/7/2022
Accepted: 25/9/2022
c:\work\Jor\vol901_167
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1120-1125
Oral Health Education (OHE) Program on Adolescents before and after
Teacher's Training in Diyala City: A Comparative Clinical Study
Sally Talib Da'aj1*, Sahar Najm Abdullah Al-Bayati2,
Aseel Jalil Ibrahim Al-Karawi3, Abdulhameed Salim Hameed4
1Pediatric Dentistry, 2Oral and Maxillofacial Radiology, 3Periodontic's Dentistry
Bilad Alrafidain University College, Diyala, 32001, Iraq
4Oral and Maxillofacial Surgery, Ministry of Health, Diyala, Iraq
*Corresponding author: Sally Talib Da'aj, Mobile: +9647705922411, Email: saly.talib@bauc14.edu.iq
ABSTRACT
Background: Application and development of oral health education (OHE) program is critical to recognize and to
improve the risk of oral and dental health factors among adolescents.
Aim: The purpose of the study was to evaluate the developments in the adolescents' oral health behavior and skills, in
comparison with the pupils' situation before the teachers' training.
Materials and Methods: Seven schools in the city of Diyala-Baquba participated in a randomized controlled
experiment for this research. Eighty males and females aged 12 with good general health participated in this study over
the course of 16weeks to evaluate the effects of a school-based OHE program on their oral hygiene, gum health, and
halitosis. From the selected schools, one subjected to the intervention of OHE program and one of them was a control.
A questionnaire was used to measure both general and oral health. In order to better prepare the teachers, a course lasting
three days planned. To evaluate levels of oral hygiene, we used plaque indices, gingival indices, and halitosis scores to
evaluate their breath.
Results: Results showed that intervention school showed statistically significant improvements in student oral health
indicators such plaque, gingivitis, and halitosis scores. Comparing teacher-led group to the controls and the baseline
assessment, the former was found significantly lower scores for the plaque index, gingival index, and halitosis. There
were significant differences discovered statistically (P< 0.01).
Conclusions: School's children in the teacher-led OHE group showed significant improvements in their oral health,
hygiene, gingival health, and oral malodor.
Keywords: Adolescents, Halitosis, Oral health education, Teacher-led
INTRODUCTION
and extended communities can all be reached through
The mouth's separation from the entire of the body
schools as a means of promoting health and wellness (5).
must be stopped (1). Intractable toothache, low quality of
There is some evidence that the oral health
life, and tooth loss affect millions of people because of
education (OHE) can improve short-term knowledge
the neglect of oral health in the context of broader health
and, to a lesser extent, healthy behaviors like tooth
promotion (2).
brushing and diet (8). All of these reasons, including the
Every year, millions of hours of school and work
desire to learn more about dental hygiene, inspired us to
are lost around the world due to oral disorders that
conduct this study.
impede activity in school, at work, and at home (3).
The state of one's oral health has far-reaching
Aim: To evaluate the developments in the
implications for one's physical and mental health,
adolescents' oral health behavior and skills, in
including one's ability to learn and develop normally, to
comparison with the pupils' situation before the
look and feel attractive, to eat and speak normally, to
teachers' training.
chew and enjoy one's food, to smile and socialize, and
to experience overall psychological and social (4).
MATERIALS AND METHODS
Children's dental health has been linked to their
Study population
overall health, educational achievement, and quality of
This study was designed to be a longitudinal
life (5). Pre-adolescents accounted for 90% of the total
with 16-weeks intervention trial involving a
respondents who indicated an oral health-related impact
representative sample of 12 years old adolescents of
(6). Time trends in both society and dental illnesses
seven primary schools in Diyala-Baquba city. The
require attention to be paid to the adolescent years, when
sample involved was forty adolescents as a teacher-led
many habits that persist into adulthood are initiated (7).
group and forty as a control of both genders.
In developing countries, the prevalence of chronic
disorders including obesity, diabetes, and caries
Ethical aspects
suggests that the quality of life in regards to dental
health, and possibly the overall quality of life, may
Diyala Educational Directorate approved the study,
decline (2). Health education is an essential component
and parental permission and written agreement
of the process of acquiring health-promoting and health-
were collected from participating teenagers.
maintaining behaviors (3).
Over a billion children and their teachers, parents,
Theoretical model of the study
The data includes self-administered questionnaires
1120
Received: 28/07/2022
Accepted: 30/09/2022
Extra corporeal membrane oxygenation Versus Standard of Care lung protective strategy in Void-19 ARDS Mechanically ventilated Critically ill patients
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1126-1131
Extra Corporeal Membrane Oxygenation versus Standard of Care Lung
Protective Strategy in Covid-19 ARDS Mechanically Ventilated Critically Ill Patients
Mohammed Abdel Monem Saeed*1, Ahmed Yehia2, Mohamed Ghanam2,
Alaa Hussein3, Deyaa Mohammed4
Departments 1Critical Care Medicine and 2Cardiothoracic Surgery, Faculty of Medicine,
Helwan University, Egypt
Department of 3Clinical Pharmacist, Faculty of Pharmacy, Helwan University, Egypt
Department of 4Critical Care Nursing, Faculty of Nursing, Helwan University, Egypt
*Corresponding author: Mohammed Abdel Monem Saeed, Mobile: (+20) 01099292999, E-Mail: mohammedicu1@gmail.com
ABSTRACT
Background: The use of venovenous extra corporeal membrane oxygenation (VV-Ecmo) in severe hypoxemic
respiratory failure from coronavirus disease 2019 has been described but reported utilization and outcomes are variable
and detailed data on patient characteristics is lacking.
Objective: Our study aimed to evaluate the effect of extra-corporeal membrane oxygenation (ECMO) when compared
to the traditional conventional protective lung strategy mechanical ventilation for Covid-19 ARDS associated
Respiratory failure.
Patients and methods: This is a prospective study with 1:1 randomization for either to go through ECMO or keep on
conventional mechanical ventilation with protective lung strategy for patient Covid-ARDS associated with respiratory
failure. One hundred patients were randomized in each group.
Results: Hundred patients were in each group. Age was 48.4 ± 9.0 in the standard care mechanical ventilation group
versus 47.8 ± 8.3 in the ECMO group, 54 males and 46 females in the standard care group and 59 males and 41 females
in the ECMO group. Vasopressor weaning was in 40 cases in the standard care group and 64 patients in the ECMO
group with a significant statistical difference in favor of the ECMO group (p-value < 0.001). Also, weaning from
mechanical ventilation was 29 patients versus 66 patients in the standard care group and in the ECMO group respectively
(P-value <0.001). Also the inflammatory markers like CRP, D-dimer, procalcitonin, IL-6 and ferritin were more
improved in the ECMO group, more than in the standard care group with a significant statistical difference (p-value
<0.001),
Conclusion: ECMO in Covid-19 ARDS respiratory failure patients was associated with weaning from mechanical
ventilation & vasopressors and more improvement in the markers profile, together with the radiological point of view
and arterial blood gases parameters when compared to the standard care group together with a great reduction in the
length of stay in the intensive care unit with decrease in the mortality.
Keywords: ECMO, Covid-19, ARDS, Mechanical ventilation.
INTRODUCTION
was comparable to previous observations on the impact
Approximately 40% of Covid-19 patients admitted
of ECMO in patients with other causes of acute
to the critical care unit have severe acute respiratory
respiratory failure (9-14). In a recent study in patients with
failure (1-2). Extracorporeal membrane oxygenation
acute respiratory failure without Covid-19, it was
(ECMO) lowers mortality in patients with Covid-19 and
discovered that ECMO is beneficial for patients with
non-Covid-19 who experience acute respiratory failure
severe hypoxemic acute respiratory failure, which is
despite receiving the best care possible from
indicated by a partial pressure of arterial oxygen to
conventional mechanical ventilation by maintaining gas
fraction of inspired oxygen (Pao2/Fio2) ratio of 80 mm
exchange and minimising lung injury caused by
Hg. At first, there was a shortage of information to
ventilation while the lung recovers (2-6).
inform clinical judgments regarding whether patients
Due to the limited resources available during a
should get ECMO, and developed guidelines were
pandemic, reports of low survival rates in case series of
primarily based on these findings (3-4).
Covid-19-associated acute respiratory failure treated
An accepted statistical method for estimating
with ECMO discouraged doctors from using it early in
treatment efficacy across populations in an uncontrolled
the pandemic, prompting some to advocate for a ban on
context is to use prospective data to simulate a target
its use in Covid-19 patients (7).
trial (15, 16).
Early data from the extracorporeal life support
This analysis approach was a desirable addition to
organisation suggested that 40% of patients undergoing
randomised controlled trials when performing them was
ECMO for acute respiratory failure linked to Covid-19
difficult (e.g., due to poor enrollment rates, crossovers,
would die (8).
stringent inclusion criteria, and lack of equipoise) (17).
Despite variations in mortality rates over time and
When researching a complicated and resource-intensive
across the pandemic, many observational studies came
technique like ECMO during a worldwide epidemic, it
to the conclusion that the outcomes with ECMO in
can provide more significant and more generalizable
patients with Covid-19-related acute respiratory failure
data (3, 18, 19).We compared weaning from vasopressor
1126
Received: 13/08/2022
Accepted: 12/10/2022
c:\work\Jor\vol901_169
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1132-1140
Patients' Evaluation of Causes of Hospital Food Waste in Surgical Wards
Furat Hussein Mahmoud*, Baghdad Hussein Mahmoud
Department of Medical Surgical Nursing, Faculty of Nursing, Helwan University, Cairo, Egypt
*Corresponding author: Furat Hussein Mahmoud, Mobile: (+20)01061819832, E-Mail: furat_hu@hotmail.com
ABSTRACT
Background: The Food and Agricultural Organization (FAO) defines food waste as food fit for human consumption
that is thrown away, whether it has been held over its expiration date or has been allowed to expire. Food waste has
drawn a lot of attention recently and is increasingly recognized as the root of a number of detrimental repercussions,
including problems with health, the economy, society, and the environment. Objective: The current study aimed to
evaluate the causes of hospital food waste in surgical wards as mentioned by patients.
Patients and methods: Design: A descriptive exploratory research design was used. Setting: The study was carried
out in surgical wards of two hospitals, AL-Hussein and Bab-ELSharia University Hospitals, Egypt. Subjects: A
convenient sample of 161 adult patients from both genders who agreed to participate in the study. Tools: Three tools
were used to collect data; Patients personal data, Rate of food waste questionnaire and Acute Care Hospital
Foodservice Patient Satisfaction Questionnaire (ACHFPSQ). Results: The participants' ages ranged between <30and
75 years, 44.1% of them had appetite worse than normal in the hospital and 42.2% said that they had less than usual
intake of food in the hospital. About 30.4% of the studied patients said that the hospital food rarely has been as good
as they expected, and 31.7% of them said that they never be able to choose a healthy meal in hospital.
Conclusion: The research provides a helpful foundation for understanding the meals that patients throw away. The
findings reveal a concerning amount of food waste that calls for a determined action by hospital officials. The
repercussions of this waste may not only have negative effects on the economy or the environment, but also adverse
effects on patients' indirect health. Create a customized, flexible meal reservation procedure based on patient's unique
needs, tastes, and dietary requirements raise the quality of the meal.
Keywords: Patients' evaluation, Surgical Wards, Hospital food waste.
INTRODUCTION
requirements for nutritional quality and adequacy,
Food that is sent to be fed to animals,
palatability, and temperature from the time it is
composting, anaerobic digestion, landfilled or burned
prepared until it is distributed. Therefore, meals
with energy recovery is referred to as food waste
provided throughout the duration of a patient's hospital
(FW). This includes food that has been served but not
stay are a crucial component of hospital care and
eaten, food that has gone bad, and peels and rinds that
patient recovery (4).
are deemed inedible (1).
Numerous factors might have an impact on the
"Wasted food" refers to food that is handled in a
amount of FW. Inappropriate meal length and
variety of ways, such as shipping to landfills or
scheduling, the inability to choose food as near to
combustion
plants,
producing
animal
feed,
mealtimes as feasible, and interruptions during
composting, anaerobic digestion, or donating it to feed
mealtimes, such as rounds by medical staff, can all
the poor. Plate trash, unfinished cooked food, unsold
have a detrimental impact on patient/client happiness
food from retail outlets, and kitchen trimmings; by-
and the amount of food consumed. "Providing food to
products from food and beverage production plants are
the patient is one thing; seeing to it that it is consumed
a few examples. For food that was not utilized for its
is quite another. Due to inadequate assistance with
original purpose, the EPA prefers the general phrase
self-feeding, a lot of hospitalized patients develop
"squandered food" rather than "food waste" since it
malnutrition. The nursing team is in charge of making
indicates that a valuable resource is being wasted,
sure all patients are fed appropriately and sufficiently
whereas "food waste" suggests that the food no longer
(5).
has value and must be managed as waste (2).
Unsatisfactory communication between the ward-
Risk waste and non-risk waste both exist in
based and catering staff is frequently the source of FW
hospital waste. Risk waste often comprises
resulting from unserved meals. All healthcare
pathological, infectious, pharmacological, sharps,
personnel who provide patients with food and
chemical, genotoxic, and radioactive wastes. Garbage
nutritional care have a responsibility to efficiently
and other everyday trash created by food remnants and
manage and prevent FW. Responsibilities may change
their packaging is considered non-risk waste.
in various healthcare contexts. Modern mothers can
Developed nations have well-organized medical waste
play a big part in making this happen. All healthcare
disposal systems. Segregation, internal transportation,
personnel who are in charge of providing patients with
and ultimate disposal are just a few of the operational
food and nutritional care should have the necessary
operations connected to waste disposal that are
training and be competent in the following areas: meal
handled by a well trained staff (3).
planning, food safety, fundamental nutrition,
The hospital's food service is required to always
interpersonal skills, collaboration, diversity and equal
serve food that is safe and meets the established
opportunity, health and safety, and communication (6).
1132
Received: 5/10/2022
Accepted: 5/12/2022
c:\work\Jor\vol901_170
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1141-1148
Peripheral Blood Count Changes in Neonates with Indirect
Hyperbilirubinemia after Phototherapy
Reem Medhat Mourad 1 , Nevien Maher Waked 1, Manar Aref El Desouky1,
Khaled Mohamed Abdelhamid El-Khashab 2, Ahmed Saad El-Gayed 1
1 Department of Pediatrics, Faculty of Medicine, October 6th University, Egypt
2 Department of Pediatrics, Faculty of Medicine, Cairo University, Egypt
Correspondence to: Ahmed S. El-Gayed, Egypt. Tel: (020)1005098331; ORCID 0000-0003-1011-6165;
E-mail: ahmedgayed.med@o6u.edu.eg
ABSTRACT
Background: Phototherapy (PT) is the mainstay treatment for jaundiced neonates, regardless of the cause. Concerns
about phototherapy effects on the blood and immune system have been raised with inconsistent results.
Objectives: The aim of the current work was to assess the effect of phototherapy on peripheral blood count in jaundiced
neonates and determine the effectiveness of double phototherapy based on changes in hemoglobin concentration and platelet
count in studied neonates. Patients and methods: This longitudinal cohort study was conducted on 60 neonates, 26 preterm
(43.3%) and 34 full-term (56.7%) who had physiological jaundice treated with phototherapy. Neonates with hemolytic
jaundice or direct hyperbilirubinemia, and parents refusing the assent were excluded.
Venous blood samples were obtained from newborns with jaundice before PT and 48 hours after exposure to PT in all
studied neonates. Complete blood count (CBC), Total and indirect Bilirubin, CRP were measured before initiating
Phototherapy, 48 hours after PT for all neonates, and CBC within 5-7 days of PT for neonates with a change in blood count.
The blood count before starting PT was considered the control value for individual neonates.
Results: In studied neonates, the mean age at presentation was 3.27±1.7 days and the mean weight was (2.56±0.42) kg. For
all neonates after 48 hours of PT, the mean hemoglobin concentration, RBCs, and platelet counts were significantly
decreased (p< 0.05). In Full term neonates, RBCs count was significantly decreased (p<0.01). Among preterm neonates,
RBCs and hemoglobin concentration were significantly decreased (p-value<0.01), with no significant decrease in platelet
count after 48 hours of PT. Total bilirubin inversely correlated with double PT in all studied neonates (p=0.02). Double PT
also displayed a negative correlation with hemoglobin concentration and platelet count (p=0.02). This indicates that the use
of double PT was associated with a significant decrease in hemoglobin and platelet count in cohorts studied.
Conclusion: It could be concluded that in neonates, phototherapy causes a temporary decrease in hemoglobin concentration,
RBCs, and platelet counts. Hemoglobin concentration and platelet count in newborns are important factors that would
predict the ability of phototherapy to reduce bilirubin in newborns with hyperbilirubinemia.
Keywords: Phototherapy, newborns, hemoglobin, platelet count, bilirubin, jaundice
INTRODUCTION
bond, and circadian cycle problems are among the short-
Neonatal jaundice is a frequent disease that affects
term effects(5).
more than 50% of full-term and premature newborns (1).
In the past years, there has been increased concern
The breakdown of red blood cells elevates serum bilirubin
about phototherapy's effects on the immune and
levels, resulting in jaundice. Bilirubin is mostly coupled
inflammatory systems, as well as its potential genotoxic
to albumin and is transported as 'unconjugated' bilirubin
side effects, which have been linked to neoplasms,
in the blood. Unconjugated bilirubin at high levels can be
melanocytic nevi, and allergic diseases, indicating that
neurotoxic,
resulting
in
acute
or
permanent
phototherapy is not as harmless as previously assumed (5).
encephalopathy that may lead to developmental delay,
Several published studies link phototherapy to
hearing loss, and seizures (2). Severe hyperbilirubinemia
neonatal harm. The expression of adhesion molecules,
accounted for 33% of all NICU admissions in Egypt in
cytokines, and lymphocyte surface markers has been used
2016, with approximately 10 cases complicated by
in certain studies to measure the immunological and
kernicterus each year (3).
inflammatory response (6,7). Others have investigated
Unconjugated hyperbilirubinemia can be treated with
DNA damage in newborns exposed to phototherapy (8,9,10).
phototherapy, exchange transfusion, and IVIG.
In terms of the effects on blood cells, Mrkai et al.
Regardless of the cause, phototherapy (PT) remains the
(11) noted a brief increase in the total number of leukocytes,
standard treatment for newborns with jaundice (4).
while Zarkesh et al. (12) and Jahanshahifard et al.(13)
In general, phototherapy is safe and may have no
observed an increase in circulating leukocytes in
harmful effects on newborns. Skin lesions, thermal and
newborns with jaundice upon phototherapy. Since
electrolyte imbalances that might lead to insensible water
phototherapy effects are difficult to assess in the presence
loss or dehydration, disturbance in the maternal-infant
of baseline disease, Mrkai et al.(11) investigation into the
1141
Received 14/08/2022
Accepted 17/10/2022
c:\work\Jor\vol901_171
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1149-1155
Effect of Climate Change on Health and Critical Care Nurses Practice
Furat Hussein Mahmoud*, Baghdad Hussein Mahmoud
Department of Medical Surgical Nursing, Faculty of Nursing, Helwan University, Cairo, Egypt
*Corresponding author: Furat Hussein Mahmoud, Mobile: (+20) 01061819832, E-Mail: furat_hu@hotmail.com
ABSTRACT
Background: Extreme weather events brought on by climate change have an impact on human health both directly
and indirectly. Increased temperatures and heat domes can exacerbate heart, lung, and renal diseases as well as cause
heat stress and heat stroke. Nurses are essential in assisting communities in adapting to climate change and in fighting
for a more sustainable future on behalf of patients and the environment.
Objective: The current study aimed to explore the effect of climate change on health and critical care nurse's practice.
Subjects and methods: Design: Descriptive exploratory design was used. Setting: The study was conducted at the
New Elkasr ElAini Teaching Hospital in Cairo, Egypt. Sampling: A convenient sample of 84 nurses working in ICUs
and Emergency Unit was used for conduction of this study. Tools: Two tools, 1st one structured interview
questionnaire, 2nd tool, observational guide about the effect of climate change on health and nursing practice.
Results: The majority of the studied nurses think that climate change causes harm for people and patients. Three
quarters of the studied nurses think that climate change causes malnutrition or hunger due to rising food prices. About
two-third of the studied nurses thinks that climate change causes violence, physical and mental harm respectively.
Conclusion: Nurses' awareness of climate change and how it relates to health and practice varied. The role of nursing
in combating climate change remained unclear. The study made clear that critical nurses did not immediately
understand their responsibility in combating climate change. Include climate change in nursing courses so that future
nurses will have the right attitudes toward environmental sustainability.
Keywords: Climate change, Health, Nurses Practice.
INTRODUCTION
and present effects of climate change, make plans for
Climate change is the phrase used to describe the
future requirements, and get patients ready for
gradual rise in global temperatures that is mostly
upcoming and prospective climate change disasters (5).
accelerated by human activities. At the moment, more
Climate change health hazards have frequently
than 90% of people on the planet breathe in harmful
been addressed through the employment of either
levels of air pollution brought on by the extensive
mitigation or adaptation initiatives, which aim to
combustion of fossil fuels, which emits greenhouse gas
lessen the impact of fossil fuel consumption, the
(GHG) emissions to the environment (1). Other human
primary driver of global warming. The continuity of
activities including agriculture and land usage, as well
energy policy, global warming, and more immediate
as the use of fossil fuels in manufacturing,
health threats from heat waves or climate-sensitive
transportation, energy, and industry, also produce
infectious illnesses should all be addressed.
significant amounts of GHGs. These GHGs are the
Additionally, the wider the potential benefit, as with
sole major cause of global warming and the current
any health issue, the further upstream the action (6).
climate problem (2).
Patients are informed by nurses on how
The essential underpinnings of human health and
environmental changes affect their health. Encourage
survival are under attack from climate change. In
sustainable lifestyle choices that lower greenhouse gas
comparison to preindustrial levels, the earth has
emissions. Evaluate the risks and make resources
warmed by more than 1.2°C, resulting in severe and
available to avoid or reduce environmental health
quickly deteriorating health impacts on every continent
problems. In tackling the health effects of climate
(3). At all points in a person's lifelong journey through
change, nurses are on the front lines, according to the
the health care system, nurses believe in providing
International Council of Nurses (ICN). Therefore, just
holistic care. Nurses support all aspects of wellbeing,
as they are devoted to safeguarding and advancing
including physical, mental, emotional, spiritual, and
their patients' health, registered nurses are required to
other types. Because of this, nurses are aware of how
address climate mitigation (reduce or avoid greenhouse
crucial it is to have a healthy lifestyle that benefits both
gas emissions) and climate adaptation (lower
the individual and the environment (4).
sensitivity to detrimental consequences). ICN also
In the next years, nurses should expect to observe
asserts that nurses need to be knowledgeable of and
a rise in illnesses resulting from climate change. In
equipped to deal with climate change (7).
addition to promoting and supporting health and
Earth's climate is changing as a result of both
wellbeing, nurses have a professional obligation to
natural temperature variation and direct human-caused
inform patients and clients about the effects health
global warming (8); these effects show the inextricable
effects of climate change in addition to look into,
links between planetary health and public health. For
promote, and put into practice sustainable policy and
instance, the decade from 2010 to 2019 was the
practice. By doing this, nurses may consider the past
warmest on record, which led to an increase in the
4411
Received: 20/10/2022
Accepted: 20/12/2022
c:\work\Jor\vol901_172
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1156-1161
Assessment of Clinical Profile and Impact of Different Risk Factors among
Scabietic Children at Khartoum Teaching Hospital
Nazik Mohamed Ehadi Ginawi1, Mahadi M.A Shamad2, Huda El Nour Barakat3, Hend Mohamed Hussein*4
1Department of Dermatology, Khartoum Teaching Hospital for Dermatology and Venereology, Khartoum, Sudan
2Department of Dermatology, Tropical Disease Teaching Hospital, Omdurman, Sudan
3Department of Dermatology, Al- Rayan Colleges, College of Medicine, Madinah, Saudi Arabia
4Department of Parasitology, Faculty of Medicine, Ain Shams University, Cairo
*Corresponding author: Hend Mohamed Hussein, Mobile: +966597753677, E-Mail: d.hend_m@yahoo.com
ABSTRACT
Background: Scabies is a widespread health issue that is currently underappreciated, mostly in developing nations.
The WHO's strategy for neglected tropical diseases 20212030, which aims to achieve the unmet Sustainable
Development Goals, recently included scabies.
Objective: This study aimed to assess the clinical profile and the impact of the different risk factors in scabietic
children at Khartoum Teaching Hospital for Dermatology and Venereology, aiming to put scabies in focus and
exploring definitive measures for its control, clarifying the impact of placing scabies control as an achievable and
valuable objective in Sudan.
Subjects and methods: A prospective cross-sectional study was carried out among all dermatological cases of
children that attend Khartoum Teaching Hospital for Dermatology and Venereology in the period from November
2018 to January 2019, among them 144 cases were diagnosed as scabies according to the hospital protocol. one
hundred children aged 1-16 years, were selected according to calculating sample size and applying inclusion criteria.
Data were collected by using pre-designed questionnaire and then analyzed by computer using SPSS.
Results: The overall prevalence of scabies was 6.98%. The highest percent of cases were recorded in the age group
between 6-10 years 41 (41%), 80 cases (80.0%) were presented with nocturnal itching. The site of lesion was in the
finger webs in 92 (92.0%) children,70 cases (70.0%) had burrow lesions, 97 (97.0%) children had 1-10 family
members, 96 (96.0%) children were sharing bed, animals in house were found with18 (18.0%) children.
Conclusion: Scabies prevalence in children in Sudan is high compared to other developing countries. Comprehensive
control strategies are urgently needed. Improvement of socioeconomic conditions, implementing appropriate
educational programs and surveillance system for applying preventive measures, rapid diagnosis and definitive
treatment of scabietic cases are necessary in order to reduce the overall prevalence of scabies.
Keywords: Scabies, Itching, Risk factors, Children.
INTRODUCTION
intimate contact with another person in order to spread
The obligatory human parasite mite Sarcoptes
the mites. The involvement of mites is debatable, but
scabiei var. hominis is the source of scabies, a skin
other writers assert that it is plausible given that they
condition that is extremely infectious [1]. This mite is
can survive outside of humans for more than three
regarded as a human host-specific, obligate cutaneous
days, and this is further confirmed by the recall of live
parasite. Over 175 million individuals are thought to
mites from dust samples taken from clothing, bedding,
be infected with scabies globally, according to
furniture, and floors [5].
estimates from the WHO's Strategic and Technical
Strong lymphocyte, histiocyte, and eosinophilic
Advisory Group (STAG) for neglected tropical
perivascular, dermal, and perivascular inflammatory
diseases (NTDs) in 2017 [2]. The first known human
infiltrates characterise scabies, which will eventually
illness with a recognised aetiology may be scabies.
have high antibody titers that are specific for parasite
More than 130 million individuals are thought to be
antigens. Interleukin-6 (IL-6) and vascular endothelial
affected at any given moment worldwide [3].
growth factor (VEGF) production from healthy human
Scabies infestation has negative effects on patients'
epidermal keratinocytes has increased significantly,
quality of life, especially in underdeveloped and
but granulocyte colony stimulating factor (G- CSF)
resource-limited nations. It is most common in
secretion has only slightly increased. It is well known
children and elderly, immunocompromised persons,
that IL-6 stimulates the growth of keratinocytes, whilst
and it has the potential to cause significant morbidity
IL-8 and G-CSF encourage the development of
and even fatality in susceptible people, particularly in
dendritic cells from monocytes and the growth of
underdeveloped regions with little access to quality
neutrophils. Additionally, IL-6 is known to stimulate
treatment. It can appear as minor epidemics in wealthy
Th1 CD4+ cells to secrete IL-2, which encourages
nations in times of conflict and during natural
their proliferation and differentiation, as well as Th2
catastrophes [4].
CD4+ cells to produce IL-4, which drives antibody
Since the disease is mostly spread by direct skin-
production and is known to increase vascular
to-skin contact, it is usual for family members to
permeability and trigger inflammation, which explains
contract it. According to estimates, a patient with
the edoema seen in scabies lesions. These processes
traditional scabies requires 15 to 20 minutes of
are all known to be induced by IL-6 [6].
1156
Received: 11/08/2022
Accepted: 12/10/2022
c:\work\Jor\vol901_173
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1162-1168
Combined Micro-Needling with Lyophilized Platelet-Rich Plasma versus
Micro-Needling Monotherapy in The Treatment of
Atrophic Post-Acne Scars: Split-Face Study
May H. El-Samahy, Reham Gamal Abbas Ibrahim, Mona A. Ibrahim*
Department Dermatology, Venereology, and Andrology, Faculty of Medicine, Ain Shams University, Egypt
*Corresponding author: Mona Abdel-Halim Ibrahim, Mobile: (+20) 01006228698, E-mail: monaabdelhalim@med.asu.edu.eg
ABSTRACT
Background: Combined micro-needling with platelet-rich plasma (PRP) is an effective treatment option for atrophic
post-acne scars. Lyophilized PRP (L-PRP) is a novel, simpler, standardized preparation of PRP. The combined treatment
of post-acne scars with micro-needling and L-PRP hasn't been previously investigated.
Objectives: This study aimed to compare the effectiveness of the combined use of micro-needling and L-PRP versus
micro-needling only in treating atrophic post-acne scars. Patients and methods: This randomized controlled split-face
study included 20 adult patients with post-acne atrophic scars. One side of the face was treated with micro-needling.
The other side was treated with micro-needling and L-PRP. The treatment was applied at 2 weeks intervals for 3 sessions.
The assessment was done with Antera 3D® camera analyzer. The mean indentation index of each side of the face was
calculated before and two weeks after the last treatment.
Results: Our study showed that the mean age of patients was 28.35 ± 4.87 years, 90% were females, and 20% were
males. 50% had Fitzpatrick skin type III, while the other half had skin type IV. Both micro-needling monotherapy and
combined micro-needling with L-PRP produced significant improvement in the mean indentation index of atrophic post-
acne scars. However, the mean percentage of improvement was higher in the combined treatment group. Side effects
were minimal and transient with both treatment modalities.
Conclusion: Combined treatment with micro-needling and L-PRP showed superior results in improving atrophic post-
acne scars and is regarded as a safe, simple, and cost-effective treatment modality.
Keywords: L-PRP, Post-acne scars, Micro-needling, Dermapen, PRP.
INTRODUCTION
is done by using a sterile dermaroller or dermapen,
Acne vulgaris is a highly prevalent skin
which is made up of a number of fine and sharp needles
condition that affects virtually all teenagers and adults
that penetrate the skin. Multiple microbruises form in
at some point in their lives. The general state of health
the dermis triggering a complex cascade of growth
is unaffected, but acne can leave both physical and
factors that results in collagen production (5, 6).
mental scars that last a lifetime resulting in loss of self-
Micro-needling can also be combined with PRP
esteem. Inflammatory acne lesions might leave lifelong
(7). The latter contains a high concentration of platelets.
scars, and the severity of scaring may rely on delaying
There are several growth factors in the -granules of the
the treatment of acne patients (1). Acne scarring is the
platelets, and these granules are secreted after platelets'
result of skin damage that occurs throughout the healing
activation by aggregation initiators. The secreted
process. Scars are classified into two main categories:
growth factors can cause fibroblastic stimulation,
atrophic and hypertrophic or keloid scars. Most patients
inducing collagen production (8). Lyophilized PRP (L-
have atrophic scars. Atrophic acne scars are sub-
PRP) is a novel technique of PRP that show similar
categorized into ice pick, boxcar, and rolling scars (2).
effectiveness as the conventional PRP. However, it is
There are numerous treatment options for
more time-saving and comfortable for the patients. It
atrophic
post-acne
scars.
Chemical
peeling,
can also deliver a standardized amount of growth factors
microdermabrasion, dermabrasion, laser therapy, punch
per treatment session (9). To the best of our knowledge,
techniques,
dermal
grafting,
tissue-augmenting
combined micro-needling with L-PRP has not been
substances, subcision, micro-needling, and platelet-rich
assessed before in the treatment of atrophic post-acne
plasma (PRP) are some of these. These treatment
scars. Therefore, we aimed to assess the effect of this
modalities show variations in their effectiveness and
combined treatment and compare it with micro-needling
side effects. Generally, invasive techniques showed a
monotherapy in a split-face study.
greater response rate with longer downtime and more
side effects. On the other hand, non- or less-invasive
PATIENTS AND METHODS
techniques are less effective but more comfortable for
Patients: A randomized-controlled open-label split-
patients with shorter downtime. This fact leads to the
face study was done on 20 adult patients having post-
adoption of the concept of combination therapy, which
acne atrophic scars. Patients aged 20 - 36 years old (80%
shows effectiveness with high safety profile (3).
females, 20% males) with Fitzpatrick skin types III
Micro-needling is found in many combination
(50%) and IV (50%). The study was done at the
treatments for post-acne scars. It can be combined with
Dermatology Department of Ain Shams University.
other treatments, such as subcision and chemical peels
Exclusion criteria: Patients with active acne, active
(4). Micro-needling is a minimally invasive technique. It
skin infection, current pregnancy, severe systemic
1162
Received: 29/07/2022
Accepted: 01/10/2022
c:\work\Jor\vol901_174
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1169-1175
The Role of Educational Program in Eliminating Infection Potential
Hazards inside Gynecology and Obstetrics Clinic in Alexandria
Amira Fathy1, Shahinda Rezk2, Amel Elsheredy2, Eglal ElSherbini2
1Governmental Poly-Clinic Center, Borg Al Arab, Ministry of Health, Alexandria Egypt
2Microbiology Department, Medical Research Institute, Alexandria University, Alexandria, Egypt.
*Corresponding author: Shahinda Rezk, Mobile: (+20) 01023020030,
Email: shahinda.rezk@alexu.edu.eg, ORCID: 0000-0003-2916-6226
ABSTRACT
Background: Over the past several decades, we have witnessed a significant shift in healthcare delivery from the acute,
inpatient hospital setting to a variety of outpatient settings. Much of the inpatient care is now delivered in outpatient
settings, using invasive procedures and advanced technologies, which increase the risk for HCAIs.
Objective: To evaluate the role of educational program in eliminating infection potential hazards inside gynecology
and obstetrics clinic.
Material and Methods: Three phases interventional study included before education (phase I) for 3 months, after
education (phase III) for 3 months, and interventional phase of 1-month (phase II) in which educational sessions about
IC standard precautions, environmental cleaning and reprocessing medical devices done.
Result: Contamination level in phase I was 77.8% in bed, 83.3% in table, 63.9% in stethoscope, 80.6% in U/S abdominal
probe, 50% in vaginal speculum after cleaning, and 16.7% in vaginal speculum after sterilization. This level decreased
in phase III to 38.9% in bed, 38.9% in table, 30.6% in stethoscope, 27.8% in U/S abdominal probe, 13.9% in vaginal
speculum after cleaning, and 0% in vaginal speculum after sterilization. The indicator organisms isolated were [MRSA,
Pseudomonas spp., Acinetobacter spp. E. coli, and Klebsiella spp.]. (100%) S. aureus isolates (48/48) were MRSA,
(100%) Acinetobacter spp. (15/15), E. coli (5/5), and Klebsiella spp. (3/3) were multidrug resistant (MDR), and 88.2%
(15/17) of Pseudomonas spp. isolates were MDR.
Conclusion: The educational program in phase II succeeded in achieving a statistically significant reduction in
contamination level (p0.05 at all sites), also achieved a decrease in number of indicator organisms found in all sample
sites.
Keywords: Gynecology, Obstetric clinic, MDR Bacteria, Infection control, Educational program.
INTRODUCTION
involving a wide range of invasive and non-invasive
Any care given in a place where a person does not
procedures using a lot of equipment, which is less likely
remain overnight is referred to as ambulatory care (e.g.,
to have standard cleaning protocols than the equipment
physician offices, urgent care centers, ambulatory
used in the critical settings, so it is more likely to carry
surgical centers, public health clinics, hospital and non-
a risk for transmitting infection (5).
hospital-based clinics, oncology clinics, physical
Hysteroscopy, vaginal specula, and vaginal
therapy and rehabilitation centers). Over the past
ultrasonography probes are among the devices that must
several decades, we have witnessed a significant shift in
be well high level disinfected. Sterilization is required
healthcare delivery from the acute, inpatient hospital
for all instruments, including biopsy tools, that come
setting to a variety of outpatient, ambulatory care
into touch with tissue through the vaginal or cervical
settings, and community-based settings (1, 2).
wall. Additionally, it's important to clean and disinfect
The change resulted from rising healthcare
any surfaces in the environment that could be
expenses and a rise in healthcare consumers. Invasive
contaminated by vaginal or cervical secretions using an
treatments and cutting-edge technologies are employed
EPA-approved solution (6).
often in ambulatory settings, while most healthcare was
Associating with lack of infrastructure, resources,
formerly offered as an inpatient service. Additionally,
and strategies that are supporting infection prevention
much of the same care is now provided in outpatient
and surveillance activities in comparison with inpatient
settings, which increase the risk for health care
settings, all of these make outpatient settings generally
associated infection among patients at ambulatory care
and gynecology and obstetrics clinic specifically a
settings (3).
potential hazard of transmitting infection (7).
Ambulatory care settings provide many services
Many reported outbreaks have been linked to
including diagnostic testing, invasive procedures, and
outpatient clinics and most of them are caused by non-
therapeutic care. As a result of this transition, there is an
adherence to recommended infection control measures
increased risk of contracting a healthcare-associated
and the main mode of transmission was health care
infection in outpatient settings, and these infections are
personnel
(HCP),
contaminated
environment,
not uncommon in outpatient clinics (4).
contaminated equipment, consequently ongoing
One of the ambulatory care settings is the
education and training of HCP on infection control
gynecology and obstetrics clinic, which have high rate
practices and hygiene and environmental cleaning are
of patients visiting the clinic for different purposes and
critical. These outbreaks reports have described
1169
Received: 02/08/2022
Accepted: 04/10/2022
c:\work\Jor\vol901_175
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1176-1183
Efficacy of Extracorporeal Shockwave Therapy versus Corticosteroid
Injection in Patients with Myofascial Pain Syndrome: A Prospective Study
Shaza A. Abdul Basset*, Marwa Y. Mahgoub, Ahmed T. Abou Ghanima
Rheumatology, Rehabilitation, and Physical Medicine Department,
Faculty of Medicine, Benha University, Benha, Qalyubia, Egypt
*Corresponding author: Shaza A. Abdul Basset, Mobile: (+20) 01007368972, E-Mail: shaza.belal@fmed.bu.edu.eg
ABSTRACT
Background: Myofascial pain syndrome (MPS) is a musculoskeletal disorder, that results from trigger points, which
are small, taut skeletal muscle and fascia.
Objective: To compare the efficacy of Extracorporeal Shock Wave Therapy (ESWT) versus corticosteroid injection in
the treatment of patients with MPS of the upper trapezius muscle.
Patients and Methods: This prospective randomized study included fifty patients with MPS who were randomly
divided equally into two groups. The active myofascial trigger points (MTrPs) in the upper trapezius were identified.
Group 1 patients received ESWT 3 times at one-week intervals and group 2 patients received one injection of
corticosteroids. The visual analog scale (VAS), Neck Disability Index (NDI), and pain pressure threshold (PPT) assessed
the outcomes.
Results: VAS scores were 7.24±1.01, 3.72 ±1.43 and 2.44±1.36 at baseline, week-4 and -8 respectively in group1; while
were 7.16±1.03, 5.76 ±1.16 and 5.24±1.48 at baseline, week-4 and -8 respectively in group2. NDI scores were 11±2.63,
7.92±2.63 and 6.52±2.66 at baseline, week-4, and -8 respectively in group1, whereas were 11.16±2.36, 8.72±2.37 and
7.64±2.66 at baseline, week-4 and -8 respectively in group2. PPT scores were 2.81±0.70 at baseline, and 4.64 ±1.03 and
5.54±1.1 at week-4 and week-8 in group1, while, in group2 the scores were 2.89±0.71, 3.92 ±0.81 and 4.08±0.92 at
baseline and week-4 and -8 respectively. VAS, NDI, and PPT pre- and post-treatment results showed statistically
significant improvements in both groups, P <0.001.
Conclusion: ESWT and corticosteroid injection considerably reduced pain intensity, physical impairment, and MTrP
sensitivity to pressure in patients with MPS. ESWT was more effective in the reduction of pain and MTrPs sensitivity
to pressure.
Keywords: Myofascial pain syndrome, ESWT, Corticosteroid injection, NDI, PPT.
INTRODUCTION
musculoskeletal illnesses, and more recently, its
Myofascial pain syndrome (MPS) could affect as
application has broadened the range of MPS therapy
many as 85% of people in general, with an estimated
options (9-12).
prevalence of 46%, at some point in their lives. MPS is
High-pressure air is used to create mechanical
a primary source of persistent musculoskeletal pain (1,2).
energy in high-intensity shockwave treatment. This
The trapezius, a muscle that is sometimes neglected as
energy moves through the tissues as a longitudinal
a cause of temporal and cervicogenic headaches, is
wave. It induces micro-functional and micro-structural
likely the muscle most impacted by the pain, which is
changes that help in revascularization and encourages
mostly felt in the neck, lumbar, and shoulder areas (3,4).
tissue regeneration. According to reports, it can help
One of the primary reasons for missed employment,
with MPS, calcifying tendonitis, and plantar fasciitis
medical appointments, and disability benefits is MPS (5).
discomfort (13).
The name "myofascial" was created since the
Although therapeutic options vary, there is no
pathophysiology of MPS includes various soft tissue
clinical evidence to guide the treatment response and
components of the myofascial unit, such as the
several studies have been conducted to demonstrate the
superficial fascia and deep fascia, in addition to its
effectiveness of different treatments in reducing pain in
primary muscle origin (6). Myofascial trigger points
patients with MPS. Therefore, we conducted this
(MTrPs), which are described as hyperirritable sites
prospective study to compare the efficacy of ESWT
inside a tight band of skeletal muscle or fascia, play a
versus corticosteroid injection in the treatment of
key role in the pathogenesis of MPS. Upon palpation,
patients with MPS of the upper trapezius muscle.
these locations can cause recognizable soreness,
referred pain, and motor or autonomic symptoms (7).
PATIENTS AND METHODS
Traditional MPS treatments include medication
Patients
(such as NSAIDs, steroids, tricyclic antidepressants,
This prospective randomized study compares the
vasodilators, or oral skeletal muscle), injectable therapy
effectiveness
of
shockwave
therapy
against
(such as local anesthetic injections into trigger points
corticosteroid injection for patients with MPS of the
with or without corticosteroids or "dry" needling"),
upper trapezius muscle. Fifty patients were recruited at
physical therapy, and behavioral modification (8).
the Rheumatology, Rehabilitation, and Physical
Extracorporeal Shock Wave Therapy (ESWT)
medicine outpatient clinic of Benha University
has also been steadily employed to treat
hospitals. Patients who agreed to participate were asked
1176
Received: 01/08/2022
Accepted: 02/10/2022
c:\work\Jor\vol901_176
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1184-1188
Comparative Study between Laparoscopic versus Open Orchiopexy in
Peeping and High Inguinal Undescended Testis: Review article
Mostafa Abdel Razek Ahmed1, Ahmad Abolyosr Mohammed1, Abdelrahman Mahmoud Mohamed
Mahmoud1*, Omar Mohammed Elsoghier1,
1Urology Department, Faculty of Medicine, South Valley University, Egypt
*Corresponding author: Abdelrahman Mahmoud Mohamed Mahmoud
E mail: abdo.mahmoud11111@gmail.com
ABSTRACT
Background: Traditional open orchiopexy remains the gold standard for palpable undescended testicles. Several
authors recently noted successful outcomes in therapy of palpable cryptorchidism using laparoscopic approach.
Objectives: This review article aimed to compare outcomes of laparoscopic versus open orchiopexy in peeping and
high inguinal undescended testis.
Conclusion: Both laparoscopic and open orchiopexy were safe & effective in cure of peeping and high inguinal
undescended testis. However, laparoscopic orchiopexy was superior to open orchiopexy as it was associated with better
outcomes as regards final testicular position at the bottom of the scrotum or low level below the mid-scrotal point and
shorter hospital stay. It was also associated with non-significantly higher success rate. Further comparative research
with greater sample size & longer follow-up are required to approve results & to identify risk factors of adverse events.
Keywords: Undescended exams, Palpable cryptorchidism, Laparoscopy, Testicular atrophy, Laparoscopic orchiopexy,
Orchiopexy.
INTRODUCTION
these committed germ cells exist outside of fetus's
Cryptorchidism, & an undescended testis, is
somatic differences. In the fifth week of human embryo
congenital malformation in children. Throughout foetal
development, the gonadal blastema forms and, based on
development, testicle
usually
fails
to
change
the sex-determining gene SRY, either develops into a
from abdomen through the inguinal canal to scrotum. In
testis or an ovary. Prior to this point, both men &
clinical practice, cryptorchidism is classified as inguinal
women gonads are composed of 3 different cell types:
cryptorchidism or intra-abdominal cryptorchidism
entry germ cells, supportive epithelial cells that arises
based on position of testis. However, more than
into either ovarian granulosa cells or testicular Sertoli
eighty percent of cryptorchidism can contact testis
cells, stromal cells produced by gonadal ridge
in groyne area (1).
mesenchyme. Sertoli cells of men equate to granulosa
A form of cryptorchidism testis known as a
cells of women (4).
peeping testis emerges from an internal ring and is
movable between the inguinal area and abdominal
Cryptorchidism
cavity; as a consequence, it is not always felt or visible
Mal-descendus testis is the medical term for when
in the inguinal area. Peeping testis is both diagnostics
one or both testes do not descend into the scrotum.
and therapy challenges. Most common approach
Instead, testis is discovered along normal path of
between paediatric urologists & surgeons is open
testicular descent, & it can be intra-abdominal, inguinal,
surgical cure of such testes. Because of difficulty of
suprascrotal, or high scrotal. Prevalence of preterm
surgical mobilisation of some peeping testes, in addition
birth & low birth weight in boys ranges from 1.1 to
to
significant
problems
like
testicular
45.3% at birth (5).
retraction/atrophy, current research hypothesized that
Cryptorchidism is connected to higher frequency
laparoscopic orchiopexy is a promising alternative
of testicular germ cell tumours (TGCT) in the future.
procedure for such high inguinal testes (2).
When compared to general population, risk of TGCT is
Aim of research was to compare outcome of
enhanced two-five-fold. The testicular dysgenesis
laparoscopic versus open orchiopexy in peeping and
disorder theory, which contends that cryptorchidism
high inguinal undescended testis.
and TGCT have a same fetal origin and is supported by
these findings. (6).
Testis Anatomy
Hypogonadism is traditionally defined as testicular
Adult testis is made up of two parts: gamete
dysfunction caused by androgen deficiency. But, Rey et
portion that provides sperm & endocrine portion that
al. (7) suggested comprehensive definition that would
secretes testosterone. Spermatogenesis takes place
contain age-related testicular dysfunction, such as
in gamete portion, within seminiferous tubules, in
weakened Sertoli and Leydig cell functioning, as well
which Sertoli cells generate and preserve spermatozoa.
as spermatogenesis disorder (8).
Leydig cells in the interstitium among seminiferous
Normal testes include retractile testes & testes in scrotal
tubules produce androgen (testosterone) (3).
position. When a testis is placed outside of the typical
They migrate to gonadal ridge after primitive
line of testicular descent, it is known as an ectopic testis.
gonad's somatic cells have created. It is critical that
In this case, testis can be found in perineal, femoral, or
1184
Received: 10/6/2022
Accepted: 17/8/2022
c:\work\Jor\vol901_177
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1189-1198
Retracted paper
1
Received: 15/08/2022
Accepted: 16/10/2022
c:\work\Jor\vol901_178
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1199-1203
Early Results and Fate of Moderate Mitral Regurgitation in
Patients Undergoing Surgical Aortic Valve Replacement
Mohamed Allam, Ehab Mohamed Elshihy, Alaa-Eldeen Farouk, Omar Alaa*, Omar Dawoud
C
1
ardiothoracic Surgery epa
D
rtment, Faculty of Medicine, Cairo University, Egypt
*Corresponding author: Omar Alaa, Mobile: 01091355358, ORCID: 0000-0001-7561-7847,
Email: omar.mohamed39199@postgrad.kasralainy.edu.eg
ABSTRACT
Background: The management of studied cases with moderate mitral regurgitation (MR) undergoing surgical aortic
valve replacement (SAVR) remains debatable.
Objective: The aim of the current study to investigate the early results and fate of moderate MR after AVR.
Patients and methods: This study was both prospective and retrospective, conducted in the Cardiothoracic Surgery
Department in the Faculty of Medicine at Cairo University, from March 2020 to October 2021. A total 200 studied cases
undergoing AVR with moderate functional MR were screened. The fate of residual MR was evaluated by transthoracic
echocardiography 6 months post-operative, and the prognosis of studied cases with residual MR.
Results: Up to 76% of the studied cases with moderate functional MR after isolated AVR enhanced mitral valve
function, while 18% did not show a significant change, and 6% showed deterioration in mitral valve function over the
short-term follow-up period. The decrease in MR is associated with the degree of LV acute reverse remodeling, which
can be demonstrated by the decrease in LV end-diastolic volume. Perioperative morbidity did not find any significant
variation among studied cases. The clinical outcomes showed significantly improved symptoms during the follow-up
period for all patients. Conclusion: Patients with aortic valve disease and moderate functional MR should undergo AVR
alone. The degree of MR will remain stable or may improve.
Keywords: Aortic valve disease, Mitral regurge, Aortic valve replacement, Follow up study, Cairo University.
INTRODUCTION
Preoperative data: Patients were subjected on
Aortic valve replacement (AVR) is the most common
admission to the following history taking regarding age,
valve surgery to be performed worldwide. In many
gender, NYHA class, and underlying conditions
cases, these patients have an associated mitral valve
(hypertension, DM, COPD, preoperative atrial
(MV) disease. If the degree of mitral disease is severe,
fibrillation, pulmonary artery pressure, renal functions,
concomitant MV surgery with AVR is indicated. With
and aortic valve lesion).
lower degrees of mitral regurge (MR), the decision to
attack the mitral valve in the same sitting is debatable
Investigations: Echocardiography was performed to all
(1). This research aimed to evaluate the early clinical
patients to establish LV Function [EF LA size, ESV,
results in studied cases with moderate MR undergoing
EDV, EF, MR (effective regurgitant orifice, regurgitant
isolated surgical aortic valve replacement (SAVR) for
volume)].
aortic disease and evaluate the degree of residual MR
postoperatively.
Intra Operative data: Median sternotomy, opening
and suspension of pericardium followed cannulation.
PATIENTS AND METHODS
Cardiopulmonary bypass is initiated using ascending
This study is an observational research aimed to
aorta and right atrial appendage as arterial and venous
determine the fate and short-term prognostic
access respectively. The aorta is cross clamped.
implications of moderate MR in studied cases
Antegrade Cardioplegia is delivered proximal to the
undergoing SAVR identified from the database of Cairo
clamp. Aortotomy is performed above the valve. The
University Medical School Hospital, between January
aortic valve is inspected, debrided, and valve
2020 and August 2021.
replacement is performed in the normal fashion. After
weaning from the bypass and removing all cannulae,
Study population: Data of 200 studied cases, who
temporary dual pacing is inserted, and the sternum is re-
underwent isolated SAVR for aortic stenosis or regurge
approximated with stainless steel wires.
with MR before surgery, are reviewed and data
A record was made of the following: Ischemic time,
analyzed regarding fate and short-term prognostic
bypass time (in minutes) and type of valve (mechanical,
problems of moderate MR.
tissue valve).
Inclusion criteria: Studied cases undergoing isolated
SAVR for aortic stenosis and/or regurge with moderate
Postoperative data: Patients were transferred to the
MR.
ICU while being mechanically ventilated with
Exclusion criteria: Studied cases with concomitant
monitoring of the blood pressure, central venous
valve lesions (pulmonary valve disease, tricuspid valve
pressure, pulse (rate, rhythm), blood loss, and urine
disease) or, concomitant CABG, any patient with more
output. Need for inotropic support in different
than moderate MR, and redo cases.
1199
Received: 28/7/2022
Accepted: 30/9/2022
c:\work\Jor\vol901_179
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1204-1209
Prevalence of Frontal Cells and Their Relation to Frontal Sinusitis in
Egyptians: A Computerized Tomography Study
Tamer Oraby, Magdy Kamel Abd Elmaksoud, Aboubakr Abu Shaalah Alsoudani Salim,
Sameh Mohamed Hosny, Mohamed Ibrahim Amin, Mohamed Ahmed Alshawadfy Saleh
Otorhinolaryngology Department, Faculty of Medicine- Zagazig University, Zagazig, Egypt
*Corresponding author: Aboubakr Abu Shaalah Alsoudani Salim, Mobile: (+20) 01095690321,
E-Mail: abwbkrabwshalhabwshalh@gmail.com
ABSTRACT
Background: The frontal sinus is frequently regarded as the most difficult location to reach in functional endoscopic sinus
surgery (FESS). There have been numerous reports of significant variations in the capacity, symmetry, and morphology of
the frontal sinus. Aim of Study: this study aimed to look at the prevalence of frontal cells in Egyptians and their relationship
to chronic frontal sinusitis using the International Frontal Sinus Anatomy Classification (IFAC).
Material and Methods: This prospective cross-sectional study was conducted in ENT and Radiology Departments, Faculty
of Medicine, Zagazig University. 60 cases underwent CTPNS were reviewed during the period from March 2022 to
September 2022. High-resolution multislice CT scan was done for each patient.
Results: Frontal sinusitis was present in 36.6% of cases and was absent in 63.4% of the studied cases. There was statistically
significant difference between both frontal positive sinusitis and frontal negative sinusitis studied groups as regards supra
agger cells where it was present in 18.2% of positive sinusitis cases.
Conclusion: Despite having the lowest frequency, frontal sinusitis is highly correlated with both SOECs and SACs.
Keywords: Frontal, Sinusitis, Recess, Frontal.
INTRODUCTION
Furthermore, it has been demonstrated that the presence
The development of the frontal sinuses, which are
of fronto-ethmoidal cells (types III-IV), suprabullar cells,
made up of a pair of pneumatic cavities, are formed in the
and frontal bullar cells has a significant impact on the
fourth month of the life of the foetus and continues up
progression of frontal's sinusitis. These three cell types
until the age of 20. Always asymmetrical, the two sinus
make up the frontal bullar cells and suprabullar cells,
chambers are partitioned off from one another by a
respectively (10). The goal of this study was to examine
septum and leak into the frontal bone's orbital region (1).
the prevalence of frontal cells in Egyptians and how those
To avoid problems and prevent illness recurrence,
cells relate to chronic frontal sinusitis. The IFAC was
planning a successful Frontal sinus surgery necessitates
used to guide the research process.
an understanding of sinus anatomy and drainage, and
frontal recess cells (2). The frontal recess cells, which
MATERIALS AND METHODS
come in a variety of forms with varied sizes,
This prospective cross-sectional study was conducted
arrangements, and extents, have an impact on the frontal
in ENT and Radiology Departments, Faculty of Medicine,
sinus drainage. Numerous efforts were made to identify
Zagazig University on 60 cases underwent CTPNS during
and categorise these cells, demonstrating how they affect
the period from March 2022 to September 2022.
frontal sinus outflow, and they were known by a variety
This study was conducted on 60 Patients in a row (120
of different names and descriptions (3).
sides) who complained of symptoms of chronic rhino
Endoscopic frontal sinus surgery (EFSS) success is
sinusitis, symptoms including nasal obstruction, nasal
heavily reliant on frontal recess cells (4). For EFSS to fail,
discharge, pain or pressure in the face, or a diminished or
frontal recess cells completely removed, the frontal sinus
lost sense of smell may be experienced.
ostium must be correctly identified, mucosal disease must
Inclusion criteria: Patients with symptoms of headache,
return, and the frontal recess, also known as the frontal
nasal obstruction or other symptoms of chronic rhino
sinus drainage area must be intentionally injured (5).
sinusitis for whom CT paranasal sinuses is indicated,
Frontal recess cells have been categorised in a number of
patients aged 18 years or more and both sexes.
ways. The four different types of frontal cell variants were
differentiated in accordance with the CT scan's coronal
Exclusion criteria: Patients under the age of 18, patients
slices by Bent and colleagues (6) in 1994, who named
with a history of sinus surgery, patients with a
them as type IIV cells.
maxillofacial fracture, lesions that disrupt the frontal
The therapeutic importance of frontal cells identified
recess anatomy as sinonasal malignancy, fungal sinusitis
using earlier classification methods has been the subject
and frontoethmoidal mucocele, lesions hindering frontal
of numerous investigations in the past (7). Numerous
cell identification and pregnancy.
studies have found a link between frontal sinusitis and
In two steps, Frontal sinus, recess cells were assessed.
frontal recess constriction by Kuhn cells (8, 9).
The first step was to examine maxillofacial none contrast
1204
Received: 12/07/2022
Accepted: 15/09/2022
c:\work\Jor\vol901_180
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1210-1216
Correlation between Left Atrial Strain and Subtle Cardiac Arrhythmias Detected by
Holter Monitoring in Non-Cardiac Individual Recovering from COVID-19
Alaa Elsayed Salama, Mesbah Taha Hasanein, Mohammad Gouda,
Jameelah Arfaad Abrayik*, Mohammed Mesbah Taha
Department of Cardiology, Faculty of Medicine, Zagazig University, Egypt
Corresponding author: Jameelah Arfaad Abrayik, Tel.: 01104866219, Email: monther.libya99@gmail.com
ABSTRACT
Background: Atrial fibrillation (AF) is the most often observed arrhythmia linked to COVID-19 pneumonia. Analysis
of left atrial strain (LAS), a measure of LA contractility, has been applied in numerous therapeutic contexts, has been
linked to the onset of AF.
Objective: The current study aimed to focus on correlation between left atrial strain and subtle cardiac arrhythmias
detected by holter monitoring in noncardiac individual recovering from COVID-19.
Patients and methods: From March 2022 to August 2022, the Cardiology Department of the Faculty of Medicine at
Zagazig University conducted a cross-sectional study on all COVID-19 survivors who had no cardiac issues. An
automated piece of software was used to analyse the LA strain. Three phases of LA strain were reported: reservoir phase
(LASr), conduit phase (LAScd), and contraction phase (LASct). The main result was the onset of AF.
Results: A total 76 patients were recruited for the current study. Patients were divided into two groups; Group I 15
patients with AF and Group II 61 Patients without AF. LAVI, LA strain reservoir, LA strain contraction and CRP were
the most significant predictors of AF in post COVID patients. Conclusion: We found high incidence of LAS impairment
using speckle tracking echocardiography that can predict AF in post COVID patients.
Keywords: Left atrial strain, Atrial fbrillation, COVID-19, Cross-sectional study, Zagazig University.
INTRODUCTION
Left atrial strain (LAS), a measure of atrial
In recent months, the global pandemic known as
deformation that has previously been shown to be
coronavirus disease 2019 (COVID-19), which is
predictive of AF and cardiovascular events in stable
brought on by the SARS-CoV-2 coronavirus, has spread
outpatients, can now be quantified thanks to recent
to more than 150 countries (1).
developments in two-dimensional echocardiography
The respiratory system is the primary site of
(2DE), including speckle-based strain quantification (8).
clinical symptoms in COVID-19 patients; however
With an incidence ranging from 1.9 to 43.9% in
cardiovascular problems have also been noted in the
the critically ill, atrial fibrillation (AF) is common and
first cases from Wuhan, the outbreak's epicentre (2).
significantly increases morbidity and mortality (9).
COVID-19 can cause cardiac damage and have a severe
According to the most recent literature, AF is the most
impact on heart function. Furthermore, the latter is
often recorded arrhythmia for patients with COVID-19,
linked to a rise in illness severity and mortality
with a frequency between 19 and 36% (10).
outcomes (3, 4). Even though 85% of individuals with
A non-Doppler echocardiographic technique
COVID-19 only had minor symptoms, up to 15% of
called left atrial (LA) strain (LAS) analysis evaluates
individuals experience serious consequences such
LA function, stiffness, and fibrous remodelling based
sudden cardiac damage, acute respiratory distress
on LA myocardial deformation (11,12). This method
syndrome, or arrhythmia (4).
enables a precise analysis of the three main phases of
The pathogenesis of the cardiac problems in
LA function (reservoir, conduit, and contraction). Angle
COVID-19 is significantly influenced by a number of
independence,
reduced
reverberation
effects,
pro-inflammatory agents. According to earlier research,
practicability, and reproducibility are the key benefits of
COVID-19 frequently combines ARDS (20%),
LAS over Doppler (11). In numerous clinical scenarios,
arrhythmias (17%), shock (9%), and acute cardiac
Bi-dimensional speckle tracking echocardiographic
damage (7%) symptoms. Patients admitted to the
(2DSTE) features of LA dysfunction have been
intensive care unit (ICU) with COVID19 experienced a
connected to the prevalence of AF, similar to ischemic
greater rate of arrhythmia (44%) (5).
stroke (13) or heart failure (14).
According to Guo et al. (4), the total incidence rate
The current study aimed to focus on correlation
of ventricular tachycardia (VT)/ventricular fibrillation
between left atrial strain and subtle cardiac arrhythmias
(VF) during hospitalisation was 7%.
detected by holter monitoring in non-cardiac individual
There is little evidence connecting myocardial
recovering from COVID-19.
injury in this cohort to arrhythmias such atrial
fibrillation/flutter, Even if myocardial damage from
PATIENTS AND METHODS
Coronavirus disease 2019 (COVID-19) has been linked
From March 2022 to August 2022, a cross-sectional
to unfavourable outcomes (6,7).
study was conducted at the Cardiology Department,
Faculty of Medicine, Zagazig University. All patients
1210
Received: 20/07/2022
Accepted: 30/09/2022
c:\work\Jor\vol901_181
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1217-1219
Role of Fractional Carbon Dioxide Laser in Treatment of
Alopecia Areata: Review Article
Basma Gamal Mostafa Khlil, Soheir Mohamed Ghonemy, Abdullah Mohamed Esawy
Department of Dermatology, Venereology and Andrology, Fuculty of Medicine, Zagazig University, Egypt
Corresponding Author: Basma Gamal Mostafa Khlil, Telephone: 01092843619, Email: basmagamal1191@gmail.com
ABSTRACT
Background: The chronic inflammatory condition known as alopecia areata causes non-cicatricial hair loss. Ablative
Fractional laser treatments as well as other laser therapies with various wave lengths have been used to treat AA.
Objective: The aim of the current review is to assess the efficacy and safety profile of fractional carbon dioxide (CO2)
treatment in alopecia areata.
Development: CO2 lasers come in two varieties: nonfractionated and fractionated (both ablative and nonablative). In
comparison to nonfractionated lasers, fractionated ablative and nonablative lasers offer a better safety profile. The two
operating modes for this kind of laser are continuous and pulsed. Utilizing the continuous wave style consumes
significantly more energy. Either a continuous wave or an intermittent wave can be selected for the pulse mode. The
ultrapulsed mode, which has also enabled therapy with the greatest power, the least thermal damage, and hence the
fewest side effects, is a final option.
Conclusion: Alopecia areata may respond well to treatment with fractional CO2 laser.
Keywords: Alopecia areata, fractional laser, fractional laserassisted drug delivery, review, Zagazig University.
INTRODUCTION
The carbon dioxide laser was one of the earliest
the least thermal damage, and hence the fewest side
lasers to enter the market (CO2 laser). At Bell Labs in
effects, is a final option (2).
the US, Patel and colleagues created the CO2 laser in
1964. It was initially developed as a surgical laser due
1. Fractional photothermolysis
to its high-water absorption, but Professor Kaplan and
Fractional photothermolysis is a novel idea in skin
his colleagues later looked into a variety of applications.
laser therapy that aims to produce uniform thermal
The CO2 laser is extensively used in dermatology for
damage at a certain depth in the skin by inflicting small
both medicinal (such as the management of benign
thermal wounds (3).
disorders like seborrheic keratosis) and cosmetic
Comparatively to traditional ablative lasers,
purposes. , warts, and skin nevi) and cosmetic (such as
fractional lasers--both ablative and nonablative enable
anti-aging) objectives (such as the correction of
rapid healing since the intervening skin is left intact for
aesthetic flaws) objectives (ie, acne scars). In
the reparative process. The principle of fractional skin
comparison to conventional therapy, the CO2 laser is
damage serves as the foundation for fractional laser
more accurate, causes less bleeding and irritation, and
therapy. reduced downtime, less side effects compared
promotes quicker recovery (1).
to standard ablative lasers, and more successful tissue
The CO2 laser has a wavelength of 10 600 nm.
regeneration compared to nonablative techniques are all
According
to
the
principles
of
selective
advantages of this system.(4).
photothermolysis, the water that makes up more than
80% of the makeup of the skin is the specific
2. Ablative Fractional Lasers (AFL)
chromophore that quickly absorbs the light that is
The so-called microthermal zones (MTZs), created
emitted. Within 20 to 50 m of tissues, the CO2 laser's
by the AFL, is minute columns of ablated tissue that run
energy is practically completely absorbed, causing a
from the epidermis to the dermis while sparing the
fast heating that causes intracellular water to evaporate
healthy tissue regions in between. The surrounding
and causes the tissues to be destroyed (2).
healthy skin cells encourage a process of rapid
CO2
lasers
come
in
two
varieties:
reepithelization in response to collagen degeneration
nonfractionated and fractionated (both ablative and
and localised epidermic necrosis (4).
nonablative). In comparison to nonfractionated lasers,
By reducing the side effects and difficulties that
fractionated ablative and nonablative lasers offer a
were previously expected because the classic ablative
better safety profile.
resurfacing did not employ to keep any healthy skin
The two operating modes for this kind of laser
region, the AFL technology offers us a fresh perspective
are continuous and pulsed. Utilizing the continuous
on facial resurfacing methods (5).
wave style consumes significantly more energy. Either
The Er:YAG (yttrium, aluminium, garnet) 2.940 nm
a continuous wave or an intermittent wave can be
and the recently developed Er: YSG (yttrium, sapphire,
selected for the pulse mode. The ultrapulsed mode,
garnet) 2790 nm are additional ablative fractional laser
which has also enabled therapy with the greatest power,
types. Their object ives are the same, therefore the only
differences are in the wavelength and water absorption
1217
Received: 20/07/2022
Accepted: 30/09/2022
c:\work\Jor\vol901_182
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1220-1225
Study of Quinolone-Resistant E.Coli Isolated from Hospital-Acquired
Urinary Tract Infection in Intensive Care Units
Mohamed Saleh Ismaeil1, Maysaa El sayed Zaki1, Nermin Yousef Abo El Kheir1,
Ahmed Mohamed Elewa1
1Clinical Microbiology Unit, Clinical Pathology Department, Faculty of Medicine,
Mansoura University, Dakahlia, Egypt
Corresponding author: Mohamed S. Ismaeil, ORCID ID: https://orcid.org/0000-0002-5275-0677,
Phone number: +201065740008, Email: Moh.sale7@mans.edu.eg
ABSTRACT
Background: Catheter-associated urinary tract infection is the most common hospital-acquired infection which is treated
empirically by quinolone antibiotics. Analysis of clinical characteristics, risk factors, and common pathogens has a major
effect on the advancement of the prevention of CAUTI in medical settings.
Subjects and Methods: Urine samples were collected from Intensive Care Units at Mansoura University Main Hospital
over two years. Samples were then transferred to the Microbiology lab, at Mansoura University Main Hospital for culture,
identification, and sensitivity
Results: The most common pathogens were E. coli (27.4%) followed by Candida (21.2%) and Staph aureus (12.0 %).
Females were slightly higher (52 %) than males (48 %). diabetes appeared to be the most common risk factor (31% of cases)
followed by chronic kidney disease (23.5%) and cerebrovascular accidents (23%). Meropenem was the highest sensitive
antibiotic (48.9%) followed by amikacin (47.4%), norfloxacin (46.2%), imipenem (41.8) while cefuroxime (100.0%), and
cefaclor (100.0%) are the most resistant antibiotic followed by ceftriaxone (97.0%), doxycycline (96.0%).
Conclusion: cases in our study showed a high resistance rate to quinolone antibiotics which need infection control
plans and antibiotic stewardship programs to reduce that rate.
Keyw ords: CAUTI, Quinolones, E coli.
Abbreviations: CAUTI (Catheter-associated urinary tract infection), HAI (hospital-acquired infections), FDA (Food and
Drug Administration), CDC (Centers for Disease Control and Prevention), CLSI (Clinical & Laboratory Standards
Institute: CLSI Guidelines).
INTRODUCTION
Catheter-associated urinary tract infection
FDA-accepted for the remedy of complex urinary tract
(CAUTI) is one of the most common hospital-acquired
infections (4).
infections (HAI). These infections are most likely caused
In this study, we aim to Determine incidence,
by bacteria entering the body during catheterization, as a
common pathogens, associated risk factors, and
result of prolonged or unnecessary use of urinary
antibiotics susceptibility responsible for hospital-
catheters, or due to disruption of the closed drainage
acquired urinary tract infection in Mansoura university
system (1).
hospital as well as to characterize the quinolone resistance
For CAUTI, sex, physiologic score on admission,
phenotypes in E. coli isolated from UTI in ICU patients
duration
of
catheterization,
diabetes
mellitus,
in Mansoura university hospital.
immunocompromised patients, neurological disease, and
high systemic antibiotic exposure on admission are all
PATIENTS AND METHODS
potential risk factors (2).
Urine samples were collected from Intensive Care
Escherichia coli is a Gram-negative bacterium of
Units at Mansoura University Main Hospital over two
the Enterobacteriaceae family that can harmlessly
years and transferred to the microbiology lab, for culture,
colonize the human intestine or cause enteric or extra-
identification, and sensitivity.
intestinal infections, including serious invasive diseases
The study also included urine culture samples
such as bacteremia and sepsis, and is considered the most
from patients who have CAUTI according to CDC, 2018
common pathogen causing UTI (3).
definition between January 2019 and January 2021
Quinolone antibiotics are a class of broad-
collected from ICU patients in Mansoura University Main
spectrum antibiotics used to treat a variety of bacterial
Hospital.
infections. The quinolones were active only against
Patients who have community-acquired UTI and
Gram-negative bacteria, and subsequent generations
Urine culture samples collected from patients other than
acquired activity against Pseudomonas species, Gram-
ICU were excluded.
positive and atypical bacterial strains. Ciprofloxacin is
All cases were subjected to full clinical history
taking and clinical examination. Also, 50 cases of E. coli
1220
Received: 20/07/2022
Accepted: 30/09/2022
c:\work\Jor\vol901_183
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1226-1230
Cord Blood Hemoglobin Levels in Full Term Neonates of Mothers with
Iron Deficiency Anemia
Marwa Adham El-Mohamdy Hasb El-Nabi1*, Ola Galal Bader El-Deen El-Farghali2,
Mortada El-Sayed Ahmed3, Nesmahar Tark Abdel Hamed Azzam2, Sara Helmy AbdElaziz Rezk2
Departments of 1Clinical and Chemical Pathology, 2Pediatrics and
3Obstetrics and Gynecology, Faculty of Medicine, Ain Shams University, Egypt
*Corresponding author: Marwa Adham EL-Mohamdy, Mobile: (+20) 01123890678,
Email: Marwa_Adham@med.asu.edu.eg
ABSTRACT
Background: For the oxygenation of tissues, cellular metabolism, the production of energy, and the metabolism of
toxins, iron is a vital micronutrient. Iron status in the maternal circulation, its transportation through the placenta, and
its subsequent transfer into the fetal circulation all play a part in the controlled process of iron transfer from mother to
fetus. Objective: The aim of the current study is to evaluate cord blood hemoglobin (Hb) levels in neonates of mothers
with iron deficiency anemia (IDA).
Patients and methods: This prospective case-control study was conducted at Ain Shams University Hospitals. It
included 60 full terms newborn who were born at Obstetrics and Gynecology Hospital. Case group included full term
neonates with maternal IDA: Maternal Hb <11 g/dl, MCV or MCH below reference ranges, serum ferritin below normal
detection limit and/or low transferrin. Control group included full term neonates without maternal IDA. For the
neonates, samples of cord blood were obtained for analysis of the level of CBC (Hb, MCV and MCH).
Results: In comparison between cases and controls as regard RBCS parameter, there was no significant difference
between cases and controls regarding neonatal Hb and MCH, but there was significantly lower MCV in cases compared
to controls. Conclusion: There was no relation between the maternal Hb deficient levels and neonatal Hb. The first sign
of iron deficiency in neonates reflected in lower MCV in cases, but did not reach to decrease Hb levels in neonates.
Keywords: Cord Blood, Hemoglobin, Neonates, Mothers, Iron Deficiency Anemia.
INTRODUCTION
For the oxygenation of tissues, cellular metabolism,
included 60 full terms newborn who were born at
the production of energy, and the metabolism of toxins,
Obstetrics and Gynecology Hospital. An informed
iron is a vital micronutrient (1). Myelination,
consent was taken from the mother or guardians before
neurotransmission, and the metabolism of neuronal
enrollment in the study.
energy are all regulated by iron and iron-containing
Inclusion Criteria: Full term newborn: the study
enzymes in the brain (2).
population was full term neonates delivered at
For more than 25 years, it has been known that
completed 37 weeks of gestation which was divided
early-life iron deficiency anemia (IDA) affects brain
into two groups according to maternal IDA. Case group
iron levels and results in cognitive and behavioral
included full term neonates with maternal IDA, while
abnormalities in young children (3). IDA during the
control group included full term neonates without
prenatal or early postnatal period results in lasting
maternal IDA. Maternal IDA was defined as: maternal
abnormalities in learning and memory, emotional
Hb <11 g/dl, MCV or MCH below reference ranges,
control, social conduct, and general neurophysiologic
serum ferritin below normal detection limit and/or low
development, according to later research (4). Also, there
Transferrin.
is a link between early-life iron deficiency (ID) and a
higher risk of neuropsychiatric diseases (5,6).
Although ID has been identified and treated, these
Exclusion Criteria: Multiple congenital anomalies.
deficiencies continue throughout adulthood (7), pointing
Hypoxic ischemic encephalopathy. Neonates with risk
to the early years as a crucial period for brain
factor of early onset sepsis. Multiple gestation neonates.
development when a sufficient iron supply is necessary
Mother who received packed red cell transfusion
for healthy growth and development. However,
2weeks or less before delivery.
according to clinical practice, IDA screening and
treatment are not carried out until 9 to 12 months of age,
METHODS
which may be too late for certain newborns (8).
Comprehensive antenatal history: Maternal age,
The objective of this study is to evaluate cord blood
chronic diseases, infection (STORCH infection),
Levels of hemoglobin (Hb) in neonates of mothers with
maternal rupture of membranes <18 hours,
IDA anemia.
chorioamnionitis, high grade fever, and urinary tract
infection (UTI). Past history included prior abortions
PATIENTS AND METHODS
and family history of repeated abortions. Maternal
Patients: This prospective case-control study was
anemia was defined as maternal Hb <11g/dl and MCV
conducted at Ain Shams University Hospitals. It
or MCH below reference ranges (9). Also, history of
1226
Received: 29/7/2022
Accepted: 1/10/2022
c:\work\Jor\vol901_184
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1231-1240
Prevalence of Antibiotic Resistance in Pediatric Malignancy Patients:
A Two-Year Retrospective Study in Basra City
Hanan AlAulddin Abdul Jabbar, Ali Mohammed Hadi
Department of Clinical Pharmacy, College of Pharmacy, University of Basra, Basra, Iraq
Corresponding author: Hanan AlAulddin Abdul Jabbar, Email:pgph.hanan.alaa@uobasrah.edu.iq, Tel: +9647705757223
ABSTRACT
Background: The most frequent side effects of chemotherapy are infections, which have substantial morbidity and
mortality rates in immunocompromised patients.
Aim: To screen the prevalence of resistance between antibiotics administered to infected patients in hematological
malignancy wards.
Subjects and Methods: A retrospective cross-sectional study of pediatric oncology patients was conducted from January
2021 to June 2022 at Basra children hospital. The study included 500 patients with hematological malignancies.
Results: This study involved 57.8% male and 42.2% female patients. Leukemia was the most common diagnosis 59%
while other solid tumors was 41%. Febrile neutropenia was only 5.8%, bacterial infection was predominant at 49.8% while
the fungal infection was 9.4%, and 4.8% suspected viral infection. We found that the high percentage of antibiotics used
were Cephalosporin (41.4%) and the lower percentage of antibiotics were Quinolone 0.4%.
Conclusion: The most frequent form of infection was a bacterial infection, and the most frequently prescribed antibiotic
for oncology patients was cephalosporin. The chest represented the most severely infected place.
Keywords: Neutropenia, Pediatric oncology, Bloodstream infections, Antibiotic, Basrah.
INTRODUCTION
Invasive fungal infections, especially in those with
For
chemotherapy-treated
cancer
patients,
hematological abnormalities treated with high-dose
bloodstream infections (BSIs) continue to be a major
chemotherapy or bone marrow transplants, are a
source of morbidity and mortality. A significant risk factor
significant contributor to the death of children with cancer
for acquiring numerous mild to severe infections including
(3). Invasive aspergillus infections are among the most
sepsis and septic shock, is chemotherapy brought on by
common infections, but there are also more and more
bone marrow suppression. Other risk factors include the
cases of other fungi besides aspergillus that are being
use of indwelling central venous catheters (CVC) for the
documented (5).
diagnosis of leukemia, undernutrition, and recently
It appears that during the past few decades, there has
administered chemotherapy (1).
been a rise in the prevalence of invasive fungal infections
Additionally, because numerous immune pathways
in children, mostly as a result of the prolonged survival of
are impaired during treatment, bacterial infections can
infants with immune deficiency disorders (6).
coexist occasionally with both invasive and non-invasive
The morbidity and even death linked to the care of
fungal and viral infections.
severe bacterial infections in children with cancer can be
Over the past few years, significant alterations in the
decreased by using a preventative strategy. Standard
range of bacteria identified from blood cultures in cancer
treatment for febrile neutropenia involves giving
patients have been recorded (1). Antibiotics may be used
antibiotics to patients until their fever breaks and their
to reduce the adverse effects of pathogenic bacteria.
neutrophil count improves (7).
Unfortunately, improper use of antibiotics is hastening the
Between 40% and 90% of febrile neutropenia cases
creation of antibiotic strains that are resistant to bacteria,
respond to empirical antibiotics. A careful understanding
which has alarming clinical implications for the treatment
of the local positive blood cultures and their sensitivity
of illnesses. Today, a lot of diseases happen because germs
and resistance profile is thus required for the development
resist traditional medicine. In actuality, bacteria are
of effective treatment and doable techniques to treat
genetically capable of developing resistance to a wide
bloodstream infections. Serious infections are frequently
range of antibiotics (2).
treated with beta-lactams as the first line of defense, then
About half of patients with respiratory tract
carbapenems frequently seen as the final resort (8).
infections in children receiving chemotherapy now
frequently have respiratory viruses as the source of their
AIMED OF THE STUDY
infection, a finding that is similar to Khan et al. (3) study,
Screening the prevalence of resistance between
which showed that 44% of cases of children and
antibiotics administered to infected patients in
adolescents with leukemia and fever had respiratory
hematological malignancy wards. Also, to correlate the
infections. Sheng et al. (4) observed that rates were 75% in
severity of infection with many patient characteristics
their study.
(gender, kind of cancer, chemotherapy, side effects of
1231
Received: 04/08/2022
Accepted: 06/10/2022
Intoduction
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1241-1244
Intravenous Regional Anesthesia: The Old and Recent Techniques?
Review Article
Sherif Salah Ismail*, Fawzy Abbas Badawy, Hala Mahmoud Hashem,
Ahmed El Saeed Ali, Ahmed Talaat Mohamed
Department of Anesthesia, Intensive Care Unit and Pain Management,
Faculty of Medicine, Sohag University, Sohag, Egypt
*Corresponding author: Sherif Salah Ismail, Mobile: (+20) 01007272718, E-Mail: sheriff_ismail2010@gmail.com
ABSTRACT
Background: A straightforward and efficient anesthetic approach for hand and forearm surgery is intravenous regional
anesthesia (IVRA), often known as the Bier Block. Dr. August Bier developed this method in 1908, and it offers total
anesthesia as well as a bloodless operating room. Historically, the local anesthetic has been contained and a bloodless
surgical field has been created by using an upper arm tourniquet. Major issues following IVRA with an upper arm
tourniquet are uncommon, although they typically arise from systemic toxicity of local anesthetics upon tourniquet
relaxation. Convulsions, coma, respiratory depression and arrest, and cardiovascular depression are signs of significant
systemic local anesthetic responses, which might be lethal. Because of this, some medical professionals favor general
anesthesia or other loco-regional procedures for hand and forearm surgery.
Objective: The aim of this review was to compare the effects of early vs late distal tourniquet deflation during hand and
forearm surgery under intravenous regional anesthetic with or without ketorolac.
Methods: A comprehensive search was conducted in PubMed, Google Scholar, and Science Direct, from August 2000
to July 2021, using the keywords "Deflation, Distal tourniquet, Intravenous Regional Anesthesia, Ketorolac, Hand and
Forearm Surgery". The reviewers evaluated relevant literature references as well. Only the most recent or complete
study was taken into account. Examples of articles that weren't regarded as significant scientific research include
unpublished manuscripts, oral presentations, conference abstracts, and dissertations. The lack of resources for translation
has led to the ignoring of documents written in languages other than English.
Results: The reviewed literature showed that alternative adjustments in extremities surgery can improve IVRA. In short-
term hand procedures, the forearm tourniquet may be chosen since it is simple to administer, has a minimal risk of
toxicity, and offers an early block to healing. Conclusion: Depending on the patient's preferences, a Bier block with a
forearm tourniquet can be utilized with or without further sedation or analgesics.
Keywords: Deflation, Distal tourniquet, Intravenous Regional Anesthesia, Ketorolac, Hand Surgery, Forearm Surgery.
INTRODUCTION
When carried out correctly in accordance with
For limb procedures, IVRA is a tourniquet-related
established protocols and using instruments and cuffs
substitute for general anesthesia. With frequency varied
for tourniquets that are accurate, dependable, and safe
depending on the type of operation and practice
that have undergone extensive testing prior to use,
patterns, it is affordable and often utilized for both adult
IVRA has been successfully used on a large number of
and pediatric patients (1).
patients for a long time and has shown to be reasonably
In IVRA, two single-bladed or two dual bladder
simple, safe, and helpful (5).
cuffs are put close to the surgical site. After that, blood
However, there are risks associated with IVRA.
is exsanguinated from the limb by elevating it or by
These dangers might be brought about by the inherent
tying an elastic bandage over it, starting distally and
safety restrictions of tourniquet devices and cuffs not
working your way toward the heart. The elastic bandage
made particularly for IVRA, by tourniquet device and
is then taken off when the cuff is compressed (2).
cuff failures while in use, and by inadequate testing of
Through an intravenous catheter, a local anesthetic
devices and cuffs before use. These dangers rise when
drug is delivered into the affected limb. As long as the
using unconventional procedures and when using
tourniquet is inflated, the local anesthetic is still in the
personnel with insufficient IVRA expertise (6).
affected limb. Most of the anesthetic agent has been
The aim of this review was to compare the effects
absorbed into the tissues of the limbs around 20 minutes
of early vs late distal tourniquet deflation during hand
after infusion, therefore deflating the tourniquet cuff
and forearm surgery under intravenous regional
won't cause a large concentration of the substance to be
anesthetic with or without ketorolac.
released into the bloodstream (3).
The anesthesia practitioner may manage the
METHODS
inflation and deflation of each bladder individually
A comprehensive search was conducted in PubMed,
using dual bladder cuffs and two single bladder cuffs,
Google Scholar, and Science Direct, from August 2000
which increases patient safety and comfort during
to July 2021, using the keywords "Deflation, Distal
surgery (4).
tourniquet,
Intravenous
Regional
Anesthesia,
Ketorolac, Hand and Forearm Surgery".
1241
Received: 8/8/2022
Accepted: 1/10/2022
c:\work\Jor\vol901_186
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1245-1252
In Vitro Novel Study the Effect of Scopoletin Compound and Silver Nanoparticles of
Fenugreek Extract on Focal Adhesion Kinase Enzyme as Anti-Metastatic in Serum of
Iraqi Patients of Stage and Stage with Pancreatic Cancer
*Nihad K. Hasan and Nijoud F. Yousif AL-Saarag
Department of chemistry, College of Education for Pure Sciences (Ibn Al-Haitham),
University of Baghdad, Ahdamiyah, Baghdad, Iraq.
*Correponding auther: Nijoud F. Yousif AL-Saarag, Mobil: +9647905158320,
Email: nijud.f.y@ihcoedu.uobaghdad.edu.iq
ABSTRACT
Background: Experts consider pancreatic cancer one of the most deadly types. For unknown reasons, pancreatic cancer
incidence and mortality are rising. Scopoletin and Ag-NPs compounds have therapeutic properties and are utilized
experimentally in vitro as chemotherapies for numerous disorders.
Objective: This study manufactures silver nanoparticles from fenugreek extract and analyzes their anti-metastatic effects
with scopoletin at different doses to find the best combination to lower FAK enzyme concentration.
Patient and Methodes: Sixty pancreatic cancer serum samples were divided: 30-Stage II patient samples (male and female,
45-65 years old), 30 stage IV patients of both sexes and ages (52-79), Thirty serum samples from healthy 23-45-years-olds
served as a control group. Silver nanoparticles and scopoletin solutions were tested to find the appropriate concentration to
reduce the focal adhesion kinase (FAK) enzyme.
Resuts: Researchers showed that patients with stage and stage with pancreatic cancer and the control group had
enzyme concentrations of 1.620.11ng/ml, 1.790.06 ng/ml, and 0.940.41 ng/ml, respectively, when treated with a 2 ppm
solution of nanoparticles. Stage and stage with pancreatic cancer patients had lower enzyme concentrations than
controls (1.570.15 ng/ml and 1.410.07 ng/ml). when treated with a 8 ppm solution of Scopoletin solution.
Conclusion: Based on their potential to decrease focal adhesion kinase enzyme concentrations in the blood serum of patients
with stage and stage Iraqi pancreatic cancer, scopoletin and silver nanoparticles of fenugreek can be recommended as
anticancer materials.
Keywords: Pancreatic cancer, Scopoletin, Fenugreek, Silver nanoparticles,Focal adhesion kinase.
INTRODUCTION
accounts for 20% of pancreatic cancer cases), age over 55,
Cancer is an idiom for a disease in which unusual
diabetes, obesity, chronic pancreatitis, liver cirrhosis,
cells divide in the absence of control and can pervade
helicobacter pylori infection, work exposure to chemicals
nearby tissues (1). Cancer is the unrestricted growth of
in the dry cleaning and metalworking industries, males
cells that have damaged deoxyribonucleic acid
more than females, African Americans more than whites,
manifestation. The cancerous cells repeatedly divide,
and family history. 10% of instances are genetic in nature,
displacing normal tissue(2, 3).
either due to genetic mutations or to illnesses such as
The broad spectrum of pancreatic cancer is typically
Lynch syndrome, Peutz-Jeghers syndrome, VonHipaul
divided into benign, pre-malignant, and malignant
Lindau syndrome, or MEN1 (multiple endocrine
neoplasms based on biological characteristics and
neoplasia type1). Heavy alcohol consumption, coffee
histological differentiation into epithelial or non-
consumption, physical inactivity, a high intake of red
epithelial neoplasms. Ductal and acinar neoplasms are
meat, and two or more soft drinks per day are all risk
additional categories for epithelial tumours that exist (4).
factors.(7) .
The disease is often discovered at an advanced stage
Focal adhesion kinase (FAK) is an Enzyme with a
because pancreatic cancer has a high mortality rate and
commission number (EC 2.7.10)(8). FAK, also known as
relatively poor detection rates. This is a result of the
PTK2 (protein tyrosine kinase 2), is a cytoplasmic protein
disease's quick progression and inadequate diagnosis (5).
kinase that is essential for embryonic development and
pancreatic cancer can be described as follows (6).
cell adhesion, migration, survival, and proliferation (9).
Stage I: Pancreatic tumour that has not spread to other
The 125kD FAK protein is composed of a central catalytic
organs. Tumour infiltrates the bile duct and other nearby
kinase domain, a central FERM (four-point-one, ezrin,
tissues in stage II, but lymph nodes are negative. Any
radixin, moesin) domain, and a C-terminal domain.
lymph nodes with a positive stage three reach
Integrins regulate focal adhesions, which are points of
neighbouring organs such as the stomach, liver,
interaction between the cell surface and the extracellular
diaphragm, and adrenals at stage IVA. Stage IVB: The
matrix. Cell adhesion, migration, proliferation,
tumour has spread to distant organs (7).
differentiation, and survival are influenced by the
The most significant risk factors are smoking (which
coordinated creation and dissolution of focal adhesions as
1245
Received: 1/10/2022
Accepted: 1/12/2022
c:\work\Jor\vol901_187
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1253-1259
Outcome of Using Angiosculpt in Bifurcation and Osteal Lesions, Efficacy, Safety
Wael Ahmed Elsayed Ahmed Makled1*, Ehab Kamal Mustafa El Melegy2, Haithem Abd Elrazek Elkady1
1Department of Cardiology, Benha Teaching Hospital, Benha, Egypt
2Department of Cardiology, Shebin El-Kom Teaching Hospital, Menofia, Egypt
*Corresponding author: Wael Ahmed Elsayed Ahmed Makled, Mobile: (+20) 01009537864,
Email: wael_makled82@yahoo.com
ABSTRACT
Background: Balloon Catheter for AngioSculpt Scoring being considered using a scoring balloon close to the distal tip,
cut the percutaneous transluminal coronary angioplasty (PTCA) catheter. The balloon is designed to expand to a specific
diameter and length at a particular pressure. At the distal end of the catheter, there is a conventional nylon-blend balloon
and a nitinol scoring element with three spiral struts that wrap around the balloon. Objective: To evaluate the outcome
of using Angiosculpt in bifurcation and osteal lesions beside its efficacy and safety. Patients and Methods: This
prospective, observational, non-controlled study included 20 with ischemic heart disease (IHD) patients, ischemic with
osteal lesions and bifurcational lesion admitted at Wadi Elnil Hospital from January 2019 to May 2020. All patients
were subjected to demographic data analysis, clinical examination, ECG. Echocardiography was done for each patient,
on admission. Quantitative coronary angiography and PTCA using AngioSculpt then Percutaneous coronary
intervention (PCI) with drug-eluting stent (DES) were performed. All patients received proper medications with follow
up for morbidity and mortality for 3 months. Results: Mean age was 55± 23 years and 65% were men. The type of
lesion was osteal in 25% of lesions and true bifurcation lesion in 75%. Additional stenting was performed in all lesions
after angioplasty with the AngioSculpt balloon. The immediate complication was recorded as perforation in one patient
(5%). Coronary complication was localized dissection, which was identified in one patient (5%). Survival was 100% at
6 months. Major adverse cardiac events (MACE) occurred in 10%of patients. Target lesion revascularization (TLR) was
not needed at the study group. Conclusion: Using the AngioSculpt scoring PTCA balloon for osteal lesions and
bifurcation lesion is considered to be safe and effective and leads to satisfactory clinical and angiographic outcome.
Keywords: Osteal, Bifurcational, AngioSculpt scoring balloon, PCI.
INTRODUCTION
assess the LV systolic function and coronary
An angioplasty with a balloon leads in acute lumen
angiography
including
quantitative
coronary
gain. The mechanisms vary based on the specifics of the
angiography (QCA), PCI with using 2nd generation and
lesion. In a severely calcified lesion, balloon inflation is
3rd generation drug-eluting stents (DES).
linked with plaque fracture and dissection, but in a
Study Endpoints: Study endpoints were 6 months.
fibrotic lesion, plaque compression and vascular stretch
Clinical outcome included death (cardiac and non-
contribute more to the gain. A scoring balloon is
cardiac), myocardial infarction, target lesion
positioned at the distal tip of the PTCA catheter known
revascularization (TLR), target vessel revascularization
as the AngioSculpt Scoring Balloon Catheter. The
(TVR) and all major adverse cardiac events (MACE).
purpose of the scoring balloon is to reach a particular
Ethical consent: The Ethical Institutional Review
diameter and length at a specified pressure [1].
Board at Benha University approved the study. After
Aim of the study was to evaluate the outcome of Using
explaining our research objectives, written informed
Angiosculpt in bifurcation and osteal lesions beside its
consent was obtained from all study participants. This
efficacy and safety.
study was conducted in compliance with the code of
ethics of the world medical association (Declaration of
PATIENTS AND METHODS
This prospective, observational, non-controlled
Helsinki) for human subjects.
study included 20 heart disease (IHD) patients;
Statistical analysis
ischemic with osteal lesions and bifurcational lesion
The data are displayed as the mean standard
admitted at Wadi Elnil Hospital from January 2019 to
deviation (SD) for continuous data and as a number (%)
May 2020.
for categorical data. Using the student t-test for
Inclusion criteria were patients with documented
continuous data and the Chi-square test for categorical
CAD, preserved EF, target lesion(s) must be osteal
data, the level of evidence was determined to be
lesion or true bifurcation lesion.
significant when P <0.05.
Exclusion Criteria were impaired EF, patient on
RESULTS
immunosuppressive therapy, contraindication to
Baseline clinical characteristics are shown in table
essential drugs aspirin, heparin, clopidogrel or contrast
(1). Figure (1) showed that male gender patients (65%)
sensitivity, CKD prepared for dialysis, any other
and the mean age of patients was 55.23±7.31 years.
comorbidity such as CVS, cerebral hemorrhage,
diabetes mellitus was present in 53.3% of total study
bleeding varices, pregnancy, target lesion(s), which
population., Hypertension was present in 53.3%.
doesn't match with our inclusion criteria and CTO
Seventy percent had dyslipidemia, while 53.3% of
lesions. Methods: Patients were subjected to ECG,
patients were smokers.
lipid profile, kidney function tests, echocardiography to
1253
Received: 01/08/2022
Accepted: 02/10/2022
c:\work\Jor\vol901_188
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1260-1263
Interleukin 1 and Interleukin 2 as Important Diagnostic Markers in
Patients Infected with Salmonellosis
Israa Abduljabbar Jaloob Aljanaby1, Kais Khudhair ALhadrawi2, Hanan Khaled Aldhalmi3,
Thualfakar Hayder Hasan4, Ahmed Abduljabbar Jaloob Aljanaby5*
1 Department of Microbiology, College of Pharmacy, University of Kufa, Iraq
2 Radiology Techniques Department, 3 Medical Laboratory Techniques Department,
Collage of Medical Technology, Islamic University, Najaf, Iraq
4 College of Medical and Health Techniques, University of AL-Kafeel, Al-Najaf, Iraq
4 Department of Microbiology, Faculty of Science, University of Kufa, Iraq
*Corresponding author: Ahmed Abduljabbar Jaloob Aljanabay, Mobile: 009647816118353,
E-mail: ahmedaj.aljanabi@uokufa.edu.iq
ABSTRACT
Background: Salmonellosis is enteric disease caused by Salmonella typhi (S.typhi). Humans are infected with it and it
is transmitted through contaminated foods.
Objective: The aim of the current study is to compare between two Interleukins (IL-1 and IL-2) levels in patients serum
infected with S.typhi.
Patients and methods: A case control was conducted in our university hospital. The study included 60 patients with
Salmonellosis and 30 healthy individuals as controls. ELISA technique was used to determine the concentrations of IL-
1 and IL-2 in the serum of all individuals with acute and chronic typhoid based on a positive blood culture and IgM/IgG
test. Results: A total of 33 patients with acute infection and 27 with chronic infection have been diagnosed. IL-1 and
IL-2 in acute and chronic infections were higher than in the control group (P values <0.0001 and <0.032, respectively).
Conclusions: Humans with Salmonellosis have higher serum levels of IL-1 and IL-2 depending on the severity and
duration of the illness and may be used as a diagnosis marker.
Keywords: Salmonellosis, Interleukin-1, Interleukin-2, Acute infection, Chronic infection, Case control study,
University of Kufa.
INTRODUCTION
Typhoid fever causes about 27 million new cases
Salmonella typhi is a bacterium that can cause
yearly and approximately 90% of typhoid deaths occur
salmonellosis, which is a foodborne illness. It is a
(6). The immune system, both innate and cell-mediated,
bacterium that lives in and on poultry and beef products
plays an important role in protecting the host against
(e.g., raw eggs) as well as contaminated food and water
S.typhi infections, the interleukins in particular, play an
(1). Foodborne illnesses are caused by consuming food
important role in enhancing the defense of the host
or drink contaminated with pathogenic bacteria. Most
against acute and chronic infections led by S.typhi (7).
people infected with Salmonella typhi usually develop a
As a result of their role in promoting leukocyte
mild illness such as diarrhea, fever, nausea, and
survival under bacterial infection conditions, the role of
vomiting. Severe infections in young children can cause
mast cells, T-helpers 2, basophils, and eosinophils in
ear infections or pneumonia (2).
imm unity and their role in stimulating B-cell
The infection is usually ingested from the animal's
differentiation, as a cytokine, interleukin-1 is released
feces. It can also be transferred through contaminated
by mast cells, T-helper 2 cells, and basophils (8,9). When
water when hands come in contact with the meat and
patients are infected with S.typhi, interleukin-2 plays an
then the mouth. In recent years, the role of interleukins
important role in preventing infection by recruiting
in immunity has been recognized as an important
neutrophils to the intestinal mucosa (10).
element in health, are a group of proteins that work
However, there were few studies about the role of
together to regulate the immune response. There are a
IL-1 and IL-2 in human models due to a lot of published
variety of types of ILs and each plays a role in protecting
articles of the immune response in laboratory animals
the body against infection and disease such as IL-17, IL-
infected with salmonellosis. Study subjects were
1 and IL-2 (2).
assessed for IL-1 and IL-2 levels in serum after acute
Depending on the strain and the host's immune
and chronic Salmonella typhi infection. The aim of the
system, the severity of infection caused by these
current study is to compare between two Interleukins
bacteria varies (3).
(IL-1 and IL-2) levels in patients serum infected with
S.typhi and S.paratyphi are only found in humans
S.typhi.
since typhoid fever is spread via oral transmission due
to contaminated food and water (4). The pathogens
PATIENTS AND METHODS
responsible for these diseases have been considered a
A case control was conducted in our university
significant threat worldwide, especially in developing
hospital. The study included 60 patients with
countries (5).
Salmonellosis and 30 healthy individuals as controls.
1260
Received: 7/8/2022
Accepted: 10/10/2022
Review of literature
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1264-1267
New Markers for Cases with Acute Renal Injury: Review Article
Waleed Adel Ahmed*, Samar Thabet Abu Bakre, Al Shaymaa Mahmoud Ahmed
Department of Anaesthesia, ICU and Pain Management, Faculty of Medicine, Sohag University, Egypt
*Corresponding author: Waleed Adel Ahmed, Mobile: (+20) 01006392210, E-Mail: Waleed.salama@med.sohag.edu.eg
ABSTRACT
Background: Acute kidney injury (AKI) is caused by ischemia, toxins, radiographic contrast, and microbial endotoxins,
among others. It affects around 30% of intensive care unit (ICU) patients and is significantly more frequent in operated
heart cases. The concentration of (sCr) does not alter until about 50% of renal function is gone, and it is dependent on
muscular weight, age, gender, and drugs. The delay between damage and function loss jeopardizes a therapy chance and
can be a proof to the increased death rate of the condition. Several of these novel indicators for AKI may have potential
applications in anesthesia and critical care. A panel of kidney biomarkers may be standardized before and after major
surgery. If raised, the anesthesiology should take further precautions to optimize patients in the surgical wards or ICU
post-operatively to minimize additional toxic insults and commence additional therapy. Objective: The aim of the
present review is to highlight on AKI indicators that have been established during the recent decade.
Methods: A comprehensive search was conducted in 4 data bases [PubMed, Google Scholar, and Egyptian Knowledge
Bank], with keywords "Acute Kidney Injury, Biological Markers OR Intensive Care AND Postoperative Care", in peer-
reviewed articles between May 2001 and March 2022. Boolean operators (AND, OR, NOT) had been used. These
databases were searched for articles published in English. Documents written in a language other than English have
been disregarded since no sources for interpretation were discovered. Dissertations, conversations, conference abstract
papers, and anything other than the primary scientific investigations had been disqualified. Results: Initiating a KDIGO
preventive bundle in high-risk cases identified by markers might lower the occurrence and development of AKI, but had
no positive impact on patient-centered outcome. Conclusion: The strength of evidence limits the widespread use of
markers to guide RRT initiation decisions. CCL14 is one of the newly identified markers of renal non-recovery.
Keywords: Acute Kidney Injury, Biological Markers, Intensive Care.
INTRODUCTION
Markers must be created by damaged cells, display
Acute kidney injury (AKI) is a prevalent illness
organ selectivity, and have a concentration
that affects 57.5% of hospitalized cases and 50-60% of
proportionate to the extent of injury in all organs. It
the severely sick. The current criteria for diagnosis
should be determined early after organ failure when
include a sudden drop in glomerular filtration rate
such damage is still theoretically reversible, its
(GFR), as shown by an abrupt increase in serum
concentration should decline swiftly after the acute
creatinine (SCr) levels or a decrease in urine output
injury event to permit it as a follow up method, and it
(UO) over certain duration. A growing number of
must be evaluated immediately and correctly (4).
researches have been done over the past several decades
to standardize the definition and diagnosis of AKI and
Pathophysiology and markers of AKI
to further our understanding of this condition (1).
The majority of existing knowledge on the
Markers are currently being developed for predicting
mechanism of AKI in humans comes from animal
AKI, and numerous markers have been proposed to
research. An inflammation process appears to have a
diagnose AKI and assess its development. Although
substantial role in initiating AKI, regardless of the kind
there is necessity to risk stratify AKI, no risk
of insult or clinical situation. As a result of AKI, renal
stratification system have been universally accepted due
endothelium and tubule cells produce inflammatory
to their inadequate sensitivity and specificity (2).
mediators. Immediately following an injury, white
In the past 50 years, the utilization of biochemical
blood cells immigrate to the inflammation site and
indicators of cardiac damage has experienced
marginate through peritubular vascular endothelium.
remarkable alterations. The measurement of aspartate
Inflammatory damage to the endothelium is followed by
amino transferase has been replaced by the troponin.
an increase in capillary permeability, which within
This advancement in diagnostic capability and
twenty-four hours permits neutrophil migration into the
sensitivity has proven fundamental to the concurrent
renal interstitial tissue and tubule lumen. Throughout
improvement in heart damage therapy and survival.
migration, neutrophils secrete inflammatory cytokines
This is in striking contrast to the clinical practice of
that exacerbate tubular damage. The tubule response is
measuring SCr in relation to biochemical indicators of
eventually characterized by a loss of cytoskeletal
kidney functionality and damage. SCr is an indication
stability that leads to apoptosis and necrosis of tubule
of kidney functionality but not of renal damage, and the
cells (5).
concentration of serum SCr does not alter until
Unknown are the underlying pathophysiology and
approximately 50% of kidney functionality is lost,
timing of the lower GFR during this period.
varying with muscular weight, age, gender, medications
Hypothesized mechanisms include tubule obstruction
(2,3).
by depraved cells, renal vascular spasm caused by the
1264
Received: 08/08/2022
Accepted: 11/10/2022
c:\work\Jor\vol901_190
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1268-1273
Prognostic relevance of CD69, Vascular endothelial growth factor and Thymidine kinase in B-chronic
lymphocytic leukemia
Rasha I. Noreldin(a), Alshimaa M Alhanafy(b),Reham S. El Zaiat(a), Iman A. Ahmedy(a)
(a) Clinical Pathology Department, Faculty of Medicine, Menoufia University, Menoufia, Egypt, (b) Clinical
Oncology& Nuclear medicine department ,Faculty of Medicine, Menoufia University
Corresponding author: Rasha Ibrahim Mohamed Noreldin Assistant professor, Clinical Pathology Department Faculty of
Medicine, Menoufia University Tel: 01024110953, E-mail address: rnoreldin@yahoo.com
ABSTRACT
Background: B-chronic-lymphocytic-leukemia (B-CLL) is a heterogeneous illness with a varied clinical history. Some
individuals don't require therapy while others have an aggressive disease. Researchers discovered several prognostic
biomarkers to help clinicians make decisions about whose patients will be in need to start treatment. Developing
immunophenotyping markers such as CD69 and other serum markers such as TK and VEGF are evolving over time.
Objective: This study aimed to assess relevance of CD69 as prognostic indicator in CLL cases and its association with
Vascular-endothelial-growth factor (VEGF) and Thymidine-kinase (TK) activity.
Methods: The research had 80 patients with B-CLL and 17 healthy controls. All subjects underwent routine laboratory
investigations, flowcytometric analysis of CLL panel, CD38 and CD69 and TK activity and VEGF level by ELISA.
Results: CD69 %, VEGF and TK were significantly higher in patients than in controls. Patients who required treatment
had significantly higher CD69% and elevated levels of VEGF and TK than patients who were untreated. Correlation
between CD69% with different parameters revealed significant positive correlation between CD69% and age, modified
Rai staging, TLC, lymphocyte, B2 microglobulin, LDH, Coombs`test, receiving chemotherapy, CD 38/19%, VEGF and
TK. CD69% at cut off levels of > 45% can significantly detect time to start chemotherapy with sensitivity and specificity
of 88.89% and 77.27%. Regression analysis showed that age, modified Rai staging, lymphocyte count and HB level were
independent variables that can predict CD69 expression. Conclusions: CD69, TK and VEGF could be considered as
poor prognostic markers adding a new option for development of new prognosis score system.
Keywords: Chronic lymphocytic leukemia, Biomarkers, CD69, Prognosis, Scoring.
INTRODUCTION
angiogenesis. It has a tight connection to human
B-chronic lymphocytic leukemia (CLL) is defined
tumorigenesis and the development of many
by an excess of monoclonal B lymphocytes with the
malignancies. Solid tumor development, diffusion,
CD19+/CD5+/CD23+ phenotype in lymphoid tissue,
metastasis, and a poor prognosis are connected to
peripheral blood, and bone marrow. According to
elevated VEGF levels in blood. In hematological
statistics, CLL accounted for 2530% of leukemia
malignancies like multiple myeloma, CLL, non-Hodgkin
diagnoses, giving it the most common kind of leukemia
lymphoma and chronic myeloid leukemia, its levels are
in adults in North America and Europe (1). The illness is
increased (7). It activates mitotic responses as it stimulates
diverse and has a varying clinical history; some people
growth, migration, and survival and it improves
have an indolent course and don't need treatment, while
hematologic malignancies' leukemia progenitor cells'
others have an aggressive illness with a short duration
capacity for self-renewal (8). One of the tumor indicators
and overall survival (2). As a result, researchers
that may be detected in constantly proliferating cells is
discovered several prognostic biomarkers and staging
thymidine kinase (TK). Serum TK activity is elevated in
systems to help clinicians make decisions about whose
many types of cancer. Also, TK was utilized in CLL as a
patients will be in real need to start treatment. These
diagnostic indicator (9).
biomarkers include serum markers, immunophenotyping
Various research showed the importance of CD69
markers, microRNAs, chromosome aberrations, IGHV
and CD38 expression as prognostic indicators in CLL.
mutation status and gene mutations (3). ZAP-70 and
Enhanced serum TK and VEGF level was found also in
CD38 are established immunophenotyping markers that
patients with advanced disease stage (10).So, we
can predict aggressive stages. Conversely, leukemia
conducted this research to evaluate relevance of CD69 as
tends to develop slower and have better prognosis when
prognostic indicator in B-CLL cases and its association
the CLL cells are deficient in these proteins (4). Other
with VEGF, TK activity.
developing immunophenotyping markers such as CD69
SUBJECTS AND METHODS
are evolving over time. CD69 is a human
This case control research was conducted in the
transmembrane C-type lectin protein produced by
Clinical Pathology Department, Faculty of Medicine,
the CD69 gene located in the natural killer (NK) gene
Menoufia University between November 2020 and
cluster at chromosome 12. It is expressed as an activation
October 2021. The patients were selected from Inpatient
marker in hematopoietic stem cells (5). Given that CD69's
Wards and Outpatient Clinics, Oncology Unit, Menoufia
production is elevated following activation in the
University Hospitals. The study included 97 subjects
majority of leucocytes and it regulates immunological
divided into two groups: Group I: included 80 CLL
responses, it is employed as an activity indicator of active
patients presented to Oncology Department and Group
lymphocytes and NK cells. (6). VEGF is an important
II: included 17 healthy subjects of matched age and sex
positive mediator of physiological and pathological
as control group. All patients were subjected to the
1268
Received: 10/10/2022
Accepted: 16/12/2022
c:\work\Jor\vol901_191
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1274-1283
Antimicrobial and Antibiofilm Activity of Gold Nanoparticles Biosynthesized
Using Acinetobacter Baumannii Isolated from Wounds and Burns
Intesar H. Al-Abdeli* and Esam J. Al-Kalifawi
Department of Biology, College of Education for Pure Science Ibn -Al- Haitham,
University of Baghdad, Baghdad, Iraq
*Corresponding author: Intesar H. Al-Abdeli, Mobile: (+20) 01140292959,
Email: Intessar.Hameed1102a@ihcoedu.uobaghdad.edu.iq"
ABSTRACT
Background: Due to their biological and physiochemical characteristics, metal-based nanoparticles show promise as
antimicrobials and therapeutic agents.
Aim: This study aimed to biosynthesize AuNPs from A. baumannii broth and test their antibacterial and ant-virulence
properties.
Materials and methods: UV-vis, FTIR, XRD, TEM, FESEM and AMF were used to analyze biosynthesized gold
nanoparticles. The well method diffusion assay was utilized to determine Ab-AuNPs' antibacterial activity against five
bacterial strains. Microtiter plate was used to study the effect of Ab-AuNPs on biofilm formation in five bacterial
isolates.
Results Biosynthesized Ab-AuNPs feature 574 nm UV-Visible SPR bands. Ab-AuNPs biosynthesized at 3321.42,
2823.79, 2144.84, 1631.78 cm-1, amide III, polypeptides, and proteins form these bands. A. baumannii polypeptides
capped AuNPs. The peaks at 111, 200, 220, and 311 reflect the 2 Bragg angles 38.18°, 44.51°, 64.80°, and 77.72°.
Debye Scherrer's equation calculated Ab-AuNPs crystallite size (26.82 nm). Biosynthesized Ab-AuNPs were 20-90
nm in size, with an average of 66 nm. AFM measures Ab-AuNP shape. AFM images show Ab-AuNP size distribution.
Ab-AuNPs averaged 63.82 nm. The diameter of the inhibitory zone decreases with Ab-AuNP concentration.
Biosynthesized Ab-AuNPs inhibited biofilm formation in five bacterial strains.
Conclusions: We concluded that the biosynthesized Ab-AuNPs have effective antibacterial and antibiofilm activity that
could enhance the action of existing antibiotics and could be a therapeutic agent.
Keywords: Gold nanoparticles, Acinetobacter baumannii, Antibiofilm activity, Antibacterial activity.
INTRODUCTION
nucleic acid synthesis inhibition are just a few of NPs'
Acinetobacter baumannii is gram-negative
antimicrobial effects (8). Many NPS size and surface
strictly aerobic, nonmotile, encapsulated, non-lactose-
chemistry of the govern their antibacterial properties.
fermenting and non-fastidious coccobacillus (1, 2). A.
Bacterial biofilm is particularly resistant to antibiotic
baumannii is very adept at living in hospital
treatment (9).
environments. Because it can form biofilms, it can
This ascribes to the spread of resistance indicators
cause infections that last for a long time. A baumannii
and the extracellular polymeric matrix's ability to
is extensively present in natural surroundings and
obstruct drug transport (10). Biosynthesized AuNPs have
constantly accompanying aquatic environments as an
been shown to have antibiofilm activity against harmful
opportunistic bacterial pathogen that precipitously
bacteria (11).
increases nosocomial infections (3, 4).
The necessity for nanoparticle biosynthesis has
MATERIALS AND METHODS
increased. As a result, researchers have turned to
Collection of pathogens bacteria
microorganisms and plant extracts to create
We collected twenty-five Multiple antibiotic-resistant
nanoparticles (5).
isolates from a burn and wound. The current study was
Gold nanoparticles (AuNPs) have an advantage
conducted at Yarmouk Teaching Hospital and Baghdad
because they are high in the surface area-to-volume
Medical City laboratories in March 2022. They
ratio, improved biocompatibility, and low in the
included five strains of bacteria; Acinetobacter
toxicity. So, AuNPs is an important bionanotechnology
baumannii, Pseudomonas aeruginosa, Staphylococcus
tool. As the core magnitude grows from 1-100 nm, gold
epidermidis,
and
Escherichia
coli.
Standard
NPs with surface plasmon resonance show a range of
biochemical tests and diagnostics identified these
hues in an aqueous solution, including red, brown,
isolates and, finally, the Vitek 2 Compact system (12).
orange, and purple (6). The enormous potential of
microorganisms as eco-friendly and economical tools,
Biosynthesis of gold nanoparticles"
Due to a variety of reductase enzymes, changing metal
The modified procedure of Sabir et al. (13) was used
salts into metal nanoparticles narrowly to a lesser
in the biosynthesis of AuNPs. Two milliliters, four
degree of polydispersity, microorganisms can
milliliters, six milliliters, eight milliliters, and ten
accumulate and detoxify heavy metals (7). The cell
milliliters of A. baumannii broth culture mixed with ten
membrane bactericidal destruction, interference with
milliliters of stock solution of HAuCl4.4H2O separately
enzyme pathways, microbial cell wall alteration, and
in a flask and heated at 50°C for 30 minutes on a
1274
Received: 03/08/2022
Accepted: 04/10/2022
c:\work\Jor\vol901_192
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1284-1293
Evaluation of Topical Sodium Valproate-Loaded Nano Spanlastics
Formulation versus Minoxidil® 5% in The Treatment of Female Pattern
Hair Loss Using Transdermal Delivery: A Comparative Study
Amany Moustafa Abdel-Moiti*1, Farid Abd-Elreheim Badria2,
Sara Hamdy Fouad Aly1, Hassan Abdel-Raheim Fayed1
Departments of 1Dermatology, Andrology & STDs, Faculty of Medicine and
2Pharmacognosy, Faculty of Pharmacy, Mansoura University, Dakahlia, Egypt
*Corresponding author: Amany Moustafa Abdel-Moiti, Mobile: (+20) 01028211308,
E-Mail: amanymoustafa2500ma@gmail.com
ABSTRACT
Background: Valproic acid (VPA), is often used as an anticonvulsant drug that activates the Wnt/-
catenin signaling pathway and blocks GSK3b, a glycogen synthase kinase, and though connected with increasing
hair growth and induction of anagen. Currently, only FDA-approved two percent topical minoxidil is available therapy
to treat female pattern baldness. Objective: This randomized controlled clinical trial study aimed to evaluate the
effectiveness of topical VPA and 5% topical minoxidil for treating Female pattern hair loss (FPHL).
Patients and methods: This study included 81 patients with FPHL who were allocated into three groups randomly
(27 treated with topical sodium valproate-loaded nano spanlastics formulation, 27 treated with minoxidil® 5% lotion,
and 27 treated with saline bottled containers using transdermal delivery using a derma roller for 6 months. The
included patients were chosen randomly from the Outpatient Clinic of Dermatology, Andrology & STDs Department,
Mansoura University Hospitals. All patients were subjected to history taking, and general dermatological and scalp
examination.
Results: In comparison to the control group, the mean change in the total number of hairs was substantially larger in
the VPA and minoxidil groups (P = 0.047). Although the majority of adverse events in both groups were moderate and
self-limiting, the variations in prevalence rates across the groups were comparable (P = 0.72).
Conclusion: Topical VPA and 5% minoxidil increased the total hair count of our patients ; therefore, topical VPA is a
potential therapy option for FPHL.
Keywords: Female Pattern Hair Loss, -catenin, Glycogen synthase kinase 3, Hair, Valproic acid, Wnt, Minoxidil.
INTRODUCTION
administration that can stimulate the
The gradual transformation of thick, pigmented
development of new hair (8). Topical VPA
terminal hair into short, thin, non-pigmented vellus
administration that was accurate and effective was
hair is the main character of female pattern hair loss
previously unfeasible, but to get around these
(FPHL),
non-scarring
alopecia.
Hair
follicle
limitations, dissolvable microneedles (DMNs) were
miniaturization is the name of this undesirable
developed to move large molecules over the epidermal
process(1).
barrier (9).Therapeutics can be encapsulated in DMNs
Much recent research examined the connection
and released minimally invasively upon skin
between androgenetic alopecia (AGA) and Wnt/
implantation (10). In human dermal papilla cells,
catenin signaling, a series of signal transduction
minoxidil® prolongs the anagen phase and stimulates
pathways that start with proteins that transfer signals
the -catenin transcriptional pathway. These small
into the cell through cell surface receptors (2). Valproic
results could be enough to halt follicular shrinking or
acid has recently been shown to be more efficient promote hair growth in balding scalps (11). This study
than Minoxidil at stimulating the renewal of hair
aimed to evaluate the effectiveness of topical VPA and
follicles (3,4).
5% topical minoxidil for treating Female pattern hair
The carboxylic acid derivative (VPA) activates
loss (FPHL).
some signaling pathways, including, Wnt/catenin
PATIENTS AND METHODS
signaling which is implicated in hair formation (5).
Study population
According to some studies, By inhibiting glycogen
Female patients, 1945 years old who had
synthase kinase 3b (GSK3b), VPA promotes hair
FPHL graded according to Ebling and Rook
follicles' move from the telogen (resting phase) to the
classification were recruited from the Outpatient Clinic
anagen (active phase) (6). Furthermore, Wnt elevates
of Dermatology, Andrology, STDs Department,
catenin levels significantly, but when it is not present,
Mansoura University Hospitals. Patients with
GSK 3b phosphorylates and degrades -catenin
abnormal physical or laboratory results, systemic
proteins. Therefore, We believe that when VPA is
illness such as heart and renal diseases, a hair
applied, it causes (i) Wnt protein to bind to cell surface
transplantation history, 3 months topical minoxidil
receptors, (ii) GSK-3b to be prevented from
treatment, or any drugs such as dutasteride and
phosphorylating -catenin, and (iii) the proliferation of
finasteride for 6 months and pregnant or lactating
Hair Follicle stem cells (7). Topical administration of
females were excluded.
solvent-based VPA is the only method of
48>:
Received: 01/08/2022
Accepted: 02/10/2022
c:\work\Jor\vol901_193
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1294-1299
Extremities Fractures and Fixation and Their Effects on Patients, Quality of Life
Eman M Emara, Nagwa R Attia, Zeinab F Bahgat
Medical & Surgical Nursing, Faculty of Nursing, Tanta University, Egypt
Corresponding author: Eman Mohammed Emara, Email: eman.emara@nuring.tanta.edu.eg, Tel.: +201016925551
ABSTRACT
Background: Worldwide extremities fractures is one of the most frequent causes of physical disability and changes in
patients' quality of life. Aim: This study aimed to assess extremities fractures and fixation and their effects on patients'
quality of life. Subjects and methods: A descriptive study that was conducted at the Orthopedic Departments in Tanta
University Hospital and Casualty Hospital affiliated to Ministry of Higher Education, Egypt. A convenience sample of
100 adult patients (18-60years) of both sexes, conscious and able to communicate verbally without any neurological
problems. The assessment was done four times throughout the period of the study before fixation surgery and one week,
one month and three months after fixation surgery. Three tools were used: Tool (1) Structured interview questionnaire
that included 2 parts, part (1) Sociodemographic questionnaire and Part (2): Clinical assessment. Tool (II) The short
musculoskeletal function assessment questionnaires. Tool (III): Short form 36 (SF-36) health survey questionnaire.
Results: There was a negative impact of extremities fracture on patients' total quality of life. oth extremities and specific
lower extremity fracture had the poorest quality of life scores than upper extremity fracture.
Conclusion: Extremities fractures and their surgical management including internal and external fixation have a
considerable effect on all dimensions of patients' quality of life.
Keywords: Upper extremity fracture, Lower extremity fracture, Internal fixation, External fixation, Quality of life.
INTRODUCTION
mostly affected dimension, and the need for a care plan
Musculoskeletal fractures are common and are
centered on the provision of complete care for this
considered the main injuries seen in the emergency
aspect. This is due, in part, to a lack of consensus over
department in which the extremity fractures are the most
the criteria of impairment and decreased function
prevalent injuries and are a significant source of illness
coupled with bone fracture (7). The aim of the study was
burden and lost productivity in society (1). A bone
to determine the effects of extremity fractures and
fracture is a breach in the continuity and integrity of the
fixation on patient's quality of life.
bone caused by the inability of the bone to tolerate
Research Questions: What is the relation between
external pressures. The management of extremity
extremities fractures and quality of life? What is the
fracture depends on reduction and immobilization of the
relation between fracture fixation types and quality of
fractured site, which include medical, surgical and
life? and What is the mostly affected dimension of
nursing management. The medical treatment includes
quality of life in need for comprehensive nursing care
examination and inspection for deformity, bruising,
strategies?
effusion, open wounds and then urgent reduction and
splinting are performed (2).
SUBJECT AND METHOD
Surgical management of fracture include internal
This descriptive research was conducted at the
and external fixation. Internal fixation refers to the
Orthopedic Departments in Tanta University Hospital
process of joining the bones physically. This technique
and Emergency Hospital affiliated to Ministry of Higher
employs specific screws, plates, wires, or nails to
Education, Egypt. A convenience sample of one
properly align the bones, followed by reduction (3).
hundred adult patients (18-60years) of both sexes,
External fixation is a procedure for fracture stabilisation
conscious and able to communicate verbally without
in which pins or wires are percutaneously inserted into
any neurological problems, pathological fracture and
bone and kept in place by an external scaffold (4).
without any chronic diseases.
Quality of life (QOL) is largely an individual's
Methodology: Three tools were utilized in this study:
subjective perception of physical, psychological, social,
Tool (1) Structured Interview Questionnaire: This
and spiritual well-being. Physical and mental health,
tool has been developed after reviewing of recent
degree of independence, and social engagement with the
relevant literature (8-9). It comprises two components:
environment will affect an individual's QOL as also rely
Part (one): Sociodemographics: age, sex, marital
on external factors (5). The orthopaedic nurses
status,education and work field. Part (two): Clinical
have a distinct role as they provide patient centred care
data assessment: such as types and site of fracture, type
depends on evidence-based research and practice as
of fixation, past medical and surgical history, present
well as focused on individualized care using various
medical and surgical history, smoking, current
strategies (6).
medication use and vital signs (temperature, pulse,
Significance of the study: Musculoskeletal
respiration and blood pressure).
injury is one of the leading causes of physical disability
Tool (II) The Short Musculoskeletal Function
on a worldwide scale, but nursing appears to lack data
Assessment Questionnaires (SMFA): Initially created
on the severity and effect of this hardship on QOL. The
1294
Received: XX/XX/2022
Accepted: XX/XX/2022
c:\work\Jor\vol901_194
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1300-1302
Liposarcoma of Spermatic Cord: A Case Report
Wael Mohamed Abdelgawad Hamed*, Hassan Mohamed Khalaf, Waleed Mohamed Allam,
Khalil Taha Abo Rokba, Eslam Atef Abdelmoneim Sharara, Mohamed Elsaid Aboelnadar AbdelAty
Damanhur Medical National Institute, Elbehiera, Egypt
Corresponding author: Wael Mohamed Abdelgawad Hamed, Tel.: 01223004249, Email: waeldoc80@gmail.com
ABSTRACT
A painless inguinal or scrotal tumor is a characteristic of the uncommon illness known as liposarcoma of the spermatic
cord (LSC). We introduce a 40-year-old man who was hospitalized to the Surgery Department with indications of a
right inguinal unilateral, painless, hard, firm mass that was slow-growing. Histopathology evaluation revealed a
lipomatous neoplasm formed of lobules of fat cells of variable size having large nuclei with few showing nuclear
indentation by vacules. The fat cells are separated by either loose myxoid stroma or fibrous stroma that shows atypical
cells with large hyperchromatic nuclei. The mass is surrounded by an intact facia. The submitted membranes and
fibrofatty tissues are free from tumor invasion.
Keywords: Spermatic cord, Liposarcoma, Radical orchiectomy, Case report, Damanhur Medical National Institute.
BACKGROUND
The most prevalent primary cancerous tumor of
When the patient performed the Valsalva maneuver, it
the spermatic cord is a malignant tumor called
was discovered during a clinical examination that the
liposarcoma, which develops from mesenchymal cells
swelling had descended from the inguinal canal into the
(1).
scrotum. This led to the clinical and radiological
Patients of all ages may develop primary spermatic
diagnosis of an indirect inguinal hernia.
cord tumors, which make up 7-10% of all intrascrotal
A multi-loculated, encapsulated yellow mass was
tumors but are very uncommon. In most cases, they
discovered intra-operatively after the spermatic cord
manifest as hard, palpable, slow growing paratesticular
was severed; there were no hernias seen, and the mass
lumps. Even though lipomas make up the majority of
was totally dissectable from the surrounding tissues
them, which are mostly benign, 25% of them are
with the intact capsule and preservation of the spermatic
potentially fatal malignant tumors (2).
cord and testis.
Lipomyosarcomas,
leiomyosarcomas,
The final pathological evaluation of the specimen
rhabdomyosarcomas, malignant fibrous histiocytomas,
was well differentiated liposarcoma with intact capsule
and fibrosarcomas are the most often reported
and free surgical resection margin, metastatic work up
malignant histological forms. Due to the rarity of these
was done and was free. Consultation was done with a
malignant tumors, treatment has been challenging, and
consultant medical oncologist for if the patient in need
there is no agreement on the best surgical and non-
for radical orchiectomy, the final decision is no need for
surgical treatment approaches. (3).
further surgical interventions.
Less than 200 instances of paratesticular
liposarcomas have been documented in the literature as
HISTOPATHOLOGY
of this writing. Most of these tumors are present as
Gross pathology stroma or fibrous stroma that
scrotal or inguinal lumps that are painless and slowly
shows atypical cells with large hyperchromatic nuclei.
developing. Spermatic cord liposarcomas are
The mass is surrounded by an intact fascia. The
uncommon, and because of this, they are frequently
submitted membranes reveals a well-defined mass with
misdiagnosed as inguinoscrotal hernias, hydrocele,
intact facia measuring 11x9x8cm, the mass has a
lipomas, funicular cysts, or testicular cancers (4).
lobulated yellow myxoid cut section admixed with
There is limited information about liposarcomas
whitish areas. Also submitted is a membranous
and no formal guidelines or standards for diagnosis,
structure 10x4cm and small fibfofatty specimen's
therapy, or patient follow-up due to the rarity of these
collectively measuring 4x4cm. Histopathology report
tumors. Due to these restrictions, there is no universal
reveals a lipomatous neoplasm formed of lobules of fat
agreement on the best surgical and adjuvant therapies
cells of variable size having large nuclei with few
(5).
showing nuclear indentation by vacules. The fat cells
are separated by either loose myxoid and fibrofatty
CASE PRESENTATION
tissues are free from tumor invasion.
A 40-year-old male patient with a painless movable
The patient gave informed permission for the
mass in the right inguinal area was seen in April 2022
sharing of the information displayed here.
at Damanhour Teaching Hospital in Elbehiera, Egypt.
1300
Received: 03/08/2022
Accepted: 04/10/2022
Chapter one
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1303-1307
Evaluation of Some Biochemical Parameters and Their Use in The
Diagnosis and Follow-Up Women Ovary Cancer's Patients
Jamal A. ALJabbar Attawi*, Alzahraa S. Abdulwahid
AL-Hadi University College, Baghdad, Iraq
Corresponding author: Jamal A. ALJabbar, Phone: 964 790 691 6187, Email: dr.jamal.a@huc.edu.iq
ABSTRACT
Introduction: The common type of cancer among women is epithelial ovarian carcinoma (EOC); this is because
there aren't sufficient early diagnostic indicators. Each tumor marker has a special set of use for screening,
diagnosing, evaluating response to therapy, and monitoring for cancer recurrence.
Objective: The aim of the current is to assess role of biochemical markers in diagnosis of ovarian cancer patients,
such as serum total sialic acid, Glycoprotein, Ferritin, and Cancer Antigen 125. Additionally, the impacts of
oxidative stress in cancer cells that initiate apoptotic pathways will be investigated.
Patients and methods: The participants of this study comprised 36 women with epithelial ovarian cancer patients,
and 36 women with benign ovarian mass (pathological controls). Other 36 women were considered normal healthy
controls, who attended for treatment in Al-Amal National Cancer Hospital from January 2022 till June 2022.
Results: Epithelial ovarian cancer patients had a mean age of 52.8 (SD 9.7) years, and benign ovarian mass
(pathological controls) had a mean age of 49.6 (SD 5.9) years. Normal healthy controls had mean age of 50.7 (SD
3.8) years. Serum TSA, glycoprotein, ferritin, and CA-125, can provides useful information for patients in a
diagnosis of ovarian cancer particularly in early-stage disease. Ferritin discriminates between healthy controls and
patients with epithelial ovary cancer's, particularly in early-stage disease. In order to test for EOC, serum ferritin
and CA125 together offer highest level of diagnostic efficiency.
Conclusion: Early identification and diagnosis of metastasis in women with ovarian cancer is beneficial for therapy
and can be utilized to determine why cancer cells develop chemoresistance.
Keywords: Total sialic acid, CA125, Malondialdehyde, Glutathione, Caspase-3, Comparative study, AL-Hadi
University College.
INTRODUCTION
Total sialic acid (TSA) is involved in tumor
ovarian neoplasms are associated with high levels of
development and metastasis (1).
this glycoprotein (7). Due to iron overload increasing
Due to the lack of early diagnostic indicators,
the levels of oxidative stress and mutagenesis,
epithelial ovarian cancer is frequently discovered at a
ovarian epithelial cells may be subjected to a
late stage. The serum sialic acid ratio may aid in the
sublethal quantity of oxidative stress and may
detection of ovarian cancer because sialic acid linking
therefore become of causing cancer (8).
of N-glycans in modulations occurs even in early
Patients' serum iron levels were downregulated,
stages of the disease (2). The amount of free or
and ferritin levels were overexpressed, which may be
attached sialic acid was related with both the growth
a potential target for the detection and therapy ovary
and severity of the tumor. Sialic acid is utilized to
cancer's (9).
assess the efficacy of various malignancy therapies
A common marker for ovarian cancer diagnosis
and diagnostic developments (3).
is CA125. In the EOC groups, a considerable rise in
Chemical
markers
called
glycoprotein
CA125 was unmistakably seen. Ferritin was
oligosaccharide chains are utilized to identify proteins
examined and revealed a comparable rise in the EOC
that will be employed outside of the cell.
groups (10). The ferritin is necessary for preserving the
Glycoproteins include a range of polypeptide
cellular redox state. It has been shown that ferritin
hormones.
regulates the proliferation of cancer cells in ovarian
Glycolipid and glycoprotein residues that are
cancer (11).
membrane-bound can be found on the cell surface (4).
The intrinsic apoptotic pathway was activated
Patients with ovarian cancer may have high serum
as a result of the induced formation of intracellular
glycoprotein levels because of aberrant protein
reactive oxygen species (ROS). Apoptosis is
glycosylation, which indicates that the cells have
generated along with changes in ROS signaling and
undergone malignant transformation (5). In order to
induction of apoptosis (12).
diagnose ovarian cancer, patients can benefit from the
In healthy cells, ROS operate as antioxidants,
information provided by CA125 (6).
but in cancer cells, they are powerful pro-oxidants
A glycoprotein called CA 125, which is
that activate the apoptotic pathways (13). Caspases are
typically generated by cancerous cells with epithelial
specific cysteinyl aspartate-degrading proteases
development, acts as a tumor marker. The
utilized in programmed cell death, while apoptotic
histological grade of primary ovarian neoplasms and
caspases include executioner caspase-3 (14).
serum levels of CA 125 were related, showing that
1303
Received: 04/08/2022
Accepted: 06/10/2022
c:\work\Jor\vol901_196
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1308-1314
Green Synthesis of Ag Nanoparticles Using Musa Acuminata Fruit Peels and
Determination of Its Inhibitory Effect on Pathogenic Bacteria
Ussama Asaed Fazel, Abbas Yassen Hasan
University of Diyala, College of Science, Department of biology, Diyala, Iraq
Corresponding author: Ussama Asaed Fazel Email: Scibioms2103@udiyala.edu.iq Tel. +964 770 628 0515
ABSTRACT
Background: Creation of biocompatible compounds using nanotechnology as anticancer agent, on other hand, were highly
effective against MCF-7 breast cancer cells and had reasons of cell death, making it one of the novel approaches in field of
cancer therapy. Aim: Impact of Ag nanoparticles using Musa acuminata on pathogenic bacteria.
Methods: 125 samples were collected with various infections. All necessary examinations for preliminary diagnosing of
isolated bacteria were carried out and confirmatory diagnosis of these isolates by the Vitek- 2 system. Biosynthesis of silver
nanoparticles was conducted via green methods by using Musa acuminata alcoholic extracts, and properties of silver
nanoparticles were defined by spectrophotometer.
Results: The largest Ag NPs 75 nm for alcoholic Musa acuminata extract and FTIR analysis showed presence of flavonoids
and tannins in abundance in Musa acuminata fruits, using an agar diffusion assay, silver nanoparticles biosynthesized from
Musa acuminata isolates demonstrated antimicrobial efficacy against E. coli, S. epidermidis, K. pneumoniae, S. aureus and
P. aeruginosa. At 12,5 mg/ml Ag NPs, it was shown that growth of these bacteria was suppressed. Concentrations of
nanoparticles (12,5, 25, 50, 100 and 200 mg/ml) exhibited greatest inhibitory effects on S. aureus (20 mm), E. coli (18 mm),
K. pneumonia (20 mm), and P. aeruginosa (15 mm) and S. epidermidis (24 mm).
Conclusion: Klebsiella pneumonia was the most common infection in diabetic foot. Ag NPs could be used as potent
nanomedicines that are ideal substitutes for crude extract in treatment of diabetes mellitus.
Keyword: Musa acuminata, Bacterial, Diabetic Infection, Ag nanoparticales.
INTRODUCTION
Baaquba market in Diyala. An appropriate amount of
Antimicrobial resistance has become alarming in
banana peel drying under sunlight irradiation for a certain
recent years and poses a serious global public health threat
period. Then, cutting it into very small pieces. For
according to the World Health Organization (WHO). The
preparing plant extract, the banana peel is washed with
prevalence of multidrug resistant (MDR) strains has
ethanol then 25 g of peel pieces are added to a glass flask
created significant difficulties in the treatment of burn
containing 300 ml of the ethanol under a magnetic stirrer
infections. Multidrug-resistant bacterial infections are
for 180 min and temperature heat for 80 0C. After that a
becoming a serious problem around the world
yellow extract was obtained and the precipitation was
necessitating an immediate search for alternatives. The
separated by filter paper. The plant extract is saved in the
emergence of MDR isolates has complicated antibiotic
refrigerator (5).
efficacy even further reducing therapeutic options in
Collection of specimens
health services as a result increasing medical costs,
Several 125 specimens were obtained from Baaquba
morbidity and mortality rates (1). The high efficacy and
Teaching Hospital in Diyala province from October 2021
therapeutic index of nanotechnology against microbes
to February 2022 from people suffering from various
makes it a promising therapeutic approach (2).
illnesses. The sources of samples included diabetic foot
Nanoparticle have the potential to become a vital
ulcers. These samples underwent tests like catalase and
viable therapeutic option for treating drug-resistant
oxidase as well as culturing in ready-made media like
infections. They are viewed as potential replacements and
Blood agar, Brain Heart Infusion broth (BHIB),
supplements to existing antimicrobials (3).
MacConkey agar, Mannitol Salt agar, Muller-Hinton
Silver nanoparticles (Ag NPs) have become a popular
agar, Nutrient agar, and Nutrient broth. By autoclaving,
class of nanomaterials for various commercial and
the culture media were made sterile. After being prepared
medical uses. One of the unique methods in the field of
and kept at 4°C until they were used, they were incubated
cancer therapy is the development of biocompatible
for 24 hours at 37°C to ensure their sterility. By adding
molecules employing nanotechnology as an anticancer
fibrinogen plasma, the media can also detect coagulase
agent on the other hand were particularly efficient against
action. (6).
MCF-7 breast cancer cells and have diverse causes of cell
Antibiotic Discs
death (4).
Antibiotic discs that were used in this study to test the
MATERIALS AND METHODS
antimicrobial sensitivity by the disc diffusion method
Collection of Musa acuminata samples: Musa
were listed in table (1) according to (Clinical and Institute,
acuminata fruit used in this research was collected from
2021).
1308
Received: 04/08/2022
Accepted: 06/10/2022
c:\work\Jor\vol901_197
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1315-1322
Evaluation of the Immunohistochemical Expression of
Serotonin in Oral Lichen Planus
Hiba Jassim Rassol1*, Taghreed Fadhil Zaidan2
1 Department of Oral Diagnosis, College of Dentistry, University of Baghdad, Iraq
2 Department of Dentistry, Al-Turath Unversity College, Iraq
Corresponding author: Hiba Jassim Rassol, Phone: 9647807670890, Email: hibajassim88@gmail.com
ABSTRACT
Background: Oral lichen planus (OLP) is a T-cell-mediated disorder of oral mucosa and is mainly observed in
middle-aged adult women. The etiology of OLP is unclear.
Objective: This study investigates the potential role of serotonin in the pathogenesis of OLP, thourgh evaluation of
the immunohistochemical expression of serotonin (5-HT) in biopsies from patients with OLP and its association with
clinicopathological findings.
/Patients and methods: Paraffin-embedded tissue samples were histologically confirmed as OLP. Monoclonal
antibody serotonin was used for immunohistochemical staining. The patterns of positively stained cells were analyzed
using semiquantitative techniques.
Results: A total 40 biopsies from 24 female and 16 male OLP patients were involved. The mean age was 49.15 (SD
11.39) years. Using an immunohistochemical method, the results showed that the intensity of expression of 5-HT at
the basal layer was established in 11 (27.5%) cases who had grade 0, 18 (45%) cases had grade 1, and 11 (27.5%)
cases had grade 2, with a median H-index of 55 ranging between 0-200. The intensity of 5-HT expression at the
suprabasal layer showed that 7 (17.5%) cases had grade 0, 15 (37.5%) cases had intensity grade 1, 16 (40%) cases
had intensity grade 2, and only two (5%) cases had grade 3, with a median H-index was 80, ranging between 0-300.
The median total H-index was 153.5 (SD 111.5), ranging between 0-500. Conclusions: Serotonin has been proven in
the epithelium of oral lichen planus in most studied cases, which is considered an important marker in its pathogenesis.
Keywords: Serotonin, 5-HT, Oral lichen planus, Paraffin-embedded tissue sample, Immunohistochemical staining,
University of Baghdad.
INTRODUCTION
evaluation of the immunohistochemical expression of
Oral lichen planus (OLP) is the most common
serotonin (5-HT) in biopsies from patients with OLP
noninfectious oral mucosal disorder. It is a chronic
and its association with clinicopathological findings.
immune-mediated mucocutaneous condition (1), and
the pathogenesis of OLP and its triggering factors are
PATIENTS AND METHODS
unknown (2). Women are more likely than men to get
Study design: The study was based on paraffin-
OLP, primarily affecting people over 40 years.
embedded tissue blocks and their accompanying
However, it can also affect younger adults and children
histopathological inspection reports for 40 confirmed
(3).
OLP samples collected, between 2012 and 2020.
Serotonin, (5-HT), is a neurotransmitter and
hormone whose effects on the central nervous system
Study samples: The samples were from the archives
(CNS) and the corresponding organ systems help
of the Oral Pathology Department, College of
regulate several physiological functions. It's interesting
Dentistry, University of Baghdad. Cases with adequate
to note that a significant amount of serotonin is also
tissue samples and available clinical information
produced outside the CNS. Serotonin receptors are
confirmed by histopathological features based upon
likewise widely expressed in a diversity of peripheral
modified WHO diagnostic criteria with the relevant
organs (4). Intestinal chromaffin cells in the
case reports' data on age, gender, and site were taken.
gastrointestinal tract are the generators of peripheral
serotonin, which is released into the bloodstream, then
Sample processing: Two sections of 4 m thickness
occupied by platelets, and attracted to the site of
were cut and put onto microscopic charge slides from
inflammation upon activation. Additionally, a potent
each block. To reassess the histological picture of OLP
immunological regulator, peripheral 5-HT, affects
and ensure enough tissue, the slide was stained with
various immune cells through the immune cells
hematoxylin and eosin and an IHC analysis was carried
expressed at receptors (5-HTRs), comprised of the
out on the remaining slide.
innate and adaptive immune systems (5). Therefore, it
makes sense to suppose that 5-HT contributes to the
The histopathological assessment of inflammation:
pathophysiology of autoimmunity disorders, which
Two pathologists subjectively reviewed the OLP
could open up new avenues for dealing with them (6).
cases' microscopic slides to establish the level of
This study investigates the potential role of
inflammation. To undertake a semiquantitative
serotonin in the pathogenesis of OLP, thourgh
evaluation of inflammation, cases were classified into
1315
Received: 05/08/2022
Accepted: 07/10/2022
c:\work\Jor\vol901_198
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1323-1327
Can Diffusion-Weighted Imanging Solve the Problem of
Indeterminate Thyroid Nodule, Cross-Sectional Study
Saeda Mohamed Abd Elwhab1
1 Lecturer of radio diagnosis Department, Qena faculty of medicin, South Valley University, Egypt
*Corresponding author: Saeda Mohamed Abd Elwhab, E mail: saedamohamed904@yahoo.com
ABSTRACT
Background: Indeterminate thyroid nodule that cannot be differentiated if is it benign or malignant thyroid nodule is
problematic. Diffusion-weighted magnetic resonance imaging is new non-invasive imaging technique that can
distinguish among benign & malignant lesions.
Objective: This study aimed to investigate the role of diffusion-weighted magnetic resonance picturing in
distinguishing among malignant & benign thyroid nodules. Also, comparing apparent diffusion coefficient value with
histopathological findings. Patients & Methods: A cross-sectional research that was conducted on 15 studied cases
with solitary or dominant thyroid nodules based on ultrasonography examination from March 2021 to March 2022. Ten
were females and five were males with 20 thyroid nodules.
Results: Fifteen cases with total of twenty thyroid nodules. There were ten females and five males. Their ages ranged
from 25 to 65 years old, with mean age of 47.13 ± 0.8. Largest diameter of nodules varied from 13 mm to 55 mm, with
mean of 28.15 mm. . .ROC curve's area under curve was one. We chose an ADC cut-off value of less than and equal to
one, sensitivity, specificity, PPV, NPV & accuracy were 100%, 94.12, 75, 100, 95% respectively.
Conclusion: ADC values appeared to be capable of distinguishing benign from malignant thyroid problems. In addition,
thyroid ultrasonography & US guided-FNAC (fine needle aspiration cytology) for tissue characterization of thyroid
nodules, DWI has great value as diagnostic tool, and outcomes may even play role in selection of nodules that will
undergo FNAC.
Keywords: Diffusion-weighted imaging, Indeterminate thyroid nodule, Fine needle aspiration cytology.
INTRODUCTION
Indeterminate thyroid nodule that cannot be
parameter used to make distinction among benign &
differentiated if is it benign or malignant thyroid nodule
malignant thyroid nodules (4).
is problematic. Diffusion-weighted magnetic resonance
imaging is new non-invasive imaging technique that
PATIENTS AND METHODS
can distinguish among benign & malignant lesions.
From March 2021 to march 2022, a cross-sectional
Although, clinical features and non-invasive imaging
research was conducted on 15 studied cases with
techniques like ultrasonography do not always
solitary or dominant thyroid nodules based on
provide conclusive diagnosis to control out malignancy,
ultrasonography examination.
radionuclide scintigraphy can be used to decide which
Ten were females and five were males with 20
nodules
should
be
histopathologically
thyroid nodules. Their years old ranged from 25 to 65
evaluated. United States used this technique as first
years with a mean of 47 ± 13.8 years old. Clinically neck
stage in evaluating these nodules. But, there are
swelling was the most common presenting symptom in
overlapping criteria and no single US criterion has been
80% of patients. Other symptoms included dyspnea,
found to accurately differentiate benign from malignant
dysphagia, and hoarseness of voice that presented in
nodules. Radiation exposure is concern throughout
20% of patients, irritability, and weight loss in 12% of
radionuclide scintigraphy, and some functioning hot
patients. Patients were referred from Clinical Oncology
nodules seen in scintigraphy are malignant (1).
Department to Radio-Diagnosis Department for
Fine needle aspiration biopsy is considered gold
conventional non-contrast MRI and thyroid DWI
standard for diagnosis, and it has previously been noted
examinations. Approval of our institutional study Ethics
that outcomes of FNAB may mimic symptoms of other
Committee & informed consent from all studied cases
illnesses (2).
were obtained.
T1- & T2-weighted MR imaging can only analyse
nodules anatomically and its role in thyroid nodule
Ethical considerations:
assessment is limited because it cannot make distinction
Research was approved by Faculty's Ethics
benign from malignant nodules and cannot evaluate
Committee, South Valley University. All the studied
thyroid nodule effectiveness (3).
cases were informed about the surgery & the auto
MRI Diffusion-Weighted imaging is novel method
transplantation technique, value and possible
for detecting brain tumours. DWI is vulnerable to
complications and informed written consents were
variations in microstructure of tissue that heavily
taken from all studied cases. This work has been
impact diffusion. It has been used to evaluate thyroid
carried out in accordance with Code of Ethics of
tumours. Apparent conductivity value is quantitative
World Medical Association (Declaration of Helsinki)
for studies involving humans.
1323
Received: 10/6/2022
Accepted: 17/8/2022
c:\work\Jor\vol901_199
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1328-1333
Midterm Follow Up of Acetabular Reconstruction of Dysplastic Hips using
Structural and/or Morselized Bone Graft in Primary Total Hip Arthroplasty
Ahmad Hassan Zaki*, Ahmad Mohammed Nahla,
Mohammed Abdallah Abdelsalam, Mohamed Abd El Aziz M. Ali
Orthopedic Surgery Department, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Ahmad H. Zaki, Mobile: (+20) 01099900676, Email: AHZaki@medicine.zu.edu.eg
ABSTRACT
Background: Acetabular fixation is a dysplastic hip challenge, and many approaches for primary total hip arthroplasty
(THA) have been shown. Even though each surgical procedure was discussed, combining bulk graft with impaction of
morselized graft is promising. To confirm long-term outcomes, additional research into the clinical outcomes of a
combined set of procedures may be necessary.
Objective : The aim of the current study is to report the midterm results of using structural and/or morselized autografts
for acetabular reconstruction in a series of patients with developmental dysplasia of the hip (DDH).
Patients and methods: A total of 44 patients with 44 hips were included in the study. They were followed prospectively
for an average period of 2-3 years. Preoperative planning was done including laboratory and radiological investigations.
Harris Hip Score (HHS) was applied pre- and post-operatively.
Results: HHS was raised from 41.24 before surgery to 83.4 at the latest follow-up. The limb-length was restored to
within 0.5 cm in 38 cases (86.4%). Only 4 patients (9.09%) had radiological signs of structural graft resorption. Two
(4.5%) patients developed complete radiolucent lines and were revised for loosening. Infection complicated the post-
operative course of 3 (6.8%) patients in this study.
Conclusion: The technique of biological acetabular reconstruction using structural and/or morselized bone graft in
primary THA for cases of acetabular dysplasia is reliable, and it not only simplifies the attainment of initial stability,
but also strengthens the mid-term to long-term stability during THA in DDH.
Keywords: Acetabulum, Dysplasia, Morselized Bone Graft, Harris Hip Score.
INTRODUCTION
Acetabular deficit frequently results from
Postoperative infections, bone graft failure,
actabular dysplasia. Prevalence ranges from 5.4 to
fractures around or through prosthetic devices,
12.8% in the Danish population, 1.8% in the Korean
dislocations, vascular injuries, and nerve injuries are
population, 2.4% in the Turkish population, and 7.3% in
among the complications (4). Bulk bone grafting has
the Singaporean population (1). Genetic and intrauterine
benefits, including allowing the cup to be positioned in
environmental variables are also part of the
an anatomically correct location as opposed to a high
multifactorial etiology. Patients, who have one or more
one, supporting the acetabular component, and, if used,
of the following risk factors, including female gender,
providing useful bone stock for any upcoming revision
firstborn, favorable family history or ethnic origin,
surgery. Although it is widely acknowledged that
breech birth, oligohydramnios, torticollis, and lower-
covering and initial stability of the socket are crucial,
limb deformity, are considered to be at risk (2).
many authors have documented significant rates of
Because dysplastic hips have changed architecture,
autograft resorption, bone graft collapse, and loosening
total hip arthroplasty (THA) in these patients is a
of the socket (5).
technically challenging treatment. When performing
In the present study, we report the midterm results
THA on patients with acetabular deficit, the distorted
of using structural and/or morselized autografts for
anatomy of the acetabulum and proximal femur
acetabular reconstruction in a series of patients with
combined with the leg length disparity create significant
developmental dysplasia of the hip (DDH).
complications. Additionally, since the majority of
patients are younger, it is crucial to maintain the
PATIENTS AND METHODS
continuity of the abductors and balance the soft tissues
This case series included 44 dysplastic hips of 44
to maximize the functional outcome of the operation.
patients (38 females and 6 males) during the period from
The following procedures for acetabular reconstruction
May 2016 to August 2020.
are described: Standard metal implants, specially made
acetabular implants, pedicled or autologous iliac grafts,
Inclusion criteria: Patients older than 18 years with
homologous or auto/homologous bone grafts,
developmental type of acetabular dysplasia.
reinforcement rings with hooks combined with
autologous graft augmentation, cranial positioning of
Exclusion criteria: Patients younger than 18 years or
the acetabulum, medial protrusion cotyloplasty
with acetabular degenerative changes secondary to post-
technique with chisel or reaming, and cotyloplasty
traumatic fracture acetabulum, degenerative joint
without spongioplasty are some of the procedures
disease, healed inflammatory disease as rheumatoid
available (3).
1328
Received: 09/08/2022
Accepted: 12/10/2022
c:\work\Jor\vol901_200
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1334-1339
Evaluation of Doppler Study of Uterine Artery and Subendometrial
Blood Flow in Unexplained Recurrent Pregnancy Loss
Ahmed Mohamed Elhessy*, Hend Abdelrhman Shalaby,
Abdelhady Abdelhady Zayed, Ahmed Abdelhamid El-Zayadi
Department of Obstetrics and Gynecology, Faculty of Medicine, Mansoura University, Egypt
*Corresponding author: Ahmed Mohamed Elhessy, Mobile: (+20) 01065449643, E-Mail: dr.ahmed.etooo@gmail.com
ABSTRACT
Background: Abortion is considered recurrent when it happens spontaneously and successively at least two times.
Recurrent pregnancy loss (RPL) can occur due to maternal or fetal factors. Studies recommend that uterine artery
perfusion could control endometrial receptivity, and that poor uterine perfusion may be a main cause of unexplained
abortion. Objective: The aim of the current study is to investigate the ability of uterine Doppler in assessing uterine
causes of RPL.
Patients and methods: A case-control study was carried out on females attended to Fetal Medicine Care Unit at
Mansoura University Hospital and Damietta General Hospital, from November 2019 to November 2020. The study
included 160 of non-pregnant women, who were divided into 2 groups; Group A included 80 participants presented with
a history of idiopathic recurrent pregnancy loss (RPL group), and Group B included 80 participants who had no history
of abortion and had at least one child born at term (Control group).
Results: There was statistically significant higher mean mid luteal endometrial thickness detected in case group than in
control group (P<0.001). The subendometrial blood flow resistance index was increased in RPL (P<0.001). Significant
increases in right and left uterine artery pulsatility index (PI) and resistance index (RI) were recorded in RPL cases in
comparison with the control group (P<0.001).
Conclusion: Uterine Doppler is a simple available method that can help in evaluation of RPL, especially PI and RI that
were significantly increased in women with RPL.
Keywords: Spontaneous abortions, Recurrent pregnancy loss, Color Doppler, Pulsatility index.
INTRODUCTION
context of the existence, direction and velocity of blood
Spontaneous abortion has been considered as the
flow (5). Prior to pregnancy, blood flow of the uterine
commonest complication of pregnancy and is described
artery reveals high resistance to absent or reversed
as the passage of a pregnancy before termination of 20
diastolic flow. The PI of uterine artery is identified to
weeks gestation. It implies delivery of all or any part of
reduce markedly throughout the luteal phase during
the products of conception (1). Prior to the termination
which implantation develops (6).
of the first trimester, 40% of conceptions end in
The aim of the current study is to investigate the
spontaneous abortion. The majority of losses develop at
ability of uterine Doppler in assessing the
implantation time. About 17.5% of clinical pregnancies
subendometrial and uterine artery blood flow (UABF)
end in spontaneous abortion (2).
and pattern of waveform of uterine artery RPL patients,
Recurrent abortion could be described as at least
in comparison with normal controls.
two successive pregnancy losses prior to 20 weeks of
gestation, with a fetus weighing less than 500gm (1).
PATIENTS AND METHODS
Though the true incidence of spontaneous abortion isn't
A case-control study was carried out on females
well identified, about 50% of clinically diagnoses
attended to Fetal Medicine Care Unit at Mansoura
pregnancies and 50% of chemically diagnosed
University Hospital and Damietta General Hospital,
pregnancies end in spontaneous abortion. Of note, about
from November 2019 to November 2020. The study
80% of spontaneous abortions happen before 12 weeks
included 160 of non-pregnant women, who were
gestation. About 1% of women are habitual aborters. In
divided into 2 groups; Group A included 80 participants
addition, there is a substantial controversy in the context
presented with a history of idiopathic recurrent
of the cause and correlation; as the actual
pregnancy loss (RPL group), and Group B included 80
pathophysiological mechanisms of the most identified
participants who had no history of abortion and had at
causes haven't been accurately clarified. The majority
least one child born at term (Control group).
of women with RPL probably have a lot of predisposing
They presented to the clinic seeking for
factors for miscarriage (3).
contraception. All females enrolled in the study had
Uterine perfusion is important in the context of
recurrent abortion (at least 2 times) and had regular
accomplishing a normal pregnancy. Researches
cycles for the preceding 3 months before the study with
recommend that uterine artery perfusion could control
no history of hormonal contraception or intrauterine
endometrial receptivity, and that recommend uterine
devices.
perfusion might a main cause of unexplained abortion
Exclusion criteria: Cases with uterine aberrations,
(4). Color Doppler could be utilized as a complementary
uterine fibroids or polypi from the study, cases with
approach to grayscale radiology to obtain data in the
bleeding tendencies, hypercoagulable conditions,
1334
Received: 09/08/2022
Accepted: 12/10/2022
c:\work\Jor\vol901_201
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1340-1344
Advanced Pediatric Recurrent Pneumonia in A Sample of
Tanta University Hospital Children
Mohamed B. Hamza*1, Heba Dawoud2, Ahmed I. Harkan3
1 Pediatric Pulmonology Department, 2 Pediatric Department,
3 Pediatric ICU Department, Faculty of Medicine, Tanta University, Egypt
*Corresponding author: Mohamed B. Hamza, E mail: mohamed.hamza@med.tanta. edu.eg
ABSTRACT
Background: Pneumonia is the most frequent reason for morbidity and mortality in children worldwide. As many as
ten times as many children die from childhood pneumonia in developing countries, compared to developed countries.
Aim: This study was conducted to investigate severe recurrent pneumonia in children.
Subjects and methods: This prospective & descriptive research were conducted on 200 patients at Tanta University
Hospital, Pediatrics Department during the period from the beginning of May 2019 to April 2022. We recruited all
patients with advanced recurrent pneumonia (RP).
Results: Mean age of advanced RP children is 15.4 months, while the age at 1st episode of pneumonia was 12.7 months.
Between children with advanced RP, the majority were males, being twice compared with females. Cough was the
prevalent symptom in 99% of cases then wheezing (63%) and fever (60%). Respiratory abnormalities were the most
prevalent (28%) as underlying causes of advanced RP patients, then immune disorders (22%) and congenital heart
diseases (16%). The pulmonary hemorrhagic syndrome was the least prevalent cause as it was observed in only 2 cases.
Conclusion: Children with underlying diseases had more serious diseases & poorer clinical results because they were
more likely to get recurrent pneumonia & were susceptible to resistant microorganisms. As a result, more emphasis can
be placed on clinical severity & therapeutic plan.
Keywords: Advanced pneumonia, Recurrent pneumonia, Underlying reasons, Children, Egypt.
INTRODUCTION
Early discovery and treatment of the underlying
Pneumonia is an infection in children & leading
cause may reduce hospitalizations, morbidity, and
reason for death worldwide. In the first two years of life,
mortality associated with pneumonia. Increased
at least 1 episode of pneumonia is anticipated in about
epidemiological studies on recurrent pneumonia,
6% of young children. The most common cause of
especially in developing countries, will help to improve
illness and mortality in children under the age of five in
preventative and treatment strategies (6). The morbidity
low- and middle-income nations is pneumonia (1).
and mortality rate among RP children known to
Pneumonia is an acute lung parenchymal inflammation
Pediatric Intensive Care Unit with severe pneumonia is
caused by both infectious & non-infectious reasons.
high (7). This study was conducted to investigate severe
According to World Health Organization, pneumonia
recurrent pneumonia in children.
impacted around 156 million children (2). 6.49% of
children with pneumonia had recurrent pneumonia (3).
Material & techniques
Recurrent pneumonia is described as having at
This prospective and descriptive cohort research
least two bouts of pneumonia in 1 year or at least three
was conducted on 200 patients at Tanta University
episodes at any period, with no clinical symptoms or
Hospital, Pediatrics Department during the period from
chest X-ray abnormalities. Even in industrialized areas,
the beginning of May 2019 to April 2022. Studied cases
up to nine percent of children with pneumonia will
categorized as advanced recurrent pneumonia, were
advance to RP. Over eighty percent of the children have
recruited.
underlying illnesses. The morbidity and mortality rate
The symptoms of tachypnea, fever, and lobar or
among RP children admitted to Pediatric Intensive Care
broncho-pneumonic infiltration, as well as chest wall in-
Unit with severe pneumonia is high (4).
drawing and breathing trouble, were utilised to make the
Inadequacies in local pulmonary or systemic
diagnosis of pneumonia.
host defenses, as well as underlying diseases that
According to research conducted by the
change lung defense are common causes of recurrent
Pediatric Infectious Diseases Society and the Infectious
pneumonia. As a consequence, physicians must
Diseases Society of America, subjects were deemed to
investigate the possible underlying reasons. There is
have progressed pneumonia if they met either 1 major
little known about the underlying diseases that
or 2 minor criteria for pneumonia (8). With no clinical
predispose
children
to
recurrent
pneumonia.
symptoms or chest X-ray lesions between pneumonia
Furthermore, few studies on this topic have been
episodes, recurrent pneumonia was defined as two bouts
undertaken in developing nations. Potential impact of
of pneumonia in a year or three episodes of pneumonia
RP on healthcare system is substantial in terms of
in any time (9).
recurrent hospitalizations (5).
STROCSS criteria were used to present this
research (10). All advanced RP children who were known
1340
Received: 20/07/2022
Accepted: 22/09/2022
c:\work\Jor\vol901_202
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1245-1255
The Ameliorative Effect of Apigenin or Silymarin as Add-On Therapy to
Risperidone on Valproic Acid Induced Autism in Albino Rats: Implication of
Oxidative Stress, Apoptosis and Autophagy
Alaa H. Abd Elazeem*, Hams M. Kotb, Heba A. Mahmoud, Sabiha E. Hedya
Medical Pharmacology Department, Faculty of Medicine, Tanta University, Egypt
Corresponding author: Alaa Hussien Abd Elazeem,
Telephone: 01226648482. Email: alaa.hussien@med.tanta.edu.eg
ABSTRACT
Background: Recent studies show that deficient autophagy, increased mammalian target of rapamycin (mTOR), oxidative
stress and apoptosis have a critical role in the pathophysiology of autism. The objective of the current study is to evaluate
and compare some possible ameliorative effects of apigenin, silymarin either alone or in combination with risperidone on
autism induced by valproic acid (VPA) in albino rats concerning; oxidative stress, autophagy, apoptosis as well as
histopathological examination & behavioral tests. Methodology: This experiment was performed on 70 male Wister albino
rats divided into seven equal groups; control group; 10 rat pups from control female rats and the other 60 rat pups from
female rats that received i.p VPA during pregnancy for other groups as follows untreated VPA-induced autism, risperidone
treated group, apigenin treated group, silymarin treated group, apigenin and risperidone treated group, silymarin and
risperidone treated group. All treatments were given from post-natal day (PND) 21st to 40th. behavioral tests were performed
at the end of treatment. Portions of hippocampus were dissected and processed for assessment of biochemical parameters,
histopathological examination and immunohistochemistry. Results and conclusion: The findings suggest that apigenin and
silymarin produce promising effects in VPA-induced autism as they decrease oxidative stress and apoptosis; in addition,
they produce modulation of autophagy with inhibition of mTOR, that all are reflected as amelioration of impaired behavior
& improvement of the histopathological picture. Moreover, the use of apigenin or silymarin in combination with risperidone
exhibits better and more satisfactory results than in either remedy alone.
Keywords: ASD, VPA, Risperidone, Apigenin, Silymarin, Autophagy, Tanta University.
INTRODUCTION
rapamycin (mTOR) is an essential protein for dendritic
Autism spectrum disorder (ASD) is a severe
plasticity and cell survival. It was discovered that mTOR
lifelong neurodevelopmental disorder that appears within
might be involved in disturbed cell signaling in ASD (6).
the initial three years of life. It is manifested by social
Risperidone is the first FDA-approved drug for
interactions deficiencies, recurring forms of behavior and
children with autism, and the most widely used. It is
limited interests (1). The precise etiology of ASD remains
effective for the improvement of behavior symptoms in
unknown; it has been regarded as a disorder with multiple
ASD children and adolescence. Risperidone is an atypical
etiologies that is affected by numerous factors like genetic
antipsychotic antagonist of both dopamine (D2) and
and environmental factors. As a consequence, there is a
serotonin (5HT2A) receptor. However, it has a lot of
difficulty in identifying complete curative medical
adverse effects that limit its long use (7).
therapy up till now (2).
Apigenin (4', 5, 7-trihydroxyflavone) is found in a
As regards environmental factors, it was found that
variety of food. It demonstrates a number of biological
administration of valproic acid (VPA) in pregnancy leads
actions as anti-carcinogenic, anti-inflammatory, and
to an increase in the prevalence of ASD between
antioxidant properties. In addition, great evidence
offspring. Additionally, over several animal model
supports its neuroprotective effect as it has a high level of
researches, it has been indicated that maternal therapy
distribution in the brain (8).
with VPA in rodents mimics ASD pathophysiology. As a
Moreover, apigenin has antidepressant effects in
consequence, the VPA-induced ASD-like animal model
chronic stress model by its ability to promote autophagy
provides an excellent model for testing pharmacological
in this model through mTOR signaling pathway inhibition
agents that could be used to treat ASD (3).
(9). Silymarin is a naturally occurring antioxidant that is
Autophagy is a cell-protecting action that permits
extremely safe. It is common to have anti-inflammatory,
cells to survive when nutrients are insufficient. Neuronal
anti-apoptotic effects. Furthermore, it was found that
autophagy is an essential determining factor of memory
silymarin can modulate autophagy and mTOR (10,11).
creation, synaptic plasticity, and structural remodeling, as
well as a key regulator of protein balance (4). Autophagy
METHODOLOGY
and associated pathways are supposed to be involved in
VPA (2-propylpentanoic acid, sodium salt, 98%)
the progress of ASD and studies showed that deficiency
white pure powder from Acros Organics, USA dissolved
of autophagy leads to autism (5). The mammalian target of
to 250 mg/ml in saline. Risperidone (Risperdal
1345
Received: 01/08/2022
Accepted: 11/10/2022
c:\work\Jor\vol901_203
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1356-1364
Significance of IL10 in COVID-19 Patients
Doaa Ezzat Mohamed Elbarbary1*, Mona Mohamed Watany1,
Mohamed Samir Abd Elghafar2, Manal Abd Elwahed Eid1
1 Clinical Pathology Department, Faculty of Medicine, Tanta University, Tanta, Egypt
2 Anesthesia, Surgical Intensive Care and Pain Medicine Departments,
Faculty of Medicine, Tanta University, Tanta, Egypt
*Corresponding author: Doaa Ezzat Mohamed Elbarbary, Email: dodoelbarbary2@gmail.com, Mobile: 01152712759
ABSTRACT
Background: COVID-19 is a highly infectious viral infection caused by SARS-CoV-2 that can affect persons of all
ages, from infants to the elderly, resulting in various clinical presentations and a global pandemic that resulted in a
significant loss of human life globally.
Objective: The current study aims to measure IL-10 in serum of COVID-19 patients with different degrees of severity
to identify its significance.
Patients and methods: A case control study was carried out in Clinical Pathology Department and conducted on 30
COVID-19 patients (some were selected from isolation hospital and some were clinically stable outpatients with PCR-
proven SARS-CoV-2 infection) and 20 normal subjects as reference. Serum IL10 was measured using Enzyme-linked
immune-sorbent assay (ELISA) technique.
Results: In comparison to control groups, COVID-19 patients with different degrees of severity had serum levels of IL-
10 that were significantly higher. Also, urea, creatinine, CRP, D-dimer, ferritin and IL6 are significantly higher whereas
Hb concentration, platelet count and lymphocyte percentage are much lower. In COVID-19 patients, IL-10 showed
positive correlations with CRP, ferritin, D-dimer, and IL-6, but negative correlations with platelet count and lymphocyte
percentage.
Conclusions: The current study offers proof that severe and non-severe COVID-19 cases can be distinguished based on
the outcomes of the laboratory tests conducted at the time of admission. Additionally, it implies that cytokines are crucial
to COVID-19 pathogenesis. Furthermore, it demonstrates that serum IL-10 can be used to predict severity of COVID-
19.
Keywords: Coronavirus disease 2019, Cytokine storm, Interleukin-10, Case control study, Tanta University.
INTRODUCTION
COVID-19 patients with severe symptoms may
According to reports from December 2019,
have cytokine storm also known as cytokine release
severe acute respiratory syndrome coronavirus 2
syndrome (CRS), which is a pathological state that
(SARS-CoV-2) resulted in worldwide outbreak of
characterized by hyperinflammation caused by
Coronavirus disease 2019 (COVID-19). After the first
uncontrolled actions and contributing to an abnormal
report for this disease, its effect spread rabidly, and
systemic inflammatory response. CRS has been
many countries were affected making WHO to declare
identified as a main factor in evolution of ARDS in
that new virus as a pandemic disease. Yang et al., 2020,
COVID-19, which frequently results in multiorgan
reported different cases for infected patients, some of
failure and death. However, CRS of COVID-19 is
them are asymptomatic, while others showed different
similar to that of SARS which caused by SARS-CoV,
disease severity varied from low to high severity.
the significant rise in IL-10 is a characteristic feature of
However, some cases showed fatal systemic
COVID-19 cytokine storm (4).
manifestations such as respiratory failure, and
The current study aims to measure IL-10 in serum
multiorgan failure (MOF) (1).
of COVID-19 patients with different degrees of severity
In case of pathogenic infections, two different
to identify its significance.
types of immune responses can recognize them which
include both innate and adaptive (specific) response of
PATIENTS AND METHODS
immune system. Any way the two types of response, are
The study was carried out in Clinical Pathology &
controlled by many activated cells produced by the
Anesthesia, Surgical Intensive Care Departments,
immune system, these cells is the key factor in the
Faculty of Medicine, Tanta University, Egypt. Patients
establishment of cytokines environment e.g. (TNF-,
with COVID-19 of moderate and severe symptoms
IFN-, Interlukin-2, 4, 6, and 10) (2).
from quarantine (isolation) hospital, Faculty of
In general, interleukin 10 has three effective
Medicine, Tanta University. Those with mild symptoms
activities in anti-viral immunity. First, it is a key anti-
were clinically stable outpatients with PCR-proven
viral infection cytokine. Second, it has immune-
SARS-CoV-2 infection.
modulation activity to suppress cytokines pro-
The study included 50 subjects classified into two
inflammatory; Third, IL-10 is an important anti-fibrotic
groups: Group I: 30 patients with COVID-19 (mild,
agent which can reduce tissue fibrosis (3).
moderate and severe), and Group II: 20 healthy
subjects as a control group.
1356
Received: 15/08/2022
Accepted: 15/11/2022
c:\work\Jor\vol901_204
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1365-1371
Angiographic Evaluation of Radial Artery Diameter
Pre- and Post- Coronary Angiography
Abdelrahman Omar Abdelrahman*, Mahmoud Ali Soliman,
Ahmed Mokhtar Elkersh, Mourad Beshay Mina
Department of Cardiology, Faculty of Medicine, Menoufia University, Egypt
*Corresponding author: Abdelrahman Omar Abdelrahman, Mobile: (+20) 01097020840,
E-Mail: abdelrahman.afia@med.menofia.edu.eg
ABSTRACT
Background: The femoral, radial, or ulnar arteries can be used for coronary angiography, which has emerged as the
gold standard for diagnosing and treating coronary artery disease.
Objectives: The aim of the current study is to compare radial artery diameter pre and post-radial coronary angiography
by duplex ultrasound to evaluate the effect of pre-medication at the diameter of the radial artery and analyze the
predictors that can cause radial artery spam (RAS) to avoid it.
Patients and Methods: A one-arm clinical trial was carried out on 92 patients eligible for trans-radial procedures. All
patients were subjected to medical history (demographic data, comorbidities, current medications especially cardiac
drugs, and history of ischemic heart disease and its course), clinical examination, echocardiographic data, ECG,
laboratory investigations, duplex on radial artery pre and post-trans-radial angiography.
Results: There was a significant statistical difference between radial artery diameter change and the number of radial
puncture attempts (P value 0.001). The relation between data of percutaneous coronary intervention (PCI) and radial
artery diameter change shows a significant statistical difference in the number of stents used at PCI (P value 0.039).
While the guiding catheter used, wires used, the number of balloons used, and the types of stents used showed non-
significant statistical differences (P values 0.195, 0.352, 0.995, and 0.434, respectively).
Conclusion: RAS is still an important problem in trans-radial access. During this study, we found the predictors which
decrease radial artery diameter change and induced radial artery spasm in patients who underwent trans-radial coronary
angiography.
Keywords: Angiographic evaluation, Radial artery diameter, Coronary angiography, Duplex ultrasound.
INTRODUCTION
palpation of an appropriate radial pulse volume in the
Although coronary artery disease (CAD) has long
right wrist is a sign of the simplicity of the Trans radial
been regarded as one of the leading causes of illness and
angiogram. The main factor affecting accessibility and
mortality in affluent nations, coronary angiography has
the prevention of spasms is radial artery size [7].
helped to reduce mortality rates [1].
The incidence of RAS is greatly decreased and
The femoral, radial, or ulnar arteries can be used
patient comfort is maximized during catheter
to conduct coronary angiography, which has emerged as
manipulation when introducer sheaths and catheters
the gold standard for the diagnosis and management of
with hydrophilic coating are used [8].
coronary artery disease [2].
The aim of the current study is to compare radial
Due to its safety, cost-effectiveness, short
artery diameter pre and post-radial coronary
hospital stay, patient comfort in early ambulation, and
angiography by duplex ultrasound to evaluate the effect
lower risk of complications, the radial artery has
of pre-medication at the diameter of the radial artery and
emerged as the preferred conduit for coronary
analyze the predictors that can cause RAS to avoid it.
angiography and procedures [3]. However, the radial
artery has a thick wall and is mostly made of layers of
PATIENTS AND METHODS
smooth muscle cells. Patients need appropriate
A one-arm clinical trial was carried out on 92 patients
anesthesia since the significant muscular component of
eligible for trans-radial procedures, who attended to the
the artery and the high density of alpha-1 receptors
Catheter Lab of Menoufia University Hospital
make this conduit particularly prone to spasms [4].
(Menoufia, Egypt) during the period from September
The biggest issue we still encounter during
2021 to August 2022.
transradial coronary angiography is this spasm, which
Patients with absent radial pulsation, abnormal Allen's
is uncomfortable for the patient and lowers the success
test, and Patient refusal were excluded from the study.
percentage of the operation [5]. Numerous variables,
All patients were subjected to medical history
including gender (female), the radial artery's
(demographic data, comorbidities, current medications
angiographic features (small radial artery diameter),
especially cardiac drugs, and history of ischemic heart
clinical diseases (DM), and procedure-related variables,
disease and its course), clinical examination,
were discovered to be connected to radial artery spasms
echocardiographic
data,
ECG,
laboratory
[6]. Therefore, patients undergoing percutaneous
investigations, duplex on radial artery pre and post-
coronary intervention (PCI) or coronary angiography
trans-radial angiography.
should be assessed for primary trans-radial access; the
1365
Received: 08/08/2022
Accepted: 11/10/2022
c:\work\Jor\vol901_205
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1372-1381
Short and Intermediate Term Clinical Outcomes of Patients with
Unprotected Left Main Coronary Artery Stenting
Adel Mohamad Osman*, Eid M. Daoud, Ahmed Mohamed El Sayed El Desoky, Abdallah Mohammed Elshal
Department of Cardiology, Faculty of Medicine, Mansoura University, Egypt
*Corresponding author: Adel Mohamad Osman, Mobile: (+20) 01006693976, E-Mail: Adel_osman@mans.edu.eg
ABSTRACT
Background: Unprotected left main coronary artery disease was defined as having a left main coronary artery stenosis
of greater than 50% and the absence of bypass grafts to the left anterior descending or left circumflex coronary arteries.
Objective: The purpose of this study was to assess major adverse cardiovascular events (MACE) and its relationship to
syntactic score in connection to short and intermediate term clinical outcomes of Percutaneous Coronary Intervention
(PCI) in unprotected left main coronary artery (LMCA) illness.
Patients and methods: A total of 50 patients with unprotected left main coronary artery (ULMCA) disease were
enrolled in a prospective study and received drug-eluting stent (DES) implantation at Cardiology Department, Mansoura
University Hospital, and National Heart Institute, Egypt from June 2018 to December 2019.
Result: ROC curve analysis showed that Syntax score was the best method as a marker for prediction of MACE; it had
sensitivity of 73.3%, specificity of 77.1% at AUC of 0.770 with cut off value >32.5. On univariate analysis, age, ST-
elevation myocardial infarction (STEMI), osteal, mild, distal, as well as all LM length disease were risk factors of
MACE (P <0.05). However, on multivariate analysis, osteal, all LM disease, STEMI, and high SYNTAX score were
significant predictors of MACE (P <0.05).
Conclusion: ULMCA stenosis can be successfully treated by stenting. Stenting of distal LM lesions with low or
intermediate SYNTAX scores by site evaluation, PCI with drug-eluting stents, and short- and intermediate-term follow-
up, results in a lower incidence of mortality, stroke, or myocardial infarction.
Keywords: Clinical outcomes, LMCA, PCI, Syntax score.
INTRODUCTION
reserved for patients who couldn't afford surgery (7).
Unprotected left main coronary artery disease was
The use of drug-eluting stents has significantly reduced
defined as a left main coronary artery stenosis of less
restenosis rates, transforming the therapeutic landscape
than 50% and a lack of bypass grafts placed on either
and rekindling interest in percutaneous left main
the left circumflex or left anterior descending arteries (1).
intervention in the modern era (8). Recent studies using
Left main stem illness was progressively recognized
both first- and second-generation drug-eluting stents
during the 1960s, the age of regular coronary
have started to put surgery's dominance in the
angiography, and individuals with this ailment were
management of left main stem disease under scrutiny (9).
quickly classified as a "high-risk" category (2).
The purpose of this study was to assess major
Early study found that performing coronary
adverse cardiovascular events
(MACE)
and
its
angiography on persons with left main stem disease was
relationship to syntactic score in connection to short and
dangerous, with a fatality rate of 10%-15% (3). The
intermediate term clinical outcomes of percutaneous
large-bore catheters in use at the time, which had a
coronary intervention (PCI) in unprotected left main
higher risk of injuring the left main stem and rupturing
coronary artery (LMCA) illness.
plaque, were primarily to blame for this. Coronary
bypass surgery was used to treat left main coronary
PATIENT AND METHODS
artery disease in the early 1970s. People quickly
A total of 50 patients with unprotected left main
realized that surgery offered a survival benefit over the
coronary artery (ULMCA) disease were enrolled in a
course of this fatal condition (4).
prospective study and received drug-eluting stent (DES)
Andreas Gruentzig employed the first balloon
implantation at Cardiology Department, Mansoura
angioplasty in 1977, which was a success, to treat left
University Hospital, and National Heart Institute,
main stem disease (5). Despite the initial enthusiasm for
Egypt, from June 2018 to December 2019.
a percutaneous treatment for this condition, early
According to syntax score all included Patients were
reports of balloon angioplasty for left main coronary
divided into 2 groups:
artery disease were connected with high procedural
- Group I included 31 patients with mean age 59.71
mortality and exceedingly poor long-term survival,
years old and their syntax <33 (low and intermediate
which led to the practice's discontinuance (6).
syntax).
The development of coronary stents in the early
- Group II included 19 patients with mean age 64.74
1990s revived interest in percutaneous coronary
years old and their syntax > 33 (high syntax) (10).
intervention for left main stem disease, but high
Inclusion criteria: Patients with significant ostio-
restenosis rates with bare-metal stents produced
proximal lesions of the LAD or LCX that have a
disappointing outcomes, and stenting was mostly
MEDINA Class of 1:1:1, 1:1:0, 1:0:1, OR 0:1:1 and
1372
Received: 08/08/2022
Accepted: 11/10/2022
c:\work\Jor\vol901_206
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1382-1386
Evaluation of Thyroid Functions in Patients with End Stage Renal
Disease in A Sample of Egyptian Populations
Ahmed Mohamed Bahaa Eldin, David Ezzat Shafik*, Inas Mohammed Sabry
, Manar Abdl El Rouf Raafat, Hanan Mahmoud Ali Mahmoud
Department of Internal Medicine & Endocrinology, Faculty of Medicine, Ain Shams University, Egypt
*Corresponding author: David Ezzat Shafik, Mobile: (+20) 01270102051, E-Mail: docdavidezzat.de@gmail.com
ABSTRACT
Background: In most cases, hypothyroidism is not linked to kidney disease. However, hypothyroidism has been shown
to hasten the development of chronic kidney disease (CKD). Objective: The aim of the current study is to evaluate
thyroid abnormalities in patients with end stage renal disease (ESRD) in a sample of Egyptian populations.
Patients and methods: A case control study was conducted on 70 Egyptian patients selected from the Nephrology
Department in Theodor Bilharz Research Institute. Participants were divided into 2 groups; Group 1 included 40 patients
with ESRD, with eGFR <15 mL/min, with no history of thyroid disease or receiving any thyroid medications. Group 2
included 30 health subjects, age and sex matched, with normal renal function, with no history of thyroid disease or
receiving any thyroid medications. All subjects underwent full thyroid profile, and estimated GFR.
Results: Symptoms of thyroid dysfunction were more frequent in ESRD group; statistically significant only in muscle
weakness. TSH was statistically significantly higher in Group 1 cases with hypothyroidism. Thyroglobulin
autoantibodies (TgAbs) were statistically significantly higher in cases with hypothyroidism. Antimicrosomal antibodies
recorded only in hypothyroid cases. Free T3, TSH, TgAbs and thyroid volume had perfect diagnostic performance in
diagnosing hypothyroidism among ESRD group. Conclusion: Frequency of hypothyroidism was higher in ESRD
patients compared to the control group. Thus, it is important to keep monitoring thyroid functions in patients with
advanced renal impairment that may enhance quality of life.
Keywords: Thyroid Function, End Stage Renal Disease, TSH, Thyroglobulin autoantibody.
INTRODUCTION
Chronic kidney disease (CKD) jumped from being
on the other hand, has long been known to hasten the
the 27th leading cause of death in 1990 to the 18th in
development of CKD (1).
2010, second only to HIV/AIDS, according to the
The aim of the current study is to evaluate thyroid
Global Burden of Disease research conducted in 2010.
abnormalities in patients with end stage renal disease
Pallor, coldness, and fatigue are all signs of both
(ESRD) in a sample of Egyptian populations.
hypothyroidism and chronic kidney disease (1).
Impairments in kidney function influence hormone
PATIENT AND METHODS
production, distribution, and excretion, which in turn
A case control study was conducted on 70 Egyptian
affects hypothalamic-pituitary-thyroid axis levels.
patients selected from the Nephrology Department in
Many occurrences of hypothyroidism in pre-dialysis
Theodor Bilharz Research Institute, during the period
CKD patients are asymptomatic, according to studies (2).
from July 2021 to January 2022. Age of participants
Up to 9.5% of ESRD patients, compared to 1.1% of the
ranged from 25 to 50 years old, and they were 43 males
overall population, may suffer from primary
and 37 females.
hypothyroidism.
Every patient parent gave their approved consent for
Rhee et al. (3) found that patients with CKD stages
participation in this study.
3-5 had an estimated GFR 10 mL/min lower than those
All patients approved to participate in this had been
in healthy controls, resulted in 0.11 mU/l higher TSH
classified into two groups as the following:
levels and an 18% higher incidence of hypothyroidism,
· Group 1: It included 40 patients with ESRD, with
Hollander et al. (4) suggested that thyroid dysfunction
eGFR <15 mL/min, with no history of thyroid disease
is more common at advanced CKD stages. In earlier
or receiving any thyroid medications.
research, the incidence of hypothyroidism among
· Group 2: It included 30 health subjects, age and sex
ESRD patients undergoing HD varied widely. About
matched, with normal renal function, with no history of
12% of hemodialysis patients were found to have
thyroid disease or receiving any thyroid medications.
subclinical hypothyroidism, compared to 7.14% of the
control group, in one study. Patients with CKD have an
Inclusion Criteria:
increased risk of developing both subclinical
- Age between 25 - 50 years old.
hypothyroidism (SCH) and overt hypothyroidism,
- Both genders (male and female).
although the incidence of primary hyperthyroidism
Exclusion Criteria:
remains low (5).
- Acute illness e.g. acute infection, myocardial
Most of the time, hyperthyroidism and chronic
infarction, etc.
kidney disease (CKD) are not linked. Hyperthyroidism,
- Recent surgery, trauma or burns.
1382
Received: 09/08/2022
Accepted: 12/10/2022
c:\work\Jor\vol901_207
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1387-1392
Modified Pilates versus Conventional Balance on Gait Training
Performance and Functional Status in Elderly
Bassant Mohamed Shaban Abdelhafez*, Zahra Mohamed Hassan Serry, Rana Hesham Mohamed Elbanna
Department of Physical Therapy for Cardiovascular, Respiratory Disorder and Geriatrics,
Faculty of Physical Therapy, Cairo University, Egypt
*Corresponding author: Bassant Mohamed Shaban, Mobile: (+20) 01272331208, E-Mail: passantmohammed9@gmail.com
ABSTRACT
Background: Aging correlates to declining balance and physical performance and a decrease in cognitive capabilities
combined with the deterioration of muscle strength, coordination, and balance, leading to a high risk of falling.
Physical exercise is an essential intervention to minimize the deleterious influences of aging.
Objective: The aim of the current study was to compare Pilates intervention (PI) and Conventional Balance Training
(CBT) efficacy on gait training performance and functional status in the elderly.
Subjects and methods: A total of 60 patients, of both genders aged from 60 to 70 years old, were selected from the
National Institute of Neuromotor Systems. After clinical assessment, participants were allocated into Group A (Study
group): 30 patients followed the intervention with a modified Pilate exercise program for 12 weeks. Group B (Control
group): 30 patients with the traditional CBT program for 12 weeks. Pre- and post-treatment data from both groups
regarding muscle quality index (MQI), Time Up and Go test (Ligotti Assessment), and Tinetti assessment were
statistically analyzed and compared.
Results: Our findings revealed a significant advancement in functional balance and quality of life (QOL) in the
elderly bound in old age homes due to PI and CBT programs, which are more significant for PI than CBT.
Conclusion: PI combined with other physical activities can enhance functional results and QOL in the elderly,
allowing them to age gracefully and have a high QOL. PI is revealed to be more beneficial than CBT intervention.
Keywords: Exercise movement technics, Traditional training, Geriatrics, Physical performance.
INTRODUCTION
recently gained popularity as a means of delaying the
Compared to younger adults, the elderlies are
effects of aging [3].
more likely to struggle with significant health
The aging process results in a variety of structural
problems due to the effects of aging, which include a
and functional alterations, making it crucial for the
degradation of the sensory systems and a modification
elderly to engage in activities that aim to strengthen
in the pattern of muscle activation that leads to
muscles and/or promote flexibility in large joints.
impaired balance. One of the most prevalent health
Pilates, like other forms of exercise, has recently
concerns among the aged population is the risk of
gained popularity as a means of delaying the effects of
falling and the injuries that might result from falling. It
aging [4]. PI has become an increasingly popular form
has been determined that the primary contributors to
of exercise to activate the core muscles in recent years.
poor balance and falls are declining sensory function
The practitioner can enhance their fitness, muscular
(including vision, vestibular, and proprioception),
tone, posture, and flexibility while maintaining their
motor function (including strength, coordination, and
balance by employing this method, which focuses on
endurance), and integration (including response time
toning the deep core stabilizer muscles using control
and multitask capability) [1].
and conscious movements. Exercises can be done on a
Falls lead to morbidity and mortality in the
mat using only body weight or with specialized
elderly, which can result in both broken bones and
exercise equipment [1,4].
other forms of disability and also death. Physical
Throughout physical inactivity due to mechanical
health, mental health, and socioeconomic status could
unloading, muscle mass loss seems to precede bone
all suffer as a result. As a population of older persons
loss. Age is related to a loss in muscle mass and
lives in the community, the number of falls that occur
strength in the elderly as well as across the adult
each year will rise [2].
lifetime, often beginning in the third or fourth decade
Reduced physical activity is related to increased
of life. Despite that, the annual rate of muscle loss
body fat and a corresponding decrease in lean body
varied between 0.4% and 2.6% in cross-sectional
mass. Therefore, inactivity leads to a significant
research, and its drop throughout aging is estimated to
decrease in maximal force generation. Atrophy of the
be between 1 and 3% yearly, whereas the decrease in
skeletal muscles is a hallmark of aging and physical
muscle power is estimated to be even more significant
inactivity. The aging process results in various
[5].
structural and functional alterations, making it crucial
In the Health ABC study, maintaining muscle
for the elderly to engage in activities that aim to
mass did not hinder muscle strength loss, highlighting
strengthen muscles and/or promote flexibility in large
the relevance of muscle quality by contributing to
joints. Pilates, like other forms of exercise, has
muscle strength in the elderly. Although a universally
7831
Received: 09/08/2022
Accepted: 12/10/2022
c:\work\Jor\vol901_208
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1393-1399
The Most Common Allergens in Pediatric Patients in Iraq
Ahmed Abd Al-hadi1, Haidar Jiham Alshiblawy2, Taghreed Al-Jazaeri3, Israa K. Al-Yasiri4*
1,2,4College of Medicine, Jabir Ibn Hayyan Medical University, Iraq
3Al-Sadder Medical City Hospital, Iraq
*Corresponding author: Israa K. Al-Yasiri, Mobile: 009647816246114, E-mail: israa_alyasiri@jmu.edu.iq
ABSTRACT
Background: The allergic diseases are considered as an abnormal immune system response to harmless environmental
stimuli usually proteins. Objective: This study aimed to examine the allergen profile in Iraqi children age range 1 to 10
years old. Methods: A cross-sectional observational study was conducted during the period from January 2017 to February
2019. Allergic children age ranged from 1 to 10 years old. They were collected from many clinics in Al-Najaf City, Iraq.
The pediatric penal kit Polycheck® Diagnostics was used to reveal to the sensitivity of 20 different allergens.
Results: The number and percentage of allergic children to each allergen were recorded. The inhalant allergens had higher
percentage as follow: Mugwort pollen 52%, D. farinae 45%, both Birch and Timothy grass pollens 40%. While the higher
percentages of ingested allergens were in Peanut and Apple allergens 31.67%, Carrot 26.67%, Potato's allergens 21.67%,
Soya bean 20% and Wheat flour allergens 18.33%. While the egg white showed no allergic sensitivity in all samples of
children but the allergic to egg yolk allergens were 8.33%.
Conclusion: Approximately 93% of the children were allergic to at least one inhalant. Studying the rates of allergens in
Iraqi environment and its related allergens is an important point in the planning for prevention and control of allergy.
Keywords: Pediatric, Food allergens, Inhalant allergens, Iraq.
INTRODUCTION
of exposure to allergens considered as cornerstone in the
The allergic diseases are considered as an abnormal
control and prevention of allergic diseases.
immune system response to harmless environmental
stimuli usually proteins (1). Allergic diseases may be
PATIENTS AND METHOD
linked to many genes that increase susceptibility to
Subjects in the study:
allergy (2). Allergens are almost always proteins, for a
A cross-sectional observational study was performed
protein antigen to display allergenic activity; it must
during period from January 2017 to February 2019.
induce IgE production, which must lead to a type 1
Allergic children age range 1 to 10 years old from many
hypersensitivity response on subsequent exposure to the
clinics in Al-Najaf City, Iraq. The pediatric penal kit
same protein (3). The factors that may cause an antigen to
Polycheck®Diagnostics (Germany) was used to reveal
become an allergen include: biochemical properties of the
to the sensitivity of 20 different allergens (9): Peanut, milk,
allergen, stimulating factors of the innate immune
egg white, egg yolk, potatoes, carrot, cod fish, apple, soya
response around the allergen substances at the time of
beans, wheat flour, birch pollen, timothy grass pollen,
exposure, stability of the allergen in the tissues, digestive
mugwort pollen, D. pteronyssinus, D. Farinae, dog
system, skin, or mucosa, and the dose and time of stay in
epithelia, cat epithelia, horse epithelia and Cladosporium
lymphatic organs during the interaction with the immune
harbarum. Table (1) showed test measurement the
system (4). The main allergens that account for the most
concentration in (Ku/L) for IgE antibodies against any of
allergic diseases include:
the above allergens and the concentrations then converted
Ingestible allergens, e.g. peanuts, cow's milk, egg
into scores according.
yolk, legumes, seeds, sea food and fruits. Food allergens
mostly trigger acute allergic reactions or asthma
Table (1): Scoring of IgE concentration as a response to
Inhalant allergens, e.g. house dust mites, grass
allergen exposure
pollens, pet danders and molds mostly trigger asthma,
Concentration Scores
Explanation
rhinitis and conjunctivitis.
(kU/l)
Insect stings/bites, drugs and natural rubber latex.
<0.35 KU/l
0
No
specific
antibodies
The first two are the most prevalent (5, 6)
detection
In an individual, the presence of atopy may be confirmed
0.35-<0.7 KU/l
1
Very weak antibody detection
by high levels of specific IgE or total IgE in the serum or
0.7-<3.5 KU/l
2
Weak antibody detection
by positive responses to skin-prick test. In an individual,
3.5-<17.5 KU/l
3
Clear antibody detection
the presence of atopy may be confirmed by high levels of
17.5-<50 KU/l
4
Strong antibody detection
specific IgE or total IgE in the serum or by positive
50-<100 KU/l
5
Very strong antibody detection
responses to skin-prick test (7, 8).
>100 KU/l
6
Extreme high antibody titer
The aim of this study was to describe the most
kU: Kilo unit
common types of allergens in Iraq, because the avoidance
1393
Received: 08/08/2022
Accepted: 11/10/2022
c:\work\Jor\vol901_209
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1400-1406
Galactose-1-Phosphate and Galactitol in Red Blood Cells of Galactosemia Patients
Shimaa M. Hamad*1, Hala H. El-Said1, Mohammed A. Khedr2,
Ashraf Y. Elfert1, Gihan A. Sobhy2, Samar I. Ghanem1
Departments of 1Clinical Biochemistry and Molecular Diagnostics,
2Pediatric hepatology, National Liver Institute, Menoufia University, Egypt
*Corresponding author: Shimaa Mohammed Hamad, Email: shimaahamad2014@yahoo.com, Mobile: (+20)1019245060
ABSTRACT
Background: Galactose metabolites, like galactitol and galactose-1-phosphate (G-1-P), can accumulate in galactosemia
patients on treatment, however it is yet unknown how these metabolites relate to the clinical outcome.
Objectives: The aim of the current work was to measure red blood cells (RBCs) G-1-P and galactitol in healthy and
galactosemic infants and children receiving treatment and to demonstrate their effects on clinical outcomes.
Patients and methods: The current study included 20 galactosemia patients, 30 patients suspected for galactosemia and 40
healthy controls of matched age and gender. Complete history taking, physical and ophthalmological examination, and
abdominal ultrasound were performed. Liver function tests and hemoglobin concentration were tested. RBCs G-1-P and
galactitol were quantified using a novel Ultraperformance Liquid Chromatography- Tandem Mass Spectrometry method.
Results: Treated galactosemia patients showed significant increase in RBCs G-1-P and galactitol in comparison with
healthy controls (p < 0.001). Significant age-related decrease of these metabolites was found. RBCs galactitol was
significantly correlated with albumin and ALT. Significant increase of both metabolites was found in patients with
hepatomegaly. No significant correlations between these metabolites and Z score of weight and height were found. In
suspected patients' group, RBCs galactitol showed significant increase in comparison with age comparable controls. Two
cases from the suspected cases (7%) diagnosed classic galactosemia showed highly elevated levels of RBCs G-1-P and
galactitol despite starting a galactose-free diet a few days ago.
Conclusion: This study's findings imply that galactose metabolic status can be evaluated in galactosemic patients using
RBCs galactitol and G-1-P and these can be used to assess liver functions.
Keywords: Galactosemia; RBCs G-1-P; RBCs galactitol; UPLC/MS/MS.
INTRODUCTION
galactitol concentrations is important for monitoring
Galactosemia is an inherited disorder of
galactosemic patients receiving a lactose-free diet (8, 9, 10).
carbohydrate metabolism. In Egypt, an incidence ranging
The original enzymatic approaches for measurement
from 1:1794 to 1:3000 was reported in previous studies (1,
of galactose metabolites were difficult and time
2, 3). Countries created neonatal blood screening programs
consuming. Chromatography based techniques were
for galactosemia ensure that treatment is started as soon
developed.
as possible. A galactose-restricted diet is lifesaving early
The aim of the current work was to measure RBC G-
in life, but it doesn't prevent complications, like cognitive
1-P and galactitol in healthy and galactosemic infants and
impairment, speech problems, motor disturbances and
children receiving treatment and to demonstrate their
learning disabilities (3).
effects on clinical outcomes.
Patients with any type of galactosemia on treatment
aren't truly free from galactose intoxication, due to
MATERIALS AND METHODS
galactose hidden in nondairy foodstuffs, and endogenous
The current study included 20 galactosemia patients,
synthesis from UDP-glucose and glycoconjugates
and 30 patients suspected for galactosemia, attending at
turnover naturally occurring. Chronic complications of
Department of Pediatric hepatology, National Liver
variable degrees are seen in classic galactosemia and the
Institute, Menoufia University. This study was conducted
generalized
form
of
epimerase
deficiency.
between January 2021 and June 2022.
Pathophysiology of these complications is complex and
Three groups were enrolled in the study: group 1;
not yet fully understood (4, 5, 6).
patients with galactosemia on treatment (n=20), group 2;
G-1-P was assumed to exert inhibitory activity on
patients suspected for galactosemia (n=30) and group 3;
several enzymes involved in glucose metabolism and
healthy controls of matched age and gender (n=40). Cases
glycosylation. Galactitol produced via alternative
were recruited from outpatient clinics and inpatient wards
pathway for catabolism of excess galactose isn't
in Pediatric Department, National Liver Institute (NLI),
metabolized and builds up in lens fibers and other tissues
Menoufia university, Egypt.
causing intracellular osmotic and oxidative damage (4, 7).
Exclusion criteria included patients receiving recent
In clinical practice, measuring RBCs G-1-P and/or urine
blood transfusion within the last 2-3 months.
1400
Received: 31/12/2022
Accepted: 11/01/2023
c:\work\Jor\vol901_210
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1407-1412
Is Topical Metformin Effective in Treatment of Melasma?
Doaa Abd Elhameed Atta Shokier1*, Hanan Fathy Mohamed1,
Farid Abd El Rheem Badria2, Ahmed Fathy State1
1Department of Dermatology, Andrology and STDs and
2Pharmacognosy, Faculty of Medicine, Mansoura University, Egypt
*Corresponding author: Doaa Abd Elhameed Atta Shokier, Mobile: (+20) 01096072491, E-Mail: doc.doaa.sh@gmail.com
ABSTRACT
Background: Melasma is an acquired hyperpigmentation characterized by bilateral irregular brown macules and
patches over sun-exposed areas of face and less commonly, forearms. No single treatment is universally effective. It has
been shown that metformin could decrease intracellular cyclic adenosine mono phosphate. Since c-AMP has a role in
melanogenesis, metformin can inhibit melanogenesis resulting in a significant reduction in melanin in the basal layer.
Objective: The aim of the present study was to evaluate the effectiveness and safety of topical metformin for melasma
treatment. Patients and methods: A quasi-experimental (pre-post comparison study) study included 30 female cases of
melasma from the Dermatology outpatient clinic of Mansoura University Hospital, during the period between March
2021 and March 2022. Included females had more than 18 years old. The metformin lotion was prepared using
metformin powder and a mixture of polyethylene glycol (PEG) -6; Ethylene Glycol; PEG-32, acetyl alcohol, liquid
Paraffin, Methylparaben, propylparaben, and distilled water. Participants applied one layer of metformin 30% lotion on
the affected area on face at night to the morning for a period of 3 months.
Results: Melasma Area and Severity Index (MASI) score decreased gradually after successive sessions (mean 13.8,
13.7, 11.5, 11.4, 11.4, respectively), with statistically significant improvement after 2, 3 months and also 1 month after
the end of treatment (P values 0.002, 0.001, and 0.001, respectively). Grades of improvement significantly increased
after 1, 2 months, but became stable by the 3rd month and one month after therapy. After the end of therapy, 20% of
participants were satisfied, 36.7% were slightly satisfied, 26.7% were poorly satisfied, and 16.7% were not satisfied. No
side effects were reported. Conclusion: Melasma was improved after using of topical metformin with no side effects
appeared. Thus, topical metformin is a new, safe, and effective for melisma treatment.
Keywords: Melasma, Metformin, Topical treatment, Quasi-experimental study.
INTRODUCTION
melanogenic proteins including tyrosinase, tyrosinase
Melasma is an acquired pigmentary disease
related protein-1(TRP1), TRP2, and protein kinase C-
characterized by symmetrical hyperpigmented macules
beta (9-11).
and patches over face, sometimes neck and rarely
The aim of the study was to evaluate the
forearms, often involving females of reproductive age
effectiveness and safety of topical metformin for
(1). Its prevalence varies from 1.5% to 33.3% (2,3).
melasma treatment.
Hyperpigmentation is generally because of
melanocytosis and enhanced melanogenesis due to
PATIENTS AND METHODS
upregulated melanin biosynthesis-related genes
Study Design
including microphthalmia-associated transcription
A quasi-experimental (pre-post comparison study)
factor (MITF), and tyrosinerelated protein1(TYRP1)
study included 30 female cases of melasma from the
because of many factors like genetic predisposition, UV
Dermatology outpatient clinic of Mansoura University
exposure, thyroid diseases and gestation and
Hospital, during the period between March 2021 and
medications like contraceptive pills and phenytoin (4).
March 2022. We included females aged more than 18
Melasma treatment is a frustrating experience for
years old, who did not receive any drugs for melasma
physicians and patients due to its recurrent and
over the previous 14 days for topical therapy or 3
recalcitrant nature. Several treatment modalities were
months for cosmetic techniques including lasers,
tried for melasma including hydroquinone (5,6), Triple
dermabrasion, or peel. Pregnancy, lactation, females on
Therpy Combination (TCC) include hydroquinone ,
contraceptives, phenytoin, kidney disease, and females
steroid and tretinoin (7,8), kojic acid, azelaic acid,
with any other skin diseases were excluded.
arbutin, vitamin c, chemical peeling, lasers, tranexamic
acid, rucinol, oligopeptides, silymarin, orchid extracts,
METHODS
and botanical extracts with variable success rates (8).
All participants were subjected to thorough history
However, TCC is still standard treatment,
taking including personal history (age, occupation,
although associated with severe side effects after long-
marital status, address, pregnancy and lactation, any
term use. Therefore, the search for an effective therapy
special habit), present history of the illness (onset,
that achieves depigmentation with no side effects has
duration and course), history of precipitating factors,
continued. Studies demonstrated that topical metformin
medical history of any systemic diseases, any history of
has melanopenic effect because of down regulation of
drugs (as; oral contraception, hormonal therapy,
MITF expression leading to downregulation of several
1407
Received: 09/08/2022
Accepted: 12/10/2022
c:\work\Jor\vol901_211
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1413-1420
Determination of miRNA -34a Expression in Rheumatoid Arthritis
Hawraa Muzher Hussien, Reema Mohammed Abed
Department of Biotechnology, College of Science, University of Baghdad, Baghdad, Iraq
*Corresponding author: Hawraa M. Hussien, E mail: hawraa.mozher1206a@sc.uobaghdad.edu.iq
Mobile phone: +9647730501773, ORCID iD: 0000-0001-6875-8596
ABSTRACT
Background: MicroRNAs are gene expression regulators, associated with several human pathologies. Rheumatoid
arthritis (RA) is an autoimmune systemic disease characterised by symmetrical inflammatory polyarthritis.
Rheumatoid arthritis mainly impacts smaller joints, although it can also affect large joints.
Objectives: To evaluate the expression profile of miRNA-34a and the serum levels of erythrocytes sedimentation
rate (ESR), rheumatoid factor (RF), C-reactive protein (CRP), anticyclic cetrolinated peptide (Anti-CCP) in both
patients and control group and to find their association with disease progression in RA patients and evaluate their
significance as novel markers for RA.
Subjects and methods: This study included 100 female patients and 100 female healthy controls with mean ages of
controls and patients (37.44±23.10 and 49.74±9.775 respectively). ESR, serum CRP, RF and Anti-CCP were
investigated. We examined the expression of micro ribonucleic acid 34a (miRNA-34a) in patients with RA and
controls by using quantitative time polymerase chain reaction (qRT-PCR). In addition, receiver operating
characteristic (ROC) was constructed for RA patients to establish the diagnostic accuracy of miRNA-34a in
differentiating RA patients from control people.
Results: ESR, serum CRP, RF and Anti-CCP were 37.44±23.10 mm/h, 22.72±1.44 IU/ml, 16.56±0.842 IU/ml and
28.09±6.68 EU/ml, respectively. The findings revealed a significant decrease in micro ribonucleic acid-34a (miRNA-
34a) expression with fold change (0.312). Regarding the ROC curve, specificity and sensitivity of miRNA-34a were
62% and 61.62%, respectively. The area under curve (AUC) was 0.630 and cut-off point was 9.79.
Conclusion: Expression profile of miRNA-34a can be used as novel markers for RA.
Keywords: Non-coding sRNA, Autoimmune disease, Gene expression, Rheumatoid arthritis.
INTRODUCTION
Rheumatoid arthritis is an autoimmune systemic
appropriate as new molecular diagnostic markers for
illness distinguished by persistent symmetrical
rheumatoid arthritis (13). Non-coding small RNA
polyarthritis of the large and small joints. Between
molecules known as (miRNAs) are assumed to play a
0.5 and 1 percent of people worldwide are affected by
role in regulation of genes post-transcriptionally.
it, and women are 2.5 times more likely to have it than
MiRNAs
attach
to
complementary-sequence
males, primarily between the ages of 30 and 50. Joint
messenger RNAs (mRNAs) and prevent them from
discomfort, stiffness, and swelling related to synovial
translating, preventing the synthesis of certain
inflammation, as well as effusion, are all symptoms of
proteins (14,15).
this condition (1,2,3).
In individuals with autoimmune disorders,
Extra articular symptoms such as fever,
miRNA expression appears to be altered in a variety
tiredness, anemia, interstitial lung involvement,
of cells and bodily compartments, in addition to
vasculitis, nodules, and osteoporosis may develop, as
controlling normal cellular function (11,16). Enhanced
well as acute-phase reactants increased, such as ESR
inflammatory pathway signalling, elevated synthesis
and CRP (4). Previous research has suggested that
of pro-inflammatory cytokines, and other processes
genetic factors, environmental variables, and the
that contribute to the autoimmune death spiral have all
immune system all contribute (59). An accurate
been related to altered miRNA expression (17). In
diagnosis at an early stage is essential for successful
addition, miRNAs are a component of the complex
treatment, especially in patients' characteristics that
human gene transcription and translation regulatory
have a poor prognosis (such as high disease activity or
mechanism, which can function individually or in
the presence of cancer, early joint degradation, and
groups, have multiple targets, and can target one gene
autoantibody presence) (10).
with several miRNAs. miRNAs in clusters are more
The most difficult problem remains is identifying
effective at regulating complicated processes (18).
biomarkers to enable early diagnosis, specifically for
miRNA-34a has been identified as a cell death
individuals who cannot acquire a definitive diagnosis
regulator with conflicting activities as an apoptosis
at first and are diagnosed with undifferentiated
inducer or defender. A number of studies have
arthritis as their primary diagnosis (11). MicroRNAs
indicated the abnormal regulation of miRNAs in RA-
(miRNAs) are irregularly expressed in both of the
affected joints with inflammatory conditions (19).
inflamed synovium and the circulatory system of RA
The purpose of this study was to shed more light
patients, according to mounting evidence (12). The role
on the topic by broadening our knowledge of the
of miRNAs in rheumatoid arthritis may make them
1413
Received: 09/11/2022
Accepted: 29/12/2022
c:\work\Jor\vol901_212
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1421-1429
Study of the Synergistic Effect of Three Volatile Oils on
Antibiotic-Resistant Bacteria Isolated from Burns
Sadiq R. Muhammad*, Ibrahim J. Abed
Department of Biology, College of Science, University of Baghdad, Iraq
*Corresponding author: Sadiq R. Muhammad, Mobile: (+964) 07706365502, Email: sadiqtajaldin@gmail.com
ABSTRACT
Background: Recent years increasing antibiotic resistance, the possibility of novel plant derived antibiotics is very
important as alternative compounds for antibiotics. Plant extracts involves antibacterial properties.
Objective: The aim of the current study was to evaluate the efficacy of 3 essential oils extracted from 3 plants against
pathogenic bacterial isolated from wounds and burns. Materials and methods: The essential oils of A. citrodora, R.
officinalis and T. vulgaris were extracted and prepared in serial dilution concentrations. A total of 150 bacterial isolates
from wounds and burns were isolated and identified. Results: The results showed that Pseudomonas was the most
frequent as 51 (34%) isolates, while Enterococcus and Rhizopium were the least as 1 (0.67%) isolate. A susceptibility
test was conducted by using 15 different antibiotic discs. Trimethoprim was the most resistant antibiotic for bacterial
isolates (79.33%), while Imipenem was the least (40%). Moreover, the susceptibility test was revealed the most resistant
was Rhizopium with 86.67% and Enterococcus was least with 20%. The highest antibiotic resistant isolates 22 were
selected for determining the synergistic effect of volatile oils that inhibited of bacterial growth, the concentration of
significant synergistic effect was 156.25, 156.25 and 39.0625 ppm of A. citrodora, R. officinalis and T. vulgaris
respectively. Conclusions: Little attention has been paid to evaluate the efficacy of Eos as alternative treatment instead
of conventional remedy, thus this study tested the activity of 2 EOs against pathogenic bacteria.
Keywords: Susceptibility test, essential oils, antimicrobial-resistant, Experimental study, University of Baghdad.
INTRODUCTION
microorganism's growth. Which led to finding of
Main health problem throughout the world is burn
natural antibacterial from these reported of antibiosis
and wound injuries. The burn wound appears as a
between microorganisms (4).
favourable region for opportunistic colonization of
Some
researchers
difference
between
microorganisms with endogenous and exogenous
antimicrobial and antibiotic, antimicrobial is utilized in
source. Burn wound patients are incubator for different
antiseptics materials, whereas antimicrobial is utilized
of aerobic bacteria and average of isolation of these
as medicine materials. The World Health Organization
organisms increase with rise in total body surface area
was assorted antibacterial resistance as a " dangerous
(1). Wounds are open injuries on surface of body; which
impendence is no extender a prognosis for the future, it
stay in nexus with environment. Numbers and size of
is occurring right now in any area of the world and has
burn injuries plays very significant role in colonization
the possibility to influence anyone, of each age, in each
and so in infection by different of microorganisms those
country" (5). Antibiotics can be classified to different
grow and reduplicate in aerobic condition. Spacious
types, depending on the pharmacological characteristics
burn injury deemed as infected wound and immunity of
were classified to: effect on microbe, mechanism of
burn patients deemed as suppressed immunity, as well
action and mode of spectrum. Generally, antibiotics act
as isolated bacteria must have deemed as agents of
on: cell wall, ribosomal chain and inhibited the
infective. Infection is the major cause of death after
synthesis of bacterial RNA or DNA and thus inhibitor
sever burn injuries, approximately 4265% of deaths in
the normal cellular processes and protein synthesis (6).
burn sufferers are attributable to infection, although
Antibiotics caused side-effects, before approve
advancements in burn care at hospitals over the last 50
for clinical use, it tested for any negative effects and are
years (2). As a result, burn patients with infections have
considered safe and well for used. Adverse side effects
more than twice the mortality average of uninfected
have been a wide ranging extent from moderate to
patients. The kinds of bacterial species that are isolated
extremely severe, that depending on antibiotic type
from patients is related with longitude of hospitalization
utilized, microorganism targeted, and the patient (7).
after a burn injury. Last decades, burn wounds have
In the antibiotic treatment the common
been among the most destructive type of injuries. Grave
phenomenon is bacterial resistance emergence to
thermal injuries reason high mortality and morbidity.
antibiotics. The resistance emergence reflects
Each year 300,000 die due to burns out of 11 million
development procedure that occur during antibiotic
people require medical treatment in the world (3).
remedy. Due to infections sourced by bacterial resistant,
Result of wound infection by bacteria more than
in the European Union, estimated about 25 thousand
75% of deaths reasoned by burns. The happening of
patients die each year, while, in the United States, about
burn injure infection it associated with both the depth
77 thousand patients die each year (8). Decreasing
and the size of the wound and the chances of higher on
numeral of novel antibiotics actually being led to
infection are correlated with the longer the wound
expansion of bacterial disease therapy strategies which
remains open. Since the late 1800s have been reported
are alternatives to traditional antibacterial due to excess
some microorganism's growth were inhibited by other
in bacterial strains which are resistant to common
1421
Received: 13/08/2022
Accepted: 16/10/2022
c:\work\Jor\vol901_213
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1430-1433
A Comparative Study of Some Parameters Levels in Infertile Women
Hanan Khalid ALdhalimi1*, Nawfal Hussien Aldujaili2
1Medical Laboratory Technology Department, College of Medical Technology,
The Islamic University, Najaf, IRAQ
2Departement of Biology, Faculty of Science, University of Kufa, Iraq
*Corresponding author: Hanan Khalid ALdhalimi, Mobile: 009647810111300, E-mail: kaisalhadrawii@gmail.com
ABSTRACT
Background: There are millions of women and men around the world who currently have difficulty producing babies.
Objective: This study aimed to assess and evaluate the effectiveness of antioxidant enzymes and the level of some sex
hormones, and their impact on infertility in women.
Patients and methods: One hundred twenty women with age range from 20 to 50 years old (90 infertility and 30
controls fertile) admitted at AL-Sadder Medical City, Al-Najaf Province during the period from January 2022 to June
2022. Sex hormones levels have been measured by using the Minivides technology and catalase enzyme using a
spectrophotometer.
Results: Catalase in the 90 infertile women (11.87 ± 0.41 pg/ml) was decreased significantly than in the 30 control
group (27.48 ± 1.362 pg/ml), while LH and prolactin were significantly increased in the infertile women compared to
control group. The findings showed a positive correlation with significant differences between catalase and sex
hormone, luteinizing hormone (LH), follicle-stimulating hormone (FSH), and prolactin, respectively.
Conclusion: Serum LH, and prolactin levels were significantly increased in infertile women, while catalase was
significantly decreased in infertile women as compared to control group.
Key words: Infertility in women, Oxidative stress, Catalase enzyme, Sex hormone.
INTRODUCTION
The failure to get pregnant after a year of frequent,
folliculogenesis, ovulation, and luteolysis, play a
unprotected sexual activity is known as infertility (1).
significant role in female reproduction. The
Fertility is the ability to conceive and produce
physiological levels of oxygen radicals created at
babies. Millions of individuals throughout the world
ovulation in response to luteinizing hormone (LH) may
currently experience infertility, and worries about it are
serve as a signal for oocyte differentiation (8).
growing, especially in less developed countries, where
The function of natural antioxidants, also known as
the majority of infertility diagnoses are made (2).
enzyme-based antioxidants, is to combat excessive
According to estimates, it occurs in 1 in 6 marriages,
reactive oxygen species and prevent it from damaging
with men and women accounting for about equal
cellular structures. The enzymes that make up
numbers of instances. Nearly 15% of women globally
enzymatic antioxidants include superoxide dismutase,
have main or secondary infertility (3). 37% of all infertile
catalase, glutathione peroxidase, and glutathione
couples have female infertility (4).
reeducates. They also convert hydrogen peroxide to
The two types of infertility are primary and
water and alcohol (9).
secondary. Its reported rates for primary infertility and
This study aimed to assess and evaluate the
single infertility vary from 0.6% to 3.4% and 8.7% to
effectiveness of antioxidant enzymes and the level of
32.6%, respectively (5).
some sex hormones, and their impact on infertility in
The underlying factors are linked to contemporary
women.
living patterns or conditions characterized by elevated
maternal aging, diabetes, obesity, stress, alcohol use,
PATIENTS AND METHOD
cigarette smoking, and exposure to contaminants, such
Total women and hormones levels measurement:
as endocrine disruptors (6). If the cellular antioxidant
One hundred twenty women with age ranged from
capacity is insufficient or ineffective to stop the
20 to 50 years old (90 infertility and 30 controls fertile)
increased production of reactive oxygen species that
characterizes all of these circumstances, oxidative stress
were admitted at AL-Sadder Medical City, Al-Najaf
(OS) may result.
Province during the period from January 2022 to June
OS is hypothesized to contribute to infertility by
2022 (10).
interfering with vital elements of reproduction such
Five ml of serum was placed in a gel tube, which
spermatogenesis,
folliculogenesis,
fertilization,
was stored at -20 oC, and were used to measure the
implantation, and placentation (7). Oxidative stress
levels of the catalase enzyme and sex hormones in the
occurs when the pro-oxidation and anti-oxidation
blood. Sex hormones levels have been measured by
mechanisms are out of equilibrium. Reactive oxygen
species, which are essential for processes including
using the Minivides technology (Marcy-rEoile-France)
ovarian steroidogenesis, oocyte maturation,
and catalase enzyme using a spectrophotometer (11).
1430
Received: 7/8/2022
Accepted: 10/10/2022
c:\work\Jor\vol901_214
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1434-1443
Combined Use of Lung and Heart Ultrasound: Possible Predictors of
Weaning Failure of Ventilated Patients
Mahmoud M. ALseoudya, Ibrahim M. Elnemra* ,Amal R Reyada,
Hany Mahmoud Abdel Shakoura , Hesham Abd El-Mohaimena
Anesthesia and Surgical ICU Department, Faculty of Medicine, Mansoura University, Mansoura, Egypt
*Corresponding author: Ibrahim M. Elnemr, MSc; Montaser St. EL-Mansoura, Egypt;
Tel: (+2) 01004239394; email: ibrahimelnemr2020@mans.edu.eg
ABSTRACT
Background: Lung ultrasonography (LUS) and transthoracic echocardiography (TTE) are reliable tools to predict weaning
failure.
Objectives: This study aimed to identify the predictive value of the combined use of pulmonary ultrasonography and TTE
in weaning failure.
Patients and Methods: Our work was a prospective cohort observational study. LUS and TTE were performed before
(basal) and 30 min after the trial of spontaneous breathing (SBT) (120 min) for fifty patients of both sexes, aged more than
18 years old and had postoperative mechanical ventilation. SBT was done using pressure support (PS) mode (PEEP 5
cmH2O, PS 7 cmH2O, and FIO2 0.5).
Results: LUS score was significantly increased after SBT in group WF (weaning failure) [21±2.7 vs group WS (weaning
success) 15.2±2.9, p-value < 0.001]. E/A and E/Ea ratio had a significant increase after SBT in group WF [1.4±0.3 vs group
WS 1.2 ± 0.2., p = 0.002], group WF [15.7±5.4 vs group WS 8.4±2.5, p<0.001] respectively. The LUS score and E/Ea ratio
after SBT had a high value of the area under the curve in the analysis of the ROC curve (0.917 & 0.904) respectively. The
combined use of the LUS score and E/Ea ratio had a high predictive value in weaning failure with 94.1% specificity, and
96.2% positive predictive value. No difference regarding EF, CVP, and fluid balance.
Conclusion: In postoperative mechanically ventilated patients, the combination of LUS and TTE was highly predictive of
weaning failure.
Keywords: Lung ultrasound score, Echocardiography, Weaning.
INTRODUCTION
increase in the early maximum mitral flow velocity (E
The weaning phase is crucial in mechanical
wave) / the late maximum mitral flow velocity (A wave)
ventilation and contributes as much as 50% of the gross
ratio and estimation of the early velocity of mitral annular
duration. The trial of spontaneous breathing (SBT)
displacement (Ea wave) using tissue Doppler imaging
significantly impacts lung aeration and hemodynamics (1).
(TDI) (7).
Weaning failure concludes two concepts of failure; the
Some previous studies used LUS score and TTE as
failure to pass SBT as well as reintubation within the early
isolated predictors of weaning failure (3, 5). We
48 h of extubation (extubation failure) (2). Since increased
hypothesized that the combined use of LUS and TTE is of
morbidity, mortality, and high cost of care are associated
high predictive value in the weaning failure.
with weaning failure and prolonged ventilation,
prediction of this failure and understanding the
PATIENTS AND METHODS
underlying cause may be important in prognosis (3, 4).
Between May 2020 and April 2022, this prospective
Cardiogenic pulmonary edema is considered one of
cohort observational study was performed.
the most convincing explanations for weaning failure,
A total of 50 patients of both sexes over the age of 18 were
which could be attributed to the increase of the left
considered eligible. They were candidates for the 1st SBT
ventricle (LV) filling pressure (3). Recently, pulmonary
(120 min) after receiving postoperative mechanical
edema of cardiac origin could be detected by lung
ventilation for 48 hours or more. SBT was done using
ultrasound and transthoracic echocardiography (TTE) (4).
pressure support mode (PS) (PEEP 5 cmH2O, PS 7
Lung ultrasound could detect extra-vascular lung
cmH2O, and FIO2 0.5). The start of the trial of
water (EVLW) through the assessment of B-lines, which
spontaneous breathing was based on the decision of the
substitute A-lines in this condition. Lately, B-lines equal
treating intensivist and every patient was examined by
to or more than 6 on the four anterior segments during
LUS & TTE before and 30 min after the trial.
SBT have been suggested to be a predictor of weaning-
induced pulmonary edema (WIPO) (5, 6).
Criteria of exclusion: Patients having previous SBT
Nowadays, transthoracic echocardiography (TTE) is
failure, active neuromuscular disease, history of
a widespread tool in intensive care (6). It has been used as
significant COPD, pneumothorax, pleural effusion,
a weaning failure predictor by estimation of the left
ejection fraction < 50% at enrollment, BMI > 35,
ventricle (LV) filling pressure through detecting an
pregnancy, and tracheostomy.
1434
Received: 06/08/2022
Accepted: 09/10/2022
c:\work\Jor\vol901_215
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1444-1447
Serum Leptin Level Assay in Normal and Malnourished
Children Aged from One to Five Years
Khayri Amhimmid Mousay*, Ehab Mahumoud Rashid, Samar Mahmoud Abdel Halim, Dalia Gameil
Departments of 1Pediatrics and 2Clinical Pathology, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Khayri Amhimmid Mousay, Mobile: (+20) 01026136732, E-Mail: khairiflow@gmail.com
ABSTRACT
Background: Leptin may be connected to nutrition, malnutrition, and the control of the energy balance. Objective: This
study aimed to assess the relationship between leptin levels and malnutrition status compared to normal nutrition in children
aged from 12-60 months. Subjects and methods: This case-control study was carried out on 66 children in the Nutritional
Department and Pediatrics Out-patients Clinic of Zagazig University Children Hospital. They were divided into two groups:
Group I included 33 cases as malnourished children, and Group II included 33 cases with normal nutrition state. Results:
Between the study groups, there was a statistically significant decrease in serum leptin in malnourished group. Conclusion:
The mean value of leptin levels was lower among malnutrition children than normal children.
Keywords: Leptin, Malnutrition, Anthropometric measurements.
INTRODUCTION
Reduced caloric IGF-1, eating, and fat mass all work to
An imbalance between nutritional intake and
lower leptin synthesis, are all effects of malnutrition (6).
consumption that results in cumulative deficiencies of
This study aimed to assess the relationship between
energy, protein, or micronutrients in children is referred to
leptin levels and malnutrition status compared to normal
as pediatric malnutrition and may have a deleterious
nutrition in children aged from 12-60 months.
impact on their growth, development, or other related
outcomes (1).
SUBJECTS AND METHODS
Hormonal factors are also necessary for children's
This case control study was carried out on 66
normal growth and development. For linear growth, a
children in the Nutritional Department and Pediatrics Out-
normal nutritional condition is necessary. The blood level
patients Clinic of Zagazig University.
of leptin, a hormone generated by fat cells and a protein of
Children were divided into two groups: group A
the obese (ob) gene, the body's energy is greatly impacted
comprised 33 malnourished children of both sexes; group
by this balance by regulating dietary consumption. It is the
B comprised 33 normal nourished children of both sexes.
hormone that regulates development and growth. Total fat
Children with ages 12-60 months diagnosed as
mass and leptin concentration are related, with leptin
malnourished based on history taking, anthropometric
concentrations being greater in obese patients. A symptom
measurements (height in cm, weight in kg, mid upper arm
of brain deprivation, the drop in leptin following calorie
circumference, weight for age according to Z score less
restriction may also have a protective impact (2).
than -2 were included in the study.
Leptin, "thin," or the "satiety hormone", encoded
Children with ages less than 12 and more than 60
by the obese (ob) gene, which has a mass of around 16
months with any metabolic, chronic diseases e.g., cerebral
kDa. This hormone, which controls how much body fat is
palsy, chronic infection, systemic diseases such as cardiac,
stored, is produced by fat cells. It accomplishes this by
renal and hepatic diseases were excluded from the study.
modifying both the feeling of hunger and the amount of
All children were subjected to full history taking
energy used (3). The level of leptin reflects how much
including name, age, sex, socio-economic status, type of
energy is kept in body fat. Circulating leptin levels are
feeds per day ,time of start of weaning, feeding problems
directly proportional to body fat percentage and alter
e.g., refuse to eat, difficult swallowing and colic. Carful
abruptly in response to changes in caloric consumption.
clinical examination to identify signs of malnutrition
This is particularly susceptible to a lack of energy (4).
including examination of hair, face, tongue, lips, gums,
Leptin levels are much lower and positively linked with
teeth and eyes for any signs of malnutrition and/or vitamin
the thickness of the triceps, scapula, and abdominal fat.
deficiency, it also included assessment of the child nail,
IGF-I concentrations are considerably lower in severe
skin, muscles and abdomen. anthropometric measurements
protein energy malnutrition (PEM) cases compared to
were performed according to age and gender to determine
normal children, although baseline cortisol and GH
appropriate percentile also z-score for Weight for age,
concentrations are much higher. Leptin, insulin, and IGF-I
height for age, middle upper arm circumference for age
are all highly associated with the BMI (5). Energy
were taken to determine if the child is stunted or not.
consumption and nutritional status have an impact on
Laboratory investigations were performed as routine
serum leptin levels. Consequently, it can be a sign of
complete blood count, liver, renal function tests and serum
excessive energy storage or ongoing malnutrition (2).
Leptin concentration level.
Children with malnutrition had lower blood leptin
Biochemical estimation of serum Leptin level:
levels than healthy children, and researchers hypothesized
Blood samples were collected using standard venipuncture
that this variation was caused by a reduction of leptin
technique between 9:30 to 11:00 am after fasting. Serum
production due to decreased subcutaneous adipose tissue
samples separated immediately after centrifugation at 4
lower calorie intake. Moreover, cytokines and the
degree Celsius, 2000g for 10 minutes and stored at minus
hormone insulin (IGF-1) affect leptin levels (IL, TNF-
20 degree Celsius until analysis, which performed in the
alpha). The hormone that combats obesity is leptin.
same run to avoid iner-run analytical variation, then serum
Leptin
was
measured
using
Enzyme
linked
4111
Received: 11/08/2022
Accepted: 14/10/2022
c:\work\Jor\vol901_216
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1448-1453
Study of Predictors of Outcomes and Severity of Corona Virus
Disease in Patients with Liver Cirrhosis
Ayman Fathy El Sayed, Eman Saeed Mohammed El-Bakry*,
Mohammed Hasan Ebrahem, Mohammed Abdel Azeem Abdel Azeem
Department of Internal Medicine, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Eman Saeed Mohammed El-Bakry, Mobile: (+20) 01001745048, E-Mail: emanelbakry80@gmail.com
ABSTRACT
Background: Hepatic decompensation and mortality are common after COVID-19 infection in patients with cirrhosis.
According to Child-Pugh class, mortality rose in a linear pattern. Objective: The aim of the current study is to predict
outcome of COVID-19 infection in cirrhotic patients. Patient and methods: A total of 104 patients with COVID-19
infection with history of cirrhosis admitted to Zagazig University Hospital and El-Ahrar Teaching Hospital participated
in our case control study. Patients were divided into 2 groups: The case group included 52 COVID-19 cirrhotic patients,
and the control group included 52 patients with cirrhosis but with no evidence of COVID-19 infection. All subjects were
subjected to full history taking, clinical examination, laboratory investigations, and radiological findings. Results: The
inflammatory markers (D-dimer, CRP, ESR first hour, ESR second hour and WBC) and Ferritin were statistically
significant higher in the case group compared with the control group. There were high significant correlations between
severity COVID-19 and Child Pugh classification. There were high significant correlations between laboratory
parameters and severity of COVID-19. Mortality rate was significantly higher in the case group compared with the
control group (13.4% vs. 25%, respectively). Length of hospital stay, Child Turcot Pugh, fresh frozen plasma transfusion
to correct coagulopathy, ascites and hepatic encephalopathy could predict hospital mortality among COVID-19 patients.
Conclusion: The in-hospital mortality rate for patients hospitalized with COVID-19 in the context of cirrhosis is higher
than the in-hospital mortality rate for patients hospitalized for cirrhosis alone. It is essential to acknowledge that
hospitalized patients with cirrhosis are at an elevated risk of mortality regardless of the presence of COVID-19.
Keywords: Predictors, COVID-19, Liver Cirrhosis, Child-Pugh classification.
INTRODUCTION
COVID-19 infection in patients with cirrhosis.
An outbreak of pneumonia caused by a newly
According to Child-Pugh class, mortality rose in a linear
discovered coronavirus that began in Wuhan, Hubei
pattern (6).
Province, China, at the end of 2019 quickly expanded
Age and alcohol-related liver illness were also
across the country and is now threatening to become a
contributors to mortality rates. Patients with advanced
global pandemic (1). Liver disorders and conditions
cirrhosis had a greater mortality risk compared to
including hepatitis and prolonged alcoholism can lead
controls without liver disease who were matched on
to the advanced scarring (fibrosis) of the liver known as
propensity scores. Patients with cirrhosis were
cirrhosis (2).
especially vulnerable to COVID-19-related lung illness,
The liver strives to heal itself whenever it is
which accounted for the vast majority of fatalities (7).
damaged, be it through disease, excessive alcohol
The aim of the current study is to predict outcome of
usage, or some other source. This causes the formation
COVID-19 infection in cirrhotic patients to improve the
of scar tissue. Scar tissue accumulates in a cirrhotic
prognosis of the disease.
liver, limiting its ability to perform its normal functions
(decompensated cirrhosis). Cirrhosis in its later stages
PATIENTS AND METHODS
is fatal (3).
A total of 104 patients with COVID-19 infection
There is speculation that the gastrointestinal and
with history of cirrhosis admitted to Zagazig University
hepatic signs of SARS-CoV-2 are attributable to the
Hospital and El-Ahrar Teaching Hospital participated in
widespread expression of the angiotensin-converting
our case control study.
enzyme-2 (ACE-2) receptor in these organs (4).
Patients were divided into 2 groups, 52 case in each
The virus appears to contribute to disease by
group:
stimulating an intense immunological response. Almost
half of the patients had abnormal liver function tests due
Case group: Cirrhotic patients with COVID-19
to the infection (5).
infection (Group I): 52 patients.
Patients with liver cirrhosis, particularly those who
have experienced decompensation, may be at a higher
Control group: Cirrhotic patients without COVID-19
risk of contracting SARS-CoV-2 due to systemic
infection (Group II): 52 patients.
immunological failure. The real prevalence of infected
cirrhotic people is unknown; while a preliminary
Inclusion criteria: Evidence of liver cirrhosis by
investigation found that 2-12% of COVID-19 infected
laboratory and radiological like US, evidence of
individuals have a history of liver illness. Hepatic
COVID-19 infection indicated by laboratory and
decompensation and mortality are common after
radiological findings, and their ages above 18 years.
1448
Received: 10/8/2022
Accepted: 13/10/2022
c:\work\Jor\vol901_217
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1454-1460
Thyroid Function in Liver Cirrhosis: Is It affected? A Case Control Study
Asmaa Gameel*, Aya Elbialy
Hepatology and Gastroenterology Unit, Diabetes and Endocrinology Unit,
Internal Medicine Department, Faculty of Medicine, Mansoura University, Egypt
*Corresponding author: Asmaa Gameel, Mobile: (+20)1025835429, Email: asmaagameel@mans.edu.eg
ABSTRACT
Background: Cirrhosis of the liver may be compensated with no obvious complications or decompensated which
accompanied by ascites, hematemesis, or renal impairment. Liver disease affects thyroid hormone metabolism, thyroid
problems can impair liver functions, and several systemic diseases can affect both organs.
Objectives: The aim of the current work was to study level of thyroid hormones in patients with liver cirrhosis and to
evaluate the significance of thyroid hormone level and severity of liver cirrhosis.
Patients and methods: This case control study included a total of 25 cirrhotic patients and equal number of age and
gender matched controls, attending at Hepatology and Gastroenterology unit, Department of Internal Medicine, Faculty
of Medicine, Mansoura University. Thyroid hormones were measured and correlated with child Pugh score, model for
end-stage liver disease (MELD) score and degree of hepatic encephalopathy (HE).
Results: The mean age of the liver cirrhotic patients was54.08±15.14 and for control subjects was 49.32±13.02. There
was positive correlation between TSH level, Child score and MELD score (P value <0.001). Also, there was positive
correlation between TSH level and degree of hepatic encephalopathy (p value <0.001).
Conclusions: Thyroid dysfunction is well established as liver cirrhosis progressed. So, it could be concluded that thyroid
levels could be utilized as a prognostic indicator in cirrhotic patients.
Keywords: liver cirrhosis; thyroid dysfunction; TSH level; degree of encephalopathy; Child Pugh score.
INTRODUCTION
Either "compensated" or "decompensated" liver
function, and several systemic illnesses can have an
cirrhosis could be described. Cirrhosis that has become
impact on both organs (6).
decompensated refers to it being accompanied by one or
Thyroid and liver diseases have clinical and
more of the following signs: ascites, hepatic
laboratory associations. Overall abnormal thyroid
encephalopathy (HE), jaundice or bleeding varices.
hormone levels were seen in 39.1 % patients with liver
Decompensation also includes hyponatremia, the
cirrhosis (7). Chronic liver disease patients may have
hepatorenal syndrome and spontaneous bacterial
type of hyperthyroidism, thyroiditis, or hypothyroidism.
peritonitis, however in these individuals, ascites always
Also, patients having hyperthyroidism or subacute
develops first. None of these traits are present in
thyroiditis or could have deteriorations in liver function
compensated cirrhotic patients (1).
tests, and when thyroid condition improve, these
Thyroxine (T4) and triiodothyronine, two related
abnormalities improve (6). Also,
hormones, are produced by the thyroid gland (T3). By
Studies that are currently available showed that
acting on the receptors and , these hormones control
variations in total and free T3 concentrations at the
cell growth and keep thermogenic and metabolic
plasma level of thyroid hormones are typically
equilibrium in adults. T4 is secreted by the thyroid gland
associated with the severity of hepatic dysfunction.
in excess of T3 by around 20 times. The plasma proteins
However, no study explicitly linked liver cirrhosis
to which T3 and T4 are linked are thyroxine-binding
severity to FT4 and thyroid-stimulating hormone (TSH)
globulin, transthyretin (formerly known as thyroxine
levels. Serum T4 levels are either stable or marginally
binding prealbumin), and albumin (2).
low. Serum TSH levels, however, continue to be normal
Tetraiodothyronine
(T4)
is
peripherally
or slightly elevated. Because of how well-established
converted to T3 by Type 1 deiodinase, which gives the
these fluctuations in thyroid hormone levels are, several
liver a crucial role in the metabolism of these thyroid
researchers have pushed for their use as a sensitive
hormones (3, 4) The primary enzyme in the liver, type I
indicator of liver function (8, 9).
deiodinase, converts both the 5'- and 5-deiodination of
The aim of this work was to study level of
T4 to T3, which accounts for 30% to 40% of additional
thyroid hormones (TSH, Free T3 and Free T4) in
thyroidal synthesis of T3.
patients with liver cirrhosis and to evaluate the
In addition, the liver participates in the
significance of thyroid hormone level and severity of
conjugation, excretion, and production of thyroid
liver cirrhosis.
binding globulin (3, 5). T4 and T3 impact hepatic function
via controlling the baseline metabolic rate of all cells,
PATIENTS AND METHODS
including hepatocytes. The liver is in charge of
This case control study included a total of 25 cirrhotic
metabolizing THS and managing their endocrine effects
patients and equal number of age and gender matched
throughout the body. Liver disease affects thyroid
controls, attending at Hepatology and Gastroenterology
hormone metabolism, thyroid disorders can impair liver
unit, Department of Internal Medicine, Faculty of
1454
Received: 25/8/2022
Accepted: 28/10/2022
c:\work\Jor\vol901_218
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1461-1466
Vascular and Lipid profile in Children with Chronic Kidney Disease
Samer H. El Khayat1 *, Dina E. Sallam2 , Marwa A. Abdel-Wahed3 ,
Ahmed A. Okba4 , Mohamed O. Abdel Dawoud2, Mariam J.A. Ibrahim2
1 Department of Medical studies, Faculty of Postgraduate Childhood Studies,
2 Department of pediatrics, 3 Department of Clinical Pathology,
3 Department of Diagnostic and Interventional Radiology, Faculty of Medicine, Ain Shams University
*Corresponding author: Samer El Khayat ORCID:0000-0003-3920-8557, Mobile no: +2 01005553976,
Email: Samer_elkhayat@hotmail.com
ABSTRACT
Background: Chronic kidney disease (CKD) is characterized by irreversible kidney damage and/or progressive loss of
function. Patients with CKD have hypertension and dyslipidemia, which lead to carotid intima media thickness and early
atherosclerosis.
Objective: This study aimed to evaluate the interrelationship between vascular and lipid profile abnormalities and the
different stages of CKD in pediatric patients. Methods: This cross-sectional study was done on 99 patients: 33 with stage
5 CKD on regular hemodialysis & 33 pre-dialysis CKD stage 2-4 on conservative management & 33 age and sex matched
controls. Anthropometric measures, blood pressure readings, and a lipid profile were done to all groups. Intima media
thickness was measured using ultrasound Doppler in both the common and internal carotid arteries (CCA & ICA)
Results: The waist-to-hip ratio in CKD 2-4 patients was significantly higher than in CKD 5 patients, and both were higher
than the controls, with means of 1.01 ± 0.19, 0.88 ± 0.10, and 0.86 ± 0.05 respectively. Except for high-density lipoproteins
(HDL), the lipid profile, including triglycerides, cholesterol, and low-density lipoproteins (LDL), were all significantly
increased when comparing CKD 2-4 with CKD 5, and both were higher than the controls: 170.45 ± 42.04, 166.00 ± 45.57,
and 100.88 ± 26.19 for triglycerides (p 0.001). The right and left ICA and CCA showed a significant increase in the intimal
thickness being higher in the CKD 5 group than in the CKD 2-4 and both were higher than the controls.
Conclusion: Patients with CKD had a higher waist to hip ratio with elevated lipid profile and carotid intimal thickness.
Keywords: CKD, Vascular, Lipid profile, Dyslipidemia, Carotid intima media thickness.
INTRODUCTION
Intimal media thickness (IMT) of the common
A condition known as chronic kidney disease (CKD)
carotid artery (CCA) can be assessed by B-mode
is characterised by permanent kidney damage and/or a
ultrasound. This is a simple, non-invasive way for
steady loss in kidney function over time. Kidney Disease
children receiving hemodialysis and CKD to measure the
Improving
Global
Outcomes'
clinical
practise
artery walls and track the early impacts of the
recommendations KDIGO established guidelines for
atherosclerotic process [6].
paediatric CKD staging in 2012 [1].
This study aimed to evaluate the interrelationship
Moderate to severe loss of glomerular filtration rate
between vascular and lipid profile abnormalities and the
(GFR) (i.e., GFR <45 mL/min per 1.73 m2 G3b to G5)
different stages of CKD in pediatric patients.
may result in several complications due to kidney
SUBJECTS & METHODS
function impairment. These consequences include
A cross-sectional study was accomplished in Ain
anaemia, uremic diseases, dyslipidemia, hypertension,
Shams University Children's Hospital Nephrology Unit
endocrine abnormalities, fluid and electrolyte problems,
on 99 children and adolescents. Three groups were
mineral and bone disorders, and hypertension [1].
generated: 33 patients with stage 5 CKD on regular
Children with CKD often have additional CVD risk
hemodialysis for almost four hours three times weekly, 33
factors, including hypertension and dyslipidemia. They
pre-dialysis patients with stage 2-4 CKD on conservative
may have myocardial abnormalities and early
management and 33 apparently healthy controls of the
atherosclerosis evidence, such as coronary artery
same age and sex (Table 1) [7].
calcification, [2] abnormal flow-mediated dilation,
increased carotid intima-medial thickness (CIMT), and
Table (1): Grading of CKD according to GFR
increased aortic stiffness [3]. These abnormalities seem to
GFR
GFR
Terms
be, in part, related to the degree of uremia [4].
Category (mL/min/1.73m2)
According to earlier research, central obesity is more
G1
>90
Normal or high
pathological than total fat. Body mass index (BMI) is
G2
60 to 89
Mild decrease
commonly used to detect overall obesity, other
G3a
45 to 59
Mild to moderate
anthropometric indices for obesity include waist
G3 G3b
30 to 44
Moderate to severe
circumference (WC), waist-to-hip ratio (WHR), and
G4
15 to 29
Severe decrease
waist-to-height ratio (WHtR), which are regarded as
G5
< 15
Kidney Failure
accurate indicators of central obesity or abdominal fat [5].
1461
Received: 19/07/2022
Accepted: 21/09/2022
c:\work\Jor\vol901_219
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1467-1471
Study the Level of the Pregnancy Associated Plasma Protein-A (PAPP-A)
Isolated from Mature Retrieved Oocyte during
ICSI Protocol in Iraqi Infertile women
Zainab Omar Yousif*, Lina A. Salih
Department of Biology, Collage of Sciences, University of Baghdad, Iraq
*Corresponding author: Zainab Omar Yousif, E-mail: almamarzainab@gmail.com
ABSTRACT
Background: The total number of oocytes, oocyte maturation, and oocyte fertilization all significantly affect how
successful in vitro fertilization (IVF) is. Additionally, it has been demonstrated that several chemicals in follicular
fluid, including cytokines and growth factors, have a major impact on follicular maturation, ovulation, and follicular
atresia. One of these molecules, Pregnancy Associated Plasma Protein-A (PAPP-A), a part of the Insulin like Growth
Factor (IGF) pathway, has been demonstrated to be generated by granulosa cells and present in follicular fluid.
Objective: The aim of this study is to measure the level of Pregnancy Associated Plasma Protein-A (PAPP-A) in
Follicular Fluid (FF) of infertile women undergoing ICSI, and to looking into the connections of PAPP-A with some
reproductive hormones level.
Patients and methods: The study included infertile women from Al-Wazyria Hospital, Infertility and IVF Center,
Baghdad (Iraq), from December 2021 to April 2022. This study was conducted on 45 infertile women who are set to
start their ICSI cycle.
Results: FF PAPP-A was not significant with hormones level (FSH, LH, E2 and AMH) except PRO hormone was
significant.
Conclusion: Outcomes show that no relation between studied reproductive hormones and FF PAPP-A level except
PRO levels; it was the main cause from the egg to mature and release from the ovary.
Keywords: Associated Plasma Protein-A, Follicular Fluid, Insulin like Growth Factor, In-vitro fertilization, Case
series, University of Baghdad.
INTRODUCTION
produced by blood filtration via the theca as well as
A woman's fertility is her biological potential to
extra secretions from the theca and granulosa layers. (5).
reproduce based on the monthly likelihood of
Pregnancy Associated Plasma Protein-A (PAPP-
conception, whereas fertility refers to an individual's
A), a part of the Insulin Like Growth Factor (IGF)
ability to replicate itself (1). After 12 months of
pathway, is one of these molecules that has been
unprotected sexual activity, a couple is said to be
demonstrated to be generated by granulosa cells and
infertile if they are unable to start a pregnancy; about
present in FF. IGF-I and IGF-II peptides, their binding
15% of people worldwide struggle with infertility (2).
proteins IGFBP-1 through IGFBP-6, and Type I and
Female infertility has a wide range of etiologies,
Type II IGF receptors on target cells make up the
including endometriosis, chromosomal abnormalities,
majority of the IGF system. Through autocrine and
lifestyle choices, ovulatory problems, tubal factors, and
paracrine actions, IGFs and IGF receptors are
unexplained infertility. Lifestyle factors have received a
hypothesized to contribute to follicular recruitment,
lot of attention recently due to the possibility that
oocyte maturation, and maybe embryo development (6).
unhealthy lifestyle choices, such as poor eating habits,
Pregnancy Associated Plasma Protein-A (PAPP-
stress, drinking, smoking, and obesity, might have a
A) is a zinc metalloproteinase found in the region of the
long-term influence on female physiology (1).
placental syncytiotrophoplast responsible for producing
There is much infertility management that helps
(IGFs). Cleavage of Insulin-like Growth Factor Binding
to solve the problem by either hormonal treatment or
Protein 4 depends on it (IGFBP4). IGFs regulate
Assisted Reproductive Techniques (ART) such as Intra-
steroidogenesis, follicular and oocyte development, and
Uterine Insemination (IUI), In Vitro Fertilization (IVF)
other ovarian functions (7).
and Intra-Cytoplasmic Sperm Injection (ICSI) (3).
The aim of this study is to measure the level of
Intracytoplasmic sperm injection (ICSI) is a type
PAPP-A in FF of infertile women undergoing ICSI, and
of assisted reproductive technology used to treat
to looking into the connections of PAPP-A with some
infertility; a single sperm cell is directly injected into the
reproductive hormones level.
ooplasm during ICSI. ICSI gives a variety of therapy
choices, including the use of spermatozoa with weak
PATIENTS AND METHODS
progressive motility and gametes that were surgically
The study included infertile women from Al-
removed from individuals with azoospermia's
Wazyria Hospital, Infertility and IVF Center, Baghdad
epididymis and testicles (4). Theca and granulosa cells in
(Iraq), from December 2021 to April 2022. This study
the secondary follicle release a fluid that collects in the
was conducted on 45 infertile women who are set to
antral cavity or "antrum," ultimately enveloping the
start their ICSI cycle. The respondents' ages range
oocyte. This fluid, known as Follicular Fluid (FF), is
from 19 to 45 years.
1467
Received: 15/08/2022
Accepted:18/10/2022
c:\work\Jor\vol901_220
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1472-1475
Predictor Factors of Mortality among Hospitalized COVID-19 Patients:
Retrospective Cohort Study in A Quarantine Hospital
Shaimaa H Fouad 1, Mayada Moneer 1, Sara Ibrahim 2, Ahmed Ashraf Okba 3,
Amr Hosny 3, Sylvia W Roman 1, Inas Abd El Rahim Ali 4, Mohamed Farouk Allam 5
Department of Internal Medicine (1), Department of Clinical Pathology (2), Department of Anesthesia and Intensive
Care (3), Department of Family Medicine (5), Faculty of Medicine, Ain Shams University, Cairo, Egypt
4. Department of Family and Community Medicine, Faculty of Medicine,
Misr University for Science and Technology MUST, Giza, Egypt
Correspondence: Inas Abd El Rahim Ali, Orcid number: 000-0002-8499-5919, Phone: +(202) 38247457,
Mobile: +(2) 01006064216, E-mail: inas.abdelrahim@must.edu.eg
ABSTRACT
Background: Over 630 million COVID-19 instances have been documented worldwide, and there have been close to
6.5 million fatalities. The primary methods for evaluating the effects of various variables on the COVID-19 mortality
rate have centred on individual comorbidities and risk factors related to ageing.
Objective: We looked at the connection between COVID-19 degree upon admittance to a quarantined hospital and risk
of patient death with an emphasis on several prospective therapies in order to present additional evidences.
Patients and methods: 338 participants who were admitted to Ain Shams University Hospitals were the subjects of a
retrospective cohort analysis from April 20, 2020, to July 30, 2020, of whom 317 individuals had documented outcomes
(hospital discharge or fatal prognosis). Applying logistic regression analysis, it was possible to determine the adjusted
hazard variables for fatal outcome.
Results: At the univariate stage, individuals who were elderly, smokers, hypertensives, diabetics, and individuals with
chronic kidney disease (CKD), as well as those taking steroids, tocilizumab, or enoxaparin sodium, were more likely to
have a fatal outcome. Diabetes mellitus (DM) is a strong indicator of death due to its high prevalence (65%) in COVID-
19 participants who did not survive. The multivariable investigation suggests only 2 factors from the risk categories
significantly related with fatal outcome in the univariate study: older age and steroid use.
Conclusion: The use of steroids may be more indicative of the degree of the illness than a terminal prognosis. Steroids
are frequently administered to participants who have severe respiratory problems or indications, therefore cause effect
bias is extremely possible. Additional research is required to verify the advantages of various drugs in COVID-19
individuals.
Keywords: COVID-19, Hospital, ICU, severity, risk factors, mortality, Ain Shams University.
INTRODUCTION
Aging over sixty, male gender, and comorbidities
Approximately 6.5 million deaths from COVID-19
such as diabetes mellitus (DM), hypertension, and
have been documented worldwide, with much more
chronic renal failure were found to be death indicators
than 630 million cases reported (1). All tertiary hospitals
(5,6). Decreased death was linked to the use of
worldwide were affected by the first stage of the
anticoagulants, corticosteroids, and azithromycin in
COVID-19. Research has shown that residing in
Egyptian patients having COVID-19 (6).
nursing homes, being elderly, and having persistent
In order to provide new evidence, we investigated
chronic diseases are the main causes of death (2).
the relationship between COVID-19 severity at
Critically ill SARS-CoV-2 pneumonia individuals
admission in quarantine hospital and risk of patient
have a high fatality rate. The non-survivors' survival
death with special focus on different potential
time is most expected to be 1-2 weeks following ICU
treatments.
admittance. Acute respiratory distress syndrome
(ARDS) and complications raise the risk of death in
PATIENTS AND METHODS
elderly adults (>65 years) (3).
The clinical information of individuals with
The primary methods for determining how various
laboratory- and/or CT-confirmed COVID-19 infections
variables influence the COVID-19 mortality rate have
was gathered from El-Obour Hospital reports for this
centred on individual comorbidities and risk factors
retrospective cohort analysis. This facility, which is a
related to advancing age. Firstly, it was discovered that
part of Ain Shams University Hospitals, was ready to
the likelihood of the COVID-19 mortality rate increased
isolate COVID-19 victims.
with population age. According to a WHO assessment
When a patient's identification of COVID-19 was
of data, diabetes is linked to a higher risk of COVID19-
verified
in
the
laboratory
by
related in-hospital mortality. In contrast to non-
reversed transcriptions polymerases chain
reactions
smokers, smokers have a higher risk to acquire a severe
(RT-PCR) and/or higher resolution CT chest with CO-
condition with COVID-19, according to other
RADS 4 or 5, it was deemed to be a certain diagnosis.
investigations published by WHO [WHO statement,
338 individuals were hospitalized to Ain Shams
2020] (4).
University Hospitals between April 20, 2020, and July
1472
Received: 19/07/2022
Accepted: 21/09/2022
c:\work\Jor\vol901_221
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1476-1479
Epidemiology of Neonatal Apnea in Sharqia Governorate, Egypt
Abd Elhamid Abd Allah Abd Allah
Pediatrics Department, Al Ahrar Teaching Hospital, Zagazig, Egypt
Corresponding author: Abd Elhamid Abd Allah Abd Allah, Mobile: (+20) 01025630110, E-Mail: eiadaskarany@gmail.com
ABSTRACT
Background: Apnea is defined as the cessation of airflow. Apnea is pathologic when absent air flow is prolonged
(usually 20 seconds or more) or accompanied with bradycardia. Objective: The aim of the current study is to describe
the epidemiological characteristics of neonatal apnea and its association with other diseases.
Patients and methods: A descriptive study was conducted on 100 neonates admitted at Neonatal Intensive Care Unit
(NICU) of Zagazig University Hospital. Participants were admitted at NICU between June 2021 and June of 2022.
Study variables were age, sex, weight and primary disease group. Results: Regarding the associations between neonatal
apnea and primary disease, it was found that 60% of the studied cases were premature. Hypoxic-ischemic
encephalopathy was observed in 16% of the included neonates, and respiratory distress in 60% of them. Gastro-
oesophageal reflux disease and neonatal sepsis were observed in 2% and 4% of the studied cases, respectively.
Conclusion: Our results show high association between neonatal apnea and prematurity and respiratory distress, and
to lesser extent to hypoxic-ischemic encephalopathy and gastro-oesophageal reflux disease and neonatal sepsis.
Keywords: Neonatal Apnea, Prematurity, Gastro-oesophageal reflux disease, Neonatal sepsis Epidemiology.
INTRODUCTION
disease history and associated symptoms; all cases
Apnea is defined as the cessation of airflow.
suffering from cessation of breathing for more than 20
Apnea is pathologic when absent air Flow is prolonged
second.
(usually 20 seconds or more) or accompanied by
B. Thorough clinical examination: to search for CNS,
bradycardia (heart rate <100 beats per minute) or
Cardiac, respiratory, GIT, and hematological
cyanosis. Bradycardia and cyanosis are usually present
manifestations.
after 20 seconds of apnea, although they can occur
C. Laboratory investigations: CBC, CRP, ABG, etc.
more rapidly in the small premature infant (1).
D. Radiological investigations: Chest X-ray, Cranial
Bradycardia is associated with apnea in more than 95%
U/S (suspected cases), and gastrgraphin (suspected
of cases (2).
cases).
An oxygen saturation level less than 85% is
considered pathologic in this age group. In all cases,
Ethical Consideration:
the decrease in saturation should persist for at least 5
The Ethical Institutional Review Board at Zagazig
seconds (3). After 30 to 45 seconds, pallor and
University approved the study. After explaining our
hypotonia are seen, and infants may be unresponsive to
research objectives, written informed consent was
tactile stimulation. Apnea of infancy (AOI) occurs
obtained from all study participants. This study was
when apnea persists in a neonate older than 37 weeks
conducted in compliance with the code of ethics of
after conception.The physiologic aspects of apnea of
the world medical association (Declaration of
prematurity (AOP) and AOI coincide (4).
Helsinki) for human subjects.
The aim of the current study is to describe the
epidemiological characteristics of neonatal apnea and
Statistical Analysis
its association with other diseases.
The collected data were introduced and statistically
analyzed by utilizing the Statistical Package for Social
PATIENTS AND METHODS
Sciences (SPSS) version 20 for windows. Qualitative
A descriptive study was conducted on 100 neonates
data were defined as numbers and percentages. Pearson
admitted at Neonatal Intensive Care Unit (NICU) of
Chi-Square test, Fisher's exact test and Chi-Square for
Zagazig University Hospital. Participants were
Linear Trend were used for comparison between
admitted at NICU between June 2021 and June of
categorical variables as appropriate. Quantitative data
2022.
were tested for normality by Kolmogorov-Smirnov test.
Patients were selected on the basis of the following
Normal distribution of variables was described as mean
inclusion and exclusion criteria:
and SD, and independent sample t-test was used for
Inclusion criteria: All cases with proved diagnosis of
comparison between groups. P value 0.05 was
neonatal apnea.
considered to be statistically significant.
Exclusion criteria: Cases who not suffering from
apneal attack.
RESULTS
Table 1 shows the association between neonatal
Methodology:
apnea and age where 74% of them were 1 day of age.
All neonates incorporated in this study were subjected
The results shows increase frequency of neonatal apnea
to the following: A. Careful history taking: regarding
among newborn in early age.
1476
Received: 15/08/2022
Accepted: 18/10/2022
c:\work\Jor\vol901_222
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1480-1487
Assessing Physicians' Knowledge about International Guidelines of
Albumin Use in Patients with Liver Cirrhosis
Zainab Gaber Mahran, Abdel-Rahman AboDief*, Ehab F Moustafa, Nahed A. Makhlouf
Department of Gastroenterology and Tropical Medicine, Faculty of Medicine,
Assiut University, Assiut University, Egypt
*Corresponding author: Abdel-Rahman AboDief, Mobile: (+20) 01003447486, Email: abodief.zeid1234@gmail.com
ABSTRACT
Background: Hepatocellular function is compromised in liver cirrhosis patients, and albumin production is decreased.
Objective: The aim of the current study was to evaluate clinicians' understanding of the International Guidelines-
supported evidence-based indications for using human albumin (HA).
Patients and methods: A survey was conducted on specialized Gastroenterology Physicians at Al-Rajhi Liver Hospital
and other Hospitals in Assiut, who regularly treat patients with liver cirrhosis. The study was carried out between
October 2020 and December 2021. Physicians' knowledge was assessed using Tool I then re-evaluation was done to
determine the effect of designed evidence-based indications (Tool II) for HA use on Physicians.
Results: There was statistically significant higher mean knowledge score at the post test compared to baseline (7.6±0.9
compared to 3.6±1.8, respectively). Regarding knowledge score categories, good knowledge of Physicians statistically
increased from 52.4% at the baseline to 100% at the post test. There was statistically significant higher mean difference
in function of HA knowledge score in academic doctors (3.9±1.7) compared to nonacademic doctors (2.7±1.9). There
was statistically significant higher mean difference in function of HA knowledge score in doctors with experiences 5
years (4.0±1.6) compared to doctors with experiences <5 years (3.3±1.9).
Conclusion: The level of knowledge to function and the International Guidelines of albumin use in patients with liver
cirrhosis significantly increased in the post test especially among nonacademic doctors and fresh graduate doctors.
Keywords: Human Albumin, Liver cirrhosis, Ascites, Hepato-renal Syndrome.
INTRODUCTION
assessing the effect of the worldwide guidelines-
Patients with liver cirrhosis produce fewer albumins
designed evidence-based indications for utilizing HA
and have altered hepatocellular function, which in
on doctors' knowledge after one month using Tool I.
severe cases can decline by 60-80% (1). A further decline
Total score of physician's knowledge about functions of
in protein levels is caused by the retention of water and
HA, the score was created by asking 8 questions about
salt as well as the sequestration of circulating albumin
function of HA. Total score of a doctor's awareness of
in extracellular space and ascetic fluid (2,3).
worldwide recommendations for using human albumin
Even while some trials have shown that routine long-
in cirrhotic patients.
term albumin infusion improves decompensated
Ethics Approval: This study was ethically approved
cirrhosis (4), it is not advised. As a plasma expander,
by the Institutional Review Board of the Faculty of
albumin is more costly than crystalloids and has been
Medicine, Assiut University (ClinicalTrails.gov
associated with major negative effects (5,6).The aim of
NCT04242979). Written informed consent was
the current study was to evaluate clinicians'
obtained from all participants. This study was
understanding of the International Guidelines-
executed according to the code of ethics of the World
supported evidence-based indications for using human
Medical Association (Declaration of Helsinki) for
albumin (HA).
studies on humans.
PATIENTS AND METHODS
Statistical Analysis: The Statistical Package for Social
A
survey
was
conducted
on
specialized
Sciences (IBM-SPSS) version 26.0 was used to analyze
Gastroenterology Physicians at Al-Rajhi Liver Hospital
the data. Qualitative data were defined as numbers and
and other Hospitals in Assiut, who regularly treat
percentages. Chi-Square test, Fisher's exact test and
patients with liver cirrhosis.
McNama r test were used for comparison between
The physicians were interviewed at various national
categorical variables as appropriate. Quantitative data
meetings between October 2020 and December 2021.
were tested for normality by Kolmogorov-Smirnov test.
The survey was carried out (in English) using two tools:
Quantitative variables were described as mean and
Tool (l) consists of two parts:
standard deviation (SD) or median and range. The
- Part (1): Demographic data about the physicians such
Kruskal-Wallis test was used to evaluate differences
as age, sex, job category, and years of experience.
between quantitative variables for more than two
- Part (2): Physicians' knowledge about general
groups, whereas Mann-Whitney U test was used to
information of albumin prescription and functions,
analyze differences between two independent groups.
mechanism of action of albumin in liver cirrhosis and
The association between knowledge score, age, and
potential clinical indications for albumin.
years of experience was determined using Spearman's
Tool (II): Developed evidence-based HA usage
correlation. When evaluating the internal consistency or
indications backed by global recommendations. It
reliability of scale item scores using Cronbach's alpha,
contains general information on the use and function of
a value of 70 or more is regarded as appropriate. P value
albumin as well as its mode of action in liver cirrhosis,
0.05 was considered to be statistically significant.
1480
Received: 15/08/2022
Accepted: 18/10/2022
c:\work\Jor\vol901_223
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1488-1493
Molecular Detection of Tuberculosis Disease and Association between
Drugs Taken with Some Liver Functions
Israa Jawad Jaber
College of Veterinary Medicine, Al-Muthanna University, Iraq
Corresponding Author: Israa Jawad Jaber, Mobile: 009647808957119, E-mail: Israa.jawad@mu.edu.iq
ABSTRACT
Background: Tuberculosis is one of most dangerous and infectious diseases that widespread in the world, as untreated
severe cases lead to the death of infected patients. Objective: The current study aimed to isolate and diagnose
Mycobacterium tuberculosis and to know the number of infections in the city of Samarra (Iraq), and whether there are
associations between sex or age and disease. Patients and methods: A total of 50 specimens were collected from TB
patients, out of which 25 were males and 25 were females. The diagnosis was made by the physician at the center based
on chest x-rays, microscopy, biochemical tests and examinations. The confirmatory examination was carried out using a
PCR test. Results: The age of the participants ranged from 20 to 45 years. The diagnosing bacteria from the number of
the samples reached 123 samples collected from people suffering from chest symptoms who arrived at the Respiratory
Disease Center in Samawah-Muthanna Governorate. The results of isolation and diagnosis by bacterial cultures, x-ray
showed and PCR that 49 (39.9%) samples were for people with tuberculosis and 72 (60.1%) samples were not infected
with the disease. The liver enzymes were found to be significantly low compared to the normal levels (P<0.05) in the
studied patients. The number of the persons who completed the treatment and were cured of the sickness was discovered
to be 24 (about 75%); we considered the importance of the moral difference (P value 0.463), because the significance level
is larger than 0.05. Conclusions: High proportion of drug resistance to M. tuberculosis strain detected that could suggest
the need to increase the efforts to the strengthen TB control program in the study area. There were significant variations
observed in the drug resistance patterns between M. tuberculosis lineage.
Keywords: Tuberculosis, Liver function, Drugs course, Anti-tuberculosis, M.Tuberculosis, Case series, Al-Muthanna
University.
INTRODUCTION
Mycobacterium tuberculosis does not produce
Tuberculosis is one of communicable infectious
any toxins, other studies have shown that the bacteria
diseases caused by the Mycobacterium tuberculosis
remain for several years in the lungs because the immune
complex (1).
system is the only organ that can contain them. This is
Bacteria Mycobacterium tuberculosis is the main
evidence of the bacteria's significance because it possesses
cause of tuberculosis, that as one of oldest diseases which
many key virulence factors; the growth of antibiotic
known as mankind. It's found in the mummies of the
resistance, the deteriorating state of health in big cities,
ancient Egyptians. many studies mention that this
and their virulence and severity (5).
bacterium tends to the grow in the clumps despite its slow
During the last 100 years, tuberculosis has
growth, so its generation time is from (11-30 hours), and
infected and killed more than 100 million people (6). Due
its colonies grow after weeks on solid medium and this
to the fact that latent tuberculosis, the pathogen's natural
period is long compared to others bacteria. It is one of the
reservoir, affects one third of population the world, it is a
types of bacteria whose generation time is less than an
significant public health issue on a global scale.
hour, and scientists has attributed that the length of the
Additionally, 2 million people per year pass away from
generation time for this bacteria occurs due to the
tuberculosis, which affects 9 million people with active
components of its wall that prevent the passage of
cases. Countries account for more than 90% of
nutrients easily and it protects itself in this way from the
tuberculosis cases. Africa, Southeast Asia, and Eastern
substance secrete from the host organism against it, so its
Europe are the developing regions and the regions most
cell wall contains complex substances; waxy and fatty
concerned with this illness (7).
acids such as mycolic acid and layers of (Arabinogalactan)
The BCG vaccine's insufficient protection against
and (peptidoglycan), that are situated above the plasma
Mycobacterium TB, population shifts, and the existence
membrane of the bacteria. Some scientists classified these
of multidrug-resistant strains may be the cause. 70 years
bacteria as Gram-positive because they lack the
ago, there was no medicine to treat tuberculosis; today,
phosphorylated fats, yet they are weak It is very pigmented
there are 500,000 cases of the disease caused by
or does not retain the crystal violet as a result of the high
multidrug-resistant strains and 27,000 widely drug-
level of the waxy substances and myicolic acid (2,3,4).
resistant. However, the first antibiotics, discovered in the
Because of this, some scientists characterize it as
1950s and 1960s of the 20th century, are still the first
neutral for chromium dye. Despite the fact that
1488
Received: 6/8/2022
Accepted: 6/10/2022
c:\work\Jor\vol901_224
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1494-1500
Serum Levels of Leptin and Adiponectin in Children with
Febrile Seizures: A Case-Control Study
Elsayed Abdelkreem1*, Hager A. Mohamed1, Abdelrahim A. Sadek1,
Abdelhady R. Abdel-Gawad2, Amr A. Othman1
Departments of 1Pediatrics and 2Clinical Pathology, Faculty of Medicine, Sohag University, Sohag, Egypt
*Corresponding author: Elsayed Abdelkreem, Mobile: (+20) 01114232126,
ORCID: 0000-0002-8976-2989, Email: d.elsayedmohammed@med.sohag.edu.eg,
ABSTRACT
Background: The pathogenesis of febrile seizure (FS), the most prevalent convulsive condition in children under the
age of five, has not been fully determined. Objective: The aim of the current study is to evaluate serum levels of
adiponectin and leptin in children with FS. Patients and methods: A case-control study was conducted at the
Departments of Pediatrics and Clinical Pathology of Sohag University Hospital,and included 3 groups of 30 children
per group: FS, febrile controls (FC), and healthy controls (HC). Serum levels of adiponectin and leptin were measured
during the acute phase using human enzyme-linked immunosorbent assay. A multivariate logistic regression analysis
was conducted to study independent factors associated with FS. Results: Both the FS and FC groups had comparable
serum adiponectin (median 43.5 [IQR 40-63] vs. 44 [39-83] g/L, p 0.756) and leptin (86 [56-99] vs. 78.5 [44-111], p
0.779) levels, but both groups had significantly higher adiponectin (p 0.002, 0.003) and lower leptin (p 0.007, 0.002)
levels compared with the HC group. The FS group had significantly higher body temperature on admission, WBCs,
CRP, and creatinine but lower hemoglobin levels. However, in the multivariate logistic regression model, only higher
body temperature on admission retained statistical significance (p 0.006). Conclusion: Serum adiponectin and leptin
levels had no significant associations with FS, but this should be confirmed by larger and more comprehensive studies.
Keywords: Febrile seizure, Febrile convulsion, Adipokines, Adiponectin, Leptin.
INTRODUCTION
visfatin (9). Studies on the role of adiponectin and leptin
A febrile seizure (FS) is a seizure that occurs in
in FS have shown inconsistent results. Chen et al. (7)
children between the ages of 6 months and 5 years old
reported a significant association between higher serum
in conjunction with a temperature of at least 38°C and
adiponectin levels and having FS, but Güven et al. (10)
without any signs of a central nervous system (CNS)
and Azab et al. (6) described elevated serum adiponectin
illness, another known cause of seizures, or a previous
levels in children with FS as well as febrile controls.
afebrile seizure (1,2). This is the most common
Regarding leptin, Azab et al. (6) reported a significant
convulsive disorder among children under 5 years of
association between lower serum leptin levels and FS.
age with an estimated incidence of 2-10% (3,4). FS is
However, Khoshdel et al. (11) showed no significant
divided into simple and complex categories according
association, and Güven et al. (10) found significantly
to age and seizure type, duration, and recurrence within
higher leptin levels in not only children with FS but also
24 hours (2). Future recurrence occurs in about 25-50%
in febrile controls. These inconsistencies may be
of children with FS. FS generally has a favorable
attributed to differences in study populations,
prognosis, although recent evidence suggests that
measurement techniques, and potential confounders.
complex FS may be associated with cognitive deficit in
The aim of this study was to evaluate serum levels
some cases (4,5).
of adipocytokines, specifically adiponectin and leptin,
The pathogenesis of FS has not been completely
in children with FS using controls of feverish, as well as
understood. The risk of fever's effects on the developing
healthy children.
brain, together with underlying genetic predisposition
and environmental factors, make up the likely complex
PATIENTS AND METHODS
etiology of FS (1). Disturbed balance between pro- and
Study design and setting: A case-control study was
anti-inflammatory cytokines has been demonstrated to
conducted between July 2021 and October 2022 at the
play an important role in the pathogenesis of FS.
Departments of Pediatrics and Clinical Pathology of
Because of recent developments in medical technology,
Sohag University Hospital (Southern Egypt).
several biomarkers for febrile seizures have been
Participants: The study included 3 groups of 30
investigated, such as serum lactic acid, copeptin and
children: FS, febrile control (FC), and healthy control
Von Willebrand factor, proinflammatory cytokines
(HC). The FS group included children between 6
(e.g., interleukin-6 [IL-6], tumor necrosis factor-
months and 5 years of age, presented with seizure and
[TNF-]),
anti-inflammatory
cytokines
(e.g.,
fever (temperature 38°C) and fulfilled the American
interleukin-4 [IL-4]), and adipocytokines (6-8).
Academy of Pediatrics (AAP) diagnostic criteria of FS
Adipocytokines are a group of hormonally active
(2). FC group included age-matched children presented
peptides produced by adipose tissue, which include
with fever of at least 38°C due to acute infection with
adiponectin, leptin, IL-6, TNF- , ometin, vaspin, and
no seizures, while the HC group included otherwise
1494
Received: 15/08/2022
Accepted: 18/10/2022
c:\work\Jor\vol901_225
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1501-1509
Growing Skull Fractures after a Closed Head Injury,
Early Detecting Signs, and Surgical Considerations
Ahmed M. Deabes *, Shawky El Meleigy, Mohamed E. Elhawary
Department of Neurosurgery, Benha University, Faculty of Medicine, Qalyubia, Egypt
Corresponding author: Ahmed M. Deabes, MD, Mobile: +20 1025001475,
email: ahmed.elsayed@fmed.bu.edu.eg
ABSTRACT
Background: When children younger than three years suffer a closed-head injury such as a fall or a
blow to the head, a linear calvarial fracture may occur, leading to a growing skull fracture.
Methods: In this prospective study, we provide 10 instances to better illuminate the symptoms of GSF,
facilitate earlier surgical correction, and prevent negative outcomes by the use of specific technical
details.
Results: Early surgical correction was performed for all patients showing evidence of dural tear and
GSF, such as a pulsating, non-resolving subgaleal collection despite medical treatment, a fracture
diastasis, a leptomeningeal cyst on magnetic resonance imaging, or a herniated brain via a fissure. After
a skin incision was made including the fissure, a bone flap was created using electric craniotomy from
the fracture's edge to minimize bony defects without the use of a burr hole. Next, the dura was dissected
away from the fracture's edges, and finally, the underlying arachnoid adhesions and devitalized brain
tissues were addressed before the dural closure was made. Results were better and complications such
as increased intracranial pressure, prolonged CSF leak after surgery, meningitis, and skull abnormalities
were avoided with early surgery.
Conclusions: Patients with linear skull fractures following closed head injuries require close
monitoring and follow-up. Knowing the warning signals of GSF is important for parents. In the
presence of symptoms and radiographic evidence of a dural rupture, early surgical repair is required to
avoid neurological impairment, seizures, and elevated intracranial pressure.
Keywords: Growing skull fracture, Leptomeningeal cyst, dural tear encephalomalacia
INTRODUCTION
complication of skull fractures in children. The
The skull fracture was first reported by John
brain may be readily lacerated by a depressed
Howship in the 18th century (GSF). Following
or temporarily depressed fracture (12, 13).
severe skull fractures, children younger than 3
Oedematous cortical tissue and the pia-
years are more prone to acquire GSF (1, 2, 3).
arachnoid membrane might impede recovery.
Between 0.05% and 1.6% of the population
An expanding leptomeningeal cyst pushes
may develop GSF. Parietal quadrants are the
through a dural gap into the subgaleal space as
typical sites of occurrence. Pulsatile swelling is
cerebrospinal fluid pulses enlarge the
the most prevalent presenting sign, followed by
subarachnoid pouch that extends through the
seizures and neurological abnormalities.
fracture edge. It's worth noting that CSF
Avoiding irreversible brain damage from GSF
pulsations have a greater tendency to degrade
requires an early diagnosis and rapid surgical
the inner table than the outer table (14, 15, 16).
intervention. It may take anything from a few
days to a few years to determine whether or not
PATIENTS AND METHODS
a head injury has caused permanent damage (4,
Between March 2018 and August 2021, all
5, 6). It is recommended that GSF be diagnosed
patients at Benha University Hospitals who had
by plain radiography or CT. Magnetic
surgery for a developing skull fracture were
resonance imaging (MRI) is used to identify
included in a prospective study. Our IRB has
CSF leaking, brain tissue injury, and herniation
given their approval to this work. All patient's
(7,8). The pathogenesis of GSF has not been fully
parents provided written informed permission.
elucidated in the literature (9, 10, 11). Because
A fissure that developed following a head
baby skulls are more malleable than adult
injury that was kept from the outside was
skulls, inward displacement is a common
considered. Open wounds to the skull,
1501
Received: 05/08/2022
Accepted: 07/10/2022
c:\work\Jor\vol901_226
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1510-1514
Effect of Preoperative Respiratory Muscle Training on
Respiratory Complications after Median Sternotomy Incision
Mahmoud Ahmed Labib
Department of Physical Therapy for Cardiovascular/Respiratory Disorder and Geriatrics,
Faculty of Physical Therapy, Kafr El Sheikh University, Kafr El Sheikh Egypt
Corresponding author: Mahmoud Ahmed Labib, Email: ptrservices2022@gmail.com
Mobile: +201030356508
ABSTRACT
Background: The most frequent problems following cardiothoracic surgery are postoperative pulmonary complications
(PPCs), which are also the main cause of postoperative morbidity and mortality.
Aim: This study aimed to find out how preoperative respiratory muscle training affected the incidence of PPCs.
Materials & Methods: This study included thirty high-risk PPC patients awaiting elective open-heart surgery, ranging
in age from 20 to 40 years. They were classified into two main groups: the control group (group I) and the study group
(group II). All participants had a pulmonary function test before the study began. On the day before surgery, patients in
the control group got standard care. This standard of care included a brief description of the operation's steps, potential
risks, side effects, and complications, as well as postoperative chest physiotherapies techniques such as deep breathing
exercises, coughing mechanisms, bed mobility, and ambulation. In addition to the usual care provided to the control
group, the study group undertook preoperative respiratory muscle training twice daily for at least two weeks before the
surgery.
Results: However, the findings of the current study noted that preoperative respiratory muscle training reduced the
amount of time required for mechanical ventilation, ICU stays, inpatient stays, and overall postoperative hospitalization.
Conclusion: Preoperative respiratory muscle training reduced the incidence of pulmonary problems in individuals at
high risk for median sternotomy incision.
Keywords: Preoperative respiratory muscle training, Postoperative pulmonary complications, Median sternotomy.
INTRODUCTION
occurrences of pulmonary problems following heart
The number of heart surgeries performed
surgery, which sits anywhere from 8% to 79%
worldwide has steadily and rapidly expanded since the
( 2 , 4 , 5 , 6 ) .
development of cardiac surgery in the 1950s. PPCs have
Smoking, poor general health, old age, obesity
a significant impact on major surgical recovery,
(body mass index >27), COPD (FEV 1/75 percent
particularly after open heart surgery. The most frequent
expected, FEV 1/80 % expected, and FEV 1/FVC70 %
post-abdominal
or
post-cardiothoracic
surgery
expected), diabetes mellitus, cough, and expectoration
complications seen and treated are PPCs like atelectasis,
are all patient-related risk factors that may increase the
pneumonia, respiratory failure, worsening of
incidence of PPCs. Patients with chronic pulmonary
underlying chronic lung disease, or pulmonary
illness are the greatest source of potential complications
dysfunction (1,2).
for PPCs (7).
Pasteur (3) first reported postoperative PPCs and
Screening for and modifying risk factors,
they continue to be a significant contributor to
optimizing pre-operative status, patient education,
postoperative morbidity, meaning they add significantly
intra-operative management, and postoperative
to patient suffering, duration of hospital stays, resource
pulmonary care are all effective methods for decreasing
utilization, and overall hospital expenditures. PPCs are
the occurrence of PPCs. Despite scant evidence for its
defined as abnormalities in the pulmonary system that
efficacy, physiotherapy has been widely used in both
develop after surgery and result in measurable illness or
pre-and post-operative care for the prevention and
dysfunction that compromises clinical outcomes. PPCs
amelioration of PPCs following surgery since the 1960s
develop by alterations provoked by the surgical
(6).
procedure which deteriorates the respiratory muscular
Preoperative respiratory muscle training was
function leading to respiratory dysfunction. The result
recommended by some researchers; they discovered
of this dysfunction is a decrease in pulmonary flows and
that it is well received and enjoyed by patients and
volumes, which can cause atelectasis, a less effective
appears to lower the frequency of postoperative
cough, more work for the lungs to do, and less
atelectasis.
The
importance
of
preoperative
efficiency in how the muscles of the lungs perform. The
optimization of cardiac and pulmonary status can be
frequency of PPCs varies widely according to the type
proven in specific populations undergoing high-risk
of surgery conducted, the existence of risk factors, and
surgery. Preventive physical therapy with IMT given
the diagnostic criteria employed. Rates of postoperative
to patients at high risk of PPCs prior to coronary
pancreatitis (PPC) after abdominal surgery have been
artery bypass graft (CABG) surgery was related to an
reported to fall anywhere from 17 and 88 %. Multiple
increase in inspiratory force, a decrease in the
factors contribute to the wide range of reported
incidence of PPCs, and a shorter period of
1510
Received: 05/08/2022
Accepted: 07/10/2022
c:\work\Jor\vol901_227
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1515-1521
TC-99m-MDP Bone Scintigraphy Utilization for
Articular Involvement Detection among Behçet's Patients
Heba Abdel Fattah Atya Hassan*1, Miada Nagy Almohamady Abdallah2
1Department of Rheumatology and Rehabilitation, El Galaa Teaching Hospital, Cairo, Egypt
2Department of Rheumatology and Rehabilitation, Ahmed Maher Teaching Hospital, Cairo, Egypt
*Corresponding author: Heba Abd El Fatah Attia, Mobile: (+20)1028317209, E-Mail: hebaatya@hotmail.com
ABSTRACT
Background: Behçet's disease (BD) is characterized by inflammation of the arterial and venous walls throughout the body
and has an unknown cause.
Objective: This study was aimed to assess articular involvement in patients with Behçet's disease: a pilot study with bone
scintigraphy.
Patients and Methods: This study included a total of 25 Behçet's disease patients, attending at Departments of
Radiodiagnostics and Nuclear Medicine, Cairo University Hospitals. They were subjected to the following: Full history
taking, clinical examination, routine laboratory tests including CBC, ESR, CRP and conventional radiological examination
and bone scintigraphy in the radiodiagnosis and the nuclear medicine departments respectively, Cairo University Hospital.
Skin pathergy test was performed.
Results: Joint involvement was clinically apparent in 12 of the 25 cases (48%). Two individuals (8 percent) had signs of
rheumatoid arthritis in their hands. The most frequently involved site on bone scintigraphy was the wrist (100%). All of
the patients (100%) revealed hand scintigraphic involvement, 24% of them had mild score, 60% had moderate score and
16% had severe score.
Conclusion: It could be concluded that bone scintigraphy is helpful in identifying articular involvement and pinpointing
its location.
Keywords: Behcet's disease, TC-99m-MDP Bone Scintigraphy Utilization, Articular Involvement.
INTRODUCTION
Veins and arteries of varying sizes can be affected
radiographic examination and bone scintigraphy. A test
by Behçet's disease (BD), a chronic inflammatory
for skin allergies was conducted.
condition of unknown origin. The skin, mucous
membrane, eyes, joints, arteries, digestive system, and
Pathergy test:
neurological system are only some of the organs that
Each individual had a pathergy test (in which 0.2 ml
might be affected by Behçet's disease (1).
of saline was injected intradermally into an avascular
Nevertheless, arthritis is not among the criteria
area of the flexor aspect of the forearm). If a sterile
used in international studies (2), Behçet's disease is
papule appears within 24 to 48 hours, the test is
characterized by a variety of symptoms, one of the most
considered positive (simple erythema was accepted as
common of which being arthritis or arthralgia. In the
negative). For further confirmation of the diagnosis, one
range of 5-76 percent of Behçet patients, articular
of the dermatology department's employees consulted
involvement was identified. Behçet's disease affects both
with a dermatologist.
small and large joints, as well as the tendon enthesis (3).
The severity score was arrived at by adding together
99 mTc-methylene diphosphonate (TC-99m-MDP)
the points given for each symptom, with one point given
bone scintigraphy is a non-invasive method for detecting
for mild symptoms, two for moderate symptoms, and
early subclinical articular involvement in Behçet patients
three for severe illness presentations (6).
(4). Bone scintigraphy has a high sensitivity for detecting
joint involvement in its earliest stages, especially in
Bone Scintigraphy using Tc-99m MDP:
asymptomatic or mildly symptomatic patients whose
Preparation and follow-up with patients:
plain radiographs look normal (5).
- The patient should not be in a fasting state.
This study was aimed to assess articular
- The patient is instructed to take about 500-1000
involvement in patients with Behçet's disease: a pilot
ml (0.5-1L) of water or other drink types over a
study with bone scintigraphy.
period of 2-3 hours and void regularly as no need
to retain urine in urinary bladder.
SUBJECTS AND METHODS
- Both before and after an imaging session, the
This study included a total of 25 Behçet's disease
patient should empty his or her bladder often
patients, attending at Departments of Radiodiagnostics
(reduces radiation dose to the bladder wall).
and Nuclear Medicine, Cairo University Hospitals.
- Prior to imaging, the patient should empty their
Patients
were
subjected
to
the
following:
pockets of any metal (jewellery, money, keys,
Comprehensive medical history, physical examination,
etc.).
standard laboratory testing (complete blood count,
Dose: 15-20 mCi (555-740 MBq) Tc-99m-MDP
electrolytes, C-reactive protein), and conventional
(adult dose).
1515
Received: 6/08/2022
Accepted: 8/10/2022
c:\work\Jor\vol901_228
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1522-1526
Elevated Serum Neurofilament Light Chain in Hemodialysis Patients with Pruritus
Karem Taha Khalil1*, Ahmed Abd Elwahab Saleh1, Mohamed El Tantawy Ibrahim2,
Dalia Mohamed Abd El-Hassib3, Esraa Hassan Kasem Bekheit1
Departments of 1Dermatology, Venereology and Andrology,
2Internal Medicine, and 3Clinical and Chemical Pathology, Faculty of Medicine, Benha University, Egypt
*Corresponding author: Karem Taha Khalil, Mobile: (+20) 01282559828, Email: karem.nawar_76@yahoo.com
ABSTRACT
Background: Hemodialysis-related pruritus is a widespread, troubling issue with a complex pathogenesis, including
neuropathy. The neurofilament light chain (NfL) is a neurocytoskeleton component that increases in
neurodegenerative and polyneuropathy illnesses. Objectives: The aim of the current study was to evaluate the serum
levels of NfL in pruritic hemodialysis patients. Patients and methods: Sixty patients receiving regular hemodialysis
were selected, and divided into 2 equal groups (30 patients with pruritus, and 30 patients without pruritus), and a
control group of 20 healthy individuals who were age and sex matched. With the help of the Visual Analogue Scale
(VAS), pruritus intensity was evaluated. Hemoglobin, urea, creatinine, calcium, phosphorus, and parathormone
laboratory tests were performed. Additionally, the serum NfL level was determined using ELISA.
Results: Serum NfL levels varied significantly between the study groups (P=0.001), with pruritic hemodialysis
patients having the highest median level, followed by those without pruritus, and the control group having the lowest
level. There was a significant positive correlation between the duration and intensity of itching and blood NfL
(P=0.001). Conclusion: Increased NfL levels in hemodialysis patients with pruritus support the neuropathy hypothesis
as a source of pruritus in end-stage renal disease.
Keywords: Neurofilament light chain, Hemodialysis, Pruritus.
INTRODUCTION
mild itching, 4 - <7 = moderate itching, 7 - <9 =
Patients with advanced chronic kidney disease
severe itching, and 9 = very severe itching (5).
(CKD) frequently have pruritus, which affects 15% to
Laboratory assay:
49% of patients prior to dialysis and 50% to 90% of
Blood samples were taken for analysis of
patients during dialysis (1). Uremic pruritus still has an
hemoglobin concentration, parathormone, calcium,
unclear pathogenesis. Among the many possibilities
phosphorus, urea, creatinin. Serum NfL levels were
that were taken into consideration was neuropathy (2).
measured using ELISA kits (supplied by Sinogeneclon
Neurofilaments are neuronal cytoskeletal proteins
Biotech Co., Ltd).
that include neurofilament light (NfL), medium, and
heavy chains. NfL is involved in axonal development
Ethical Approval:
and stability (3). Neuroaxonal injury in peripheral
The Ethical Institutional Review Board at the
nerves causes the release of NfL into the extracellular
Faculty of Medicine at Benha University (MS 32-
space and peripheral circulation (4). The aim of the
12-2021) approved the study. After explaining our
current study was to evaluate the serum levels of NfL
research objectives, written informed consent was
in pruritic hemodialysis patients.
obtained from each participant. This study was
conducted in compliance with the code of ethics of
PATIENTS AND METHODS
the world medical association (Declaration of
A case-control study was conducted and included
Helsinki) for human subjects.
80 subjects recruited from Outpatient Clinics of
Dermatology & Andrology Department and the
Statistical Analysis
Hemodialysis unit, Benha University Hospitals, during
The collected data were introduced and
the period from January 2022 to July 2022.
statistically analyzed by utilizing the Statistical
Participants were divided into 3 groups: a first
Package for Social Sciences (SPSS) version 20 for
group of 30 hemodialysis patients with chronic
windows. Qualitative data were defined as numbers
pruritus, a second group of 30 hemodialysis patients
and percentages. Pearson coefficient, Fisher's exact
without pruritus, and a third group of 20 healthy, age-
test and Chi-Square for Linear Trend were used for
and sex-matched controls. Patient groups comprised
comparison between categorical variables as
patients who had been receiving regular hemodialysis
appropriate. Quantitative data were tested for
for more than 6 months. Patients with chronic
normality by Kolmogorov-Smirnov test. Quantitative
illnesses, such as those related to the nervous system,
variables were described as mean and standard
the liver, the biliary system, cancer, other pruritic skin
deviation (SD) or median and interquartile range
conditions, or those who were pregnant or lactating
(IQR), and independent sample t-test/Mann-Whitney
were not included.
test was used for comparison between 2 groups.
All participants were subjected to a full and detailed
Analysis of variance test "ANOVA" or Kruskal Wallis
clinical history with a focus on the relation of itching
test was used to compare more than 2 groups with each
to dialysis sessions and the duration of dialysis. The
other. P value 0.05 was considered to be statistically
severity of itching was estimated using the Visual
significant.
Analog Scale (VAS) categories: 0 = no itching, <4 =
1522
Received: 16/08/2022
Accepted: 19/10/2022
c:\work\Jor\vol901_229
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1527-1533
Anti-Epithelial Growth Factor Receptors for Prognosis in
Management of Metastatic Colorectal Cancer
Shereen Elshorbagy1, Yousery Nada2, Islam Muhammed Saadawy2*, Rasha Haggag1
1 Medical Oncology Department, Faculty of Medicine, Zagazig University, Egypt
2 Medical Oncology Department, Oncology and Hematology Hospital,
Maadi Armed Forces Medical Compound, Egypt
*Corresponding author: Islam Muhammed Saadawy, Mobile: (+20) 01556622556, E-Mail: islam_saadawy_90@hotmail.com
ABSTRACT
Background: Up to 60% to 80% of colorectal cancer (CRCs) exhibit epithelial growth factor receptors (EGFR). EGFR
promotes cancer in a number of ways, some of which include cell cycle disruption and others that involve signaling
through a variety of downstream pathways.
Objective: The aim of the current study is to evaluate the role of Anti-Epithelial Growth Factor Receptors (Anti-EGFR)
in management of metastatic colorectal cancer.
Patients and methods: A comparative study was conducted in Medical Oncology Departments in Zagazig University
and Maadi Military Hospital including all metastatic colorectal cancer patients from January 2016 to January 2018, with
total of 186 patients. All patients were evaluated regarding epidemiological data and response to treatment and survival
analysis. Results: Median overall survival of whole studied samples (N=186 patients) was 22 months and was higher
in patients receiving Anti-EGFR. Among the studied group, patients with wild Kirsten rat sarcoma virus (KRAS) were
73 patients out of which 47 (64.3%) patients received antiEGFR and chemotherapy and 26 (35.6%) received
chemotherapy alone, with overall survival 32 vs. 27 months (P=0.217) and progression free survival 9 vs. 8 months
(P=0.824), respectively. Overall survival had significant correlations with receiving previous adjuvant treatment
(P=0.001), resection of primary tumor (P=0.001), and site of metastasis with lymph nodes metastasis showing best
overall survival up to 39 months (P=0.02). Conclusion: Anti-EGFR was beneficial in improving progression-free
survival and response rates and overall survival for patients with metastatic colorectal cancer.
Keywords: Anti-Epithelial Growth Factor Receptors, Metastatic Colorectal Cancer, Kirsten rat sarcoma virus.
INTRODUCTION
The prevalence and death from colorectal cancer
Comparison of tumour responses between wild-
varies greatly across region ns. According to the World
type and mutant Kirsten rat sarcoma virus )KRAS(
Health Organization, there were 1.8 million new cases
cells. Resistance to EGFR inhibitors was shown in
of colorectal cancer and roughly 861,000 deaths
tumours with KRAS mutations leading to a
worldwide in 2018. This makes it the third most
constitutively active GTP-binding protein (6).
commonly diagnosed cancer in males and the second
The aim of the current study is to evaluate the role
most commonly diagnosed cancer in females. Men have
of Anti-Epithelial Growth Factor Receptors (Anti-
much greater rates than women do. Both the rate of
EGFR) in management of metastatic colorectal cancer.
occurrence and the number of fatalities have been
declining in the United States (1).
PATIENTS AND METHODS
On average, there are 145,600 new instances of
This is a retrospective comparative analysis of how
large bowel cancer each year, with colon cancer
Anti-EGFR has been used to treat advanced colorectal
accounting for 101,420 and rectal cancer for the
cancer. From January 2016 to January 2018, a total of
remaining cases (2).
186 patients with metastatic colorectal cancer were
Up to 60% to 80% of colorectal cancers express
treated in the Medical Oncology Departments at
EGFR. EGFR promotes cancer through a variety of
Zagazig University and Maadi Military Hospital.
methods, including disruption of the cell cycle and the
upregulation of tumour survival factors (3).
Primary end point: Progression free survival (PFS).
Given EGFR's possible essential involvement in
Secondary end point: Overall survival (OS).
cancer, many research groups have successfully
Inclusion criteria:
developed neutralizing antibodies or kinase inhibitors.
1) Age more than 18 years old.
Monoclonal antibodies cetuximab and panitumumab
2) Pathologically proved colorectal cancer.
have garnered a lot of attention (4).
3) Metastatic disease.
Cetuximab and panitumumab block ligand-
4) Performance status: 0-2.
dependent activation and receptor dimerization by
5) Available complete data.
binding the extracellular domain of EGFR. Antibody-
dependent cell-mediated cytotoxicity is another
Exclusion criteria:
potential mechanism of action for cetuximab in
1) Other malignancies.
inducing an immunological response (5).
2) Performance status: >2.
1527
Received: 15/08/2022
Accepted: 18/10/2022
c:\work\Jor\vol901_230
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1534-1536
A Study of the Relation between Human Cytomegalovirus and IL-35 in
Rheumatoid Arthritis Disease Patients in Iraq
Layla Hassan Khayon*, Abbas Aboud Farhan, Dunya Fareed Salloom
Department of Biology, College of Education for Pure Sciences, University of Diyala, Diyala, Iraq.
Department of Biology, College of Sciences, University of Baghdad, Baghdad, Iraq.
*Corresponding author: Layla Hassan Khayon, Mobile: +96 47723220927, Email: layla.hassan.khayon@uodiyala.edu.iq
ABSTRACT
Background: An autoimmune and inflammatory illness called rheumatoid arthritis (RA) occurs when your immune system
mistakenly attacks normal cells in your body. Interleukin-35 is a brand-new cytokine that belongs to the immunosuppressive
and anti-inflammatory IL-12 family. -herpesvirus that produces inflammation and stays dormant in its host for life is the
human cytomegalovirus. Human herpesvirus (HCMV) has been at the core of several RA-related theories.
Objective: The current study looked at the association between RA and serum IL-35 levels as well as the association
between RA and CMV.
Patients and methods: Blood samples were taken in the Baghdad Teaching Hospital and Typical Rheumatology Unit from
January 2022 to Mars 2022 for the current study, which comprised 70 Iraqi patients with RA illnesses and 22 Iraqi controls.
ELISA was utilized to measure the biomarkers in this investigation, including the levels of IL-35 and anti-CMV lgG.
Results: In comparison to control group, RA patients had increased levels of IL-35, but there was no statistical significant
difference between the two groups. Because all participants in our research had anti-CMV IgG, it was determined that both
sick and healthy individuals had previously been infected with the virus.
Conclusion: Our results showed the role of IL-35 as a cytokine against inflammation and contributed to the control of RA
pathogenesis, as well as the association between IL-35 and HCMV and whether the illness is active or not.
Keywords: Rheumatoid arthritis, IL-35, CMV, Case control study, University of Diyala.
INTRODUCTION
RA often attacks numerous joints at once if it
Rheumatoid arthritis (RA), whose etiology is
predominantly affects the joints. The joint tissue in a RA-
unknown, is characterized by inflammatory changes in
affected joint is harmed by the inflammation of the joint
cartilage and bone, as well as in the synovial tissue of joint
lining. This tissue injury may result in deformity,
(1). It is an inflammatory condition that is constantly
unsteadiness (loss of balance), and long-lasting or severe
progressing and involves systemic, extra-articular, and
discomfort (misshapenness) When the body's immune
articular symptoms. Its origin is unclear (2).
system attacks its healthy cells, RA results., RA
It has been obvious in recent years that genetic and
frequently affects the knee, wrist, and hand joints.
epigenetic variables affect how RA manifests itself, but
Although the specific cause of RA is unknown, there are
environmental factors like exposure to dust and cigarette
a few things you may do to lower your chance of getting
smoke must also have a substantial impact. In addition to
the disease (5).
T and B cells entering the synovium, there appears to be
Regulatory T cells, such as peripheral and thymic
extensive interaction between the innate immune system's
Tregs, directly release IL-35, a novel type of cytokine,
components and the immune system's adaptive
according to research done in 2007 by Collison et al. and
components. Autoantibodies are created as a result of
Niedbala et al. Additionally, some non-immune cells,
anomalies in the cellular and humoral immune response
such as tumor cells, have the capacity to produce IL-35 (6).
(RF), including the innate immune system and the system,
Both T regulatory (Treg) and B regulatory cells
most notably rheumatoid factors, antibodies against
express the pro-inflammatory cytokine interleukin-35
proteins that have undergone post-translational
(IL-35). AML blast growth is encouraged by IL-35, which
modifications, including acetylation, carbamylation, and
also inhibits apoptosis (7). Infections, inflammation,
citrullination, as well as abnormalities in the cellular and
malignancies, and autoimmune disorders such systemic
humoral immune systems, known as anti-modified
sclerosis, RA, Crohn's disease, and primary biliary
protein antibodies (AMPAs) (3).
cirrhosis are all strongly correlated with IL-35 (8).
RA, which can severely destroy joints and leave
HHV5 is categorized as a beta-herpesvirus and is
sufferers disabled, affects about 5 out of every 1000
also known as human herpesvirus (HCMV).
people. In the last 20 years, there has been a significant
Seroprevalences vary with socioeconomic class. The
advancement in our understanding of illness
virus is spread by body fluids like as saliva, blood, breast
pathophysiology, optimum outcome measures, and
milk, and others. The incidence of serum positive for the
effective treatment modalities, including the recognition
infection in the general population has been found to be
given the significance of RA early detection and treatment
83% (9).
(4).
1534
Received: 17/08/2022
Accepted: 20/10/2022
c:\work\Jor\vol901_231
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1537-1541
Left Ventricular Longitudinal Strain Following Revascularization in
Acute ST Segment Elevation Myocardial Infarction: A Comparison of
Primary Angioplasty and Streptokinase Based Pharmacoinvasive Strategy
Ahmed Ibrahim Bedier1, Ahmed Elsayed Rizq2, Mohamed Bayoumi Shehab Eldin1, Sally Magdy Teima1
1Cardiology department, Faculty of Medicine, Mansoura University, Egypt
2Specialist of Cardiology, Ministry of health, Egypt
Corresponding author: Ahmed Ibrahim Bedier, Email: dr.ahmedbedier90@gmail.com-mobile:01281604553
ABSTRACT
Background: Two-dimensional speckle-tracking echocardiography (2D STE) has been proven to be more accurate than
prognostic metrics such as the left ventricular ejection fraction (LVEF) and wall motion score index (WMSI).
Aim: To contrast the effectiveness of primary percutaneous coronary intervention (PCI) versus Streptokinase based
pharmacoinvasive technique in ST elevation myocardial infarction (STEMI) patients.
Patients and methods: In this observational cross section research, 100 patients with acute STEMI were enrolled. They
were then divided into two groups: Group A, which included 50 patients who underwent primary PCI as a reperfusion
strategy, and Group B, which included 50 patients who underwent pharmacoinvasive technique, which involved
streptokinase IV infusion, over the course of a year from November 2020 to November 2021. In order to evaluate the
main outcome, which was LV systolic function, all patients had a thorough medical history review, physical
examination, 12-lead surface ECG, and echocardiogram (2D global longitudinal strain [GLS] utilizing speckle tracking
echocardiography [STE]. Results: Pre-intervention GLS showed no statistically substantial variation between the two
groups (p=0.768), however post-treatment GLS showed statistically substantial variations between the two groups
(p=0.004) and regarding change (%) GLS (p 0.001).
Conclusion: Primary PCI remains the best option for resolving ischemia. When compared to IV streptokinase treatment,
direct coronary angioplasty exhibited a substantial clinical advantage. To treat the myocardial infarction, it was superior
to streptokinase based pharmacoinvasive therapy.
Keywords: STEMI; GLS; PCI; Pharmacoinvasive; Speckle tracking echocardiography.
INTRODUCTION
patients were divided into two groups: Group A, which
Two-dimensional
speckle
tracking
echo-
included 50 patients who underwent primary PCI as a
cardiography (2D STE) has been established to be more
reperfusion strategy, and Group B, which included 50
accurate than prognostic metrics such as the left
patients
who
underwent
streptokinase-based
ventricular ejection fraction (LVEF) and wall motion
pharmacoinvasive (PI)technique.
score index (WMSI) (1).
A full medical history was taken of all patients to
Patients with STEMI who get timely perfusion had
determine their age, gender, and risk factors for
better myocardial survival and LV function. When it
coronary artery disease, such as hypertension, diabetes,
comes to mortality and morbidity following a STEMI,
dyslipidemia, smoking, and the kind and timing of chest
LV function is the most critical factor to consider (2).
discomfort.
The best way to restore blood flow is to do a
Exclusion criteria: Exclusion criteria included the
primary percutaneous coronary intervention (PCI) on
following: Patients with Killip class IV at the time of
all STEMI patients within 120 minutes of their first
presentation, presentation 12 hours after the chest pain
medical contact. If initial PCI is not feasible,
first appeared, renal failure, bleeding disorders, platelet
fibrinolysis should be carried out 30 minutes after
count > 50,000, INR <3, financial problems, patient
arriving at the hospital. When primary PCI is not an
refusal, patients who have had prior PCI or coronary
option, the pharmaco-invasive approach (Between 3
artery
bypass
grafting
(CABG),
insufficient
and 24 hours after taking fibrinolytic medication,
echocardiographic windows, device therapy.
fibrinolysis is followed by optional PCI) offers an
Ethical approval:
interesting alternative (3).
Mansoura University Ethics Board authorized
PCI after effective thrombolysis with Streptokinase
the research. Before being enrolled in the study, each
and primary angioplasty were the subjects of this cross-
subject gave their signed, informed consent and
sectional multicenter observational research.
received all the information they need during the
The purpose of this research was to compare the
investigation. The Declaration of Helsinki, the code
effectiveness of primary PCI versus Streptokinase
of ethics of the World Medical Association, was
based pharmacoinvasive technique in STEMI patients.
followed while conducting this research on humans.
PATIENTS AND METHODS
Clinical examination included: Pressure, pulse,
In this observational cross section study, 100
general assessment, and regional cardiac evaluation
patients with STEMI were enrolled over the course of a
Investigations: 12 lead surface electrocardiography,
year, from November 2020 to November 2021. The
2D conventional echocardiography, 2D speckle
1537
Received: 08/09/2022
Accepted: 11/11/2022
c:\work\Jor\vol901_232
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1542-1557
Studying the Effect of Flavonoids Extracted from Haloxylon salicornium and
Zygophilium coccinium Plants on Burn Healing in Diabetic White Rabbits
Wafaa Abdulmutalib Naji1, 2*, Sabah Hussien Enaya1, Haider Radhi Malih1
1 Department of Biology, College of science, University of Thi-Qar, Thi-Qar, 64001, Iraq.
2 Department of Biology, College of Science, Al Muthanna University, Al Muthanna, Samawah, 66001, Iraq.
*Corresponding authors: Wafaa Abdulmutalib Naji. Mobile: (+4697801012184).
Email: wafaabdu@mu.edu.iq. *ORCID ID: https://orcid.org/0000-0002-8966-4289
ABSTRACT
Background: The use of plant extracts is a successful way to treat many diseases. Desert plants are rich in many antioxidant
compounds, so they have been used since ancient times in folk medicine. The most important of these compounds are
flavonoids that contain in their composition an aromatic ring and an oxidative hydroxyl group, which resists the free radical
compounds formed in affected tissue and neutralize the tissue to reach the state of recovery.
Objectives: The study aims to find an effective treatment to prevent tissue damage in burns or wounds in diabetic patients.
Materials and methods: Two plants were used in this study; Haloxylon salicornicum and Zygophyllum coccineum (after
proving their antioxidant activity by DPPH assay, with different concentrations for both plants). Flavonoids were extracted
from them, and they were used to treat burns in laboratory rabbits with diabetes. The incidence of infection was confirmed
by histological and hematological studies. Then, we studied of the effect of using the treatment on some blood variables,
hormones and antioxidants during the treatment period for the stability of their effectiveness for treatment.
Results: The study proved the effectiveness of these compounds by accelerating the treatment period despite diabetes and
getting fast and effective results.
Conclusion: Flavonoids of H. coccineum and Z. coccineum proved a high effectiveness of treatment compared to
chemotherapy and accelerated the healing period of the wound.
Keywords: Burn, Diabetes mellitus (DM), Flavonoids, Haloxylon salicornium, Zygophilium coccinium.
INTRODUCTION
wound healing to fail. Additionally, people with
Hyperglycemia caused by abnormalities in insulin
uncontrolled diabetes often have peripheral vascular
secretion, action, or both characterizes the group of
disease in their legs due to atherosclerosis, which can
metabolic illnesses known as diabetes. The eyes, kidneys,
eventually result in foot amputation (4).
nerves, heart, and blood arteries are particularly
Diabetes-related burns and wounds are treated
vulnerable to long-term damage, dysfunction, and failure
with a variety of medications, although some of them are
caused by the chronic hyperglycemia of diabetes (1).
ineffective, leading to tissue damage and occasionally
Diabetes symptoms can also show up on the skin. Chronic
severing organs. Therefore, in addition to their
cutaneous infections are caused by the skin receiving
therapeutic effects, medicinal herbs rich in antioxidant
more blood glucose. Pruritus and other signs of skin
active ingredients have been used to neutralize the free
disease are brought on by bacterial and fungal infections,
radicals produced in the injured tissue. Microorganisms in
which are increased by hyperglycemia (HG). Long-term
the damaged area are killed by this substance (3). Any
HG induces an excess of reactive oxygen species (ROS),
plant that has elements that can be used for therapeutic
which causes oxidative stress in DM and is mostly
reasons in one or more of its organs is considered a
associated by a depleted antioxidant defense system (2). As
medicinal plant. Traditional medicine has always
a result, the body's antioxidant defenses can no longer
included plants as a key component because of the
resist the increasing ROS generation. Increased blood
chemicals present in different plant tissues that have
glycolipid and glycoprotein as well as blood pressure
particular physiological effects on humans. There are
levels linked to DM are accompanied by oxidative stress.
several phytochemicals that can be isolated from plants
Enzymes such as glutathione peroxidase, catalase, and
and used as extracts or as pure chemicals possess a
superoxide dismutase are part of the protective
significant potential function in clinical pathology and are
antioxidant system that fight off the negative
useful in the treatment of several disorders (5) .
consequences of oxidative stress (3).
It has been demonstrated that diabetes mellitus (DM)
Inflammation,
proliferation,
angiogenesis,
and platelet dysfunction are both directly correlated with
apoptosis, decreased chemotaxis and matrix formation,
a number of hematological alterations affecting the red
decreased bacterial resistance, and degeneration of the
blood cells (RBCs), white blood cells (WBCs) and
antioxidant protection system are only a few of the many
coagulation factors (6).
mechanisms that contribute to the complicated wound-
Increased levels of triglycerides (TG), total
healing cascade's impairment in DM. Each of these causes
cholesterol and low-density lipoprotein (LDL) as well as
1542
Received: 08/07/2022
Accepted:13/09/2022
Paper 2
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1558-1569
Predictors of Outcome in an Egyptian Pediatric Intensive Care Unit
Ramadan A. Mahmoud, Rania G. Abdelatif, Mohamed A. M. Bakheet, Montaser M. Mohamed
Department of Pediatrics, Faculty of Medicine, Sohag University, Sohag, Egypt
*Corresponding author: Rania G. Abdelatif, Mobile: (+20)1102227494, Email: d.rania.gamal@gmail.com
ABSTRACT
Background: Pediatric intensive care unit (PICU) has improved the outcome of children in developed countries.
However, little is known about the PICU outcomes in resource-limited settings.
Objective: This study was aimed to investigate outcomes predictors at an Egyptian PICU.
Patients and Methods: This prospective study was conducted at PICU of Sohag University Hospital from March
2018 to June 2020. Collected data included patients` demographics, clinical, laboratory parameters, severity of illness
scores, management, and length of stay in days. Main outcomes were PICU mortality and functional status
deterioration (assessed by functional status scale) on discharge and after 6 months. Outcome predictors were evaluated
by multivariable logistic regression analysis.
Results: This study included 451 patients. The median (IQR) age was 7 (3 24) months. Sepsis was the major
diagnosis (60.1%). The PICU mortality rate was 37.9%. Of survivors, 18.9% developed new disability at PICU
discharge. At 6 months only 7.5% had a residual new disability. Multivariable analysis showed that presence of
multiorgan dysfunction (AOR=44.9, 95%CI (15-134.3), p <0.001), acute kidney injury (AOR = 11.6, 95%CI (1.82-
74.2), p = 0.009), need for prolonged intravenous fluid administration (AOR = 1.2, 95%CI (1.1-1.3), p = 0.005),
vasoactive inotropic support on first day of admission(AOR = 1, 95%CI (1-1.1), p = 0.038) and antibiotic escalation
(AOR = 4.6, 95%CI (1.5-14.1), p =0.007) contributed to higher mortality outcome.
Conclusion: It could be concluded that the PICU mortality was high while the rate of developing functional
deterioration was relatively low. Factors related to sepsis-induced organ dysfunction and its treatment were associated
with the poor outcomes.
Keywords: Pediatric intensive care unit, Mortality, Morbidity, Resource-limited settings.
INTRODUCTION
terms of mortality and short term morbidity. The
Children with a range of life-threatening
second objective was to determine the most important
diseases and those needing advanced medical and
predictors of these outcomes. Therefore, the study's
surgical care are treated in the pediatric intensive care
findings would aid in creating preventative and
unit (PICU) [1].
treatment plans for the main avoidable causes of
Its establishment in 1950s in the developed
unfavorable outcomes. Furthermore, our study helps us
world was reflected in a significant reduction in child
gain insight into the current performance of our unit
mortality. Pediatric intensive care services have been
that can be used for future assessment. It can also serve
significantly increased in the poor countries since the
as a benchmark to compare the current performance
start of the new century [2]. Nevertheless, many PICUs
against the results of other PICUs, both within and
in the low-middle income countries (LMICs) lack
outside Egypt.
organizational details [3]. Many units are still deficient
PATIENTS AND METHODS
in properly-trained medical staff, adequate nurse-to-
This single-center prospective observational study
patients ratios, proper tools, monitoring capacity or
included a total of 451 patients who needed admission
ancillary assistance [4]. The lack of published data on
to PICU, attending at Sohag University Hospital,
pediatric critical care in LMICs, notably in Egypt,
Sohag, Egypt. This study was conducted over a period
makes it challenging to change practices and improve
of 28 months from March 2018 to June 2020.
outcomes.
Additionally, the majority of research
Sohag University Hospital is a tertiary care hospital
focusing on predicting mortality and morbidity
that serves Sohag Governorate with about 5 million
outcomes in PICUs are carried out in resource-rich
populations. Our PICU was relaunched in 2014. It
settings and are dependent on clinical and laboratory
provides qualified health services for a large
indicators, which are not easily accessible in resource-
proportion of the population in Southern Egypt as it
poor ones. Moreover, health needs in these settings
also receives referral from other Egyptian
frequently exceed available resources [4, 5]. According
governorates, particularly Qena, Luxor, and Aswan
to a recent WHO report, that if treatment is improved,
Governorates.
the leading causes of fatalities in children under the
Our PICU has two rooms with 10 fully-
age of five in underdeveloped countries might be
equipped beds, including hemodynamic monitors and
avoided and treated [4].
mechanical ventilations. There are portable X-ray and
This study was aimed to delineate the baseline
ultrasound machines. An infection control policy is
patient characteristics, admission pattern, major
available.
treatment protocols and the outcomes of patients
The PICU team consists of residents, fellows,
admitted to the PICU at Sohag University Hospital in
general pediatric specialists; pediatric consultants, and
a handful of senior-level nurses, but there are no
1558
Received: 07/08/2022
Accepted: 06/10/2022
c:\work\Jor\vol901_234
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1570-1578
Study of Validity of O-RADS Ultrasonography in Risk Stratification and
Management of Adnexal Masses
Asmaa Samir Abd Elsamiaa Ahmed*, Hossam Aldin Mansour Abd Alrahman,
Ahmad Abd Elazim Esmaiyl, Mohammad Abd Alkhalik Basha
Department of Diagnostic Radiology, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Asmaa Samir Abd Elsamiaa Ahmed, Mobile: (+20)1281203726,
Email: asmaasamir122015@gmail.com
ABSTRACT
Background: It is important to remember that ovarian cancer is a frequent and potentially fatal disease. For the
purpose of characterizing the imaging properties of adnexal masses, the Ovarian-Adnexal Reporting and Data System
(O-RADS) Committee have been established. Objective: The aim of the current work was to evaluate the validity of
O-RADS to diagnose adnexal masses utilizing pelvic ultrasound.
Subjects and methods: This prospective cohort study included a total of 30 women having at least one adnexal mass
detected by US, recruited from Department of radiodiagnosis, Zagazig University Hospitals.
Results: About 75.8% of the adnexal masses were benign and 24.2% were malignant. The most frequent benign lesion
among patients who had O-RADS 2 or 3 was a hemorrhagic cyst. Only 2 patients with O-RADS 5 had benign lesions
(mucinous cystadenoma and serous cystadenoma), while 5 patients had malignant lesions. Regarding only those
adnexal masses classified as O-RADS 5 to predict adnexal masses malignancy, the O-RADS had a specificity,
sensitivity, PPV, NPV and accuracy of 92%, 62.5%, 71.4%, 88.5%, and 84.8%, respectively. Considering combined
O-RADS 4 and 5 as a malignancy predictor of adnexal masses, the specificity, sensitivity, PPV, NPV, and accuracy
were 72%, 87.5%, 50%, 94.7%, and 75.8%, respectively.
Conclusion: It could be concluded that the U/S O-RADS classification system is a great noninvasive diagnostic tool
for suspected ovarian masses with high sensitivity in differentiating between benign and malignant neoplastic tumors.
Keywords: O-RADS Ultrasonography, Adnexal Masses
INTRODUCTION
For the sake of future research, Timmerman et
Early detection and treatment in high-volume
al.(3) of the European-based International Ovarian
clinics by trained clinicians is known to enhance
Tumor Analysis Group (IOTA) established a set of
survival rates for ovarian cancer, a prevalent and
words, definitions, and measurement procedures in the
deadly disease (1).
year 2000.
Recognizing the nature of adnexal masses is
Under the guidance of the American College of
crucial for providing the best care possible to patients.
Radiology (ACR), the Ovarian-Adnexal Reporting and
Lesions that are benign are better treated with less
Data System (O-RADS) Committee was formed in the
drastic measures. However, when cancer is detected,
summer of 2015 to construct a lexicon that would
patients should be sent to a gynecologic oncologist
allow the development of a practical, universal
because doing so improves outcomes. Maximizing
vocabulary to define adnexal masses' characteristics (4).
long-term survival for women with ovarian cancer
The aim of the current work was to evaluate the validity
while reducing the number of needless operations
of O-RADS to diagnose adnexal masses utilizing
performed on those with a minimal risk of the disease
pelvic ultrasound.
is the ultimate aim. Minimizing surgical morbidity and
SUBJECTS AND METHODS
preserving hormonal competence are important goals
This prospective cohort study included a total of 30
for patients with low risk of cancer (2).
women having at least one adnexal mass detected by
There is growing concern about the lack of
US, recruited from Department of radiodiagnosis,
standardized terminologies in gynecological imaging,
Zagazig University Hospitals.
in particular those pertaining to ovarian pathology (3).
Major discrepancies in interpretations are often the
Inclusion criteria:
result of inconsistencies in the usage of morphologic
1) Women with suspected adnexal mass based on
imaging criteria and descriptors on a global, national,
clinician request.
and even institutional scale. The authors Huang et al.
2) Patients of all age groups.
note that ovarian cancer is a common and deadly
3) Accidentally discovered adnexal masses in non-
disease, but that it can be effectively treated if caught
complaining females.
early and brought to a busy hospital with trained
medical professionals. Correctly characterizing
Exclusion criteria:
adnexal masses is essential for optimal patient
1) Recurrent adnexal masses.
management. Lesions with a high probability of being
2) Patients receive neoadjuvant chemotherapy.
benign require more conservative treatment (4).
3) Patients lost during follow-up.
1570
Received: 5/08/2022
Accepted: 6/10/2022
c:\work\Jor\vol901_235
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1579-1587
Evaluation of Thresholds for White Blood Cell Specific Flags on
Sysmex XN 1000 Hematology Analyzer
Azza S Eldanasoury, Christine H Hakim, Rasha A El-Gamal, Noha H Boshnak*
Clinical Pathology, Faculty of Medicine, Ain Shams University, Cairo, Egypt
Corresponding author: Noha H Boshnak, Tel.: +20 122 293 2829, ORCID: 0000-0003-2787-8908,
E-mail: nhboshnak@hotmail.com
ABSTRACT
Introduction: The Sysmex XN-1000 autoanalyzer is designed to improve the analytical performance for counting
blood cell and abnormal cell flags specificity. Each laboratory has its own decision to change the trigger thresholds for
many of these flags. This would safely decrease the number of unnecessary blood film reviews, reduce the workload,
and improve the turnaround time. Objective: The aim of the current study was to assess the performance of the
thresholds at which Sysmex XN-1000 white blood cell specific flags ("Blast/Abnormal lymphocytes", "Atypical
lymphocytes" "Left Shift", and "Immature granulocytes") are triggered as well as to optimize those trigger thresholds
in order to raise the positive predictive value (PPV) of our system of flags for those specific abnormalities.
Materials and Methods: Microscopic slide review was done for 400 blood samples when one or more of the interest
flags were triggered using the factory default settings.
Results: For all flags ("Blast/Abnormal lymphocytes", "Atypical lymphocyes" "Left Shift", and "Immature
granulocytes"), the sensitivity was excellent (100%, 92.8%, 91%, and 95.8%, respectively) but the specificity was
much less (14.2%, 19.3%, 25% and 1.9%, respectively). A statistical method (Youden Index) was applied for
optimizing the thresholds of the 4 flags aiming at improving their specificity. Statistically speaking, the optimal
thresholds for best efficiency were 290 for the "Blast/Abnormal lymphocytes" flag, 150 for the "Atypical
lymphocytes" flag, 190 for the "Left Shift" flag and 0.42×103/µL for the "Immature granulocytes" flag. Conclusion:
Considering the clinical impact of the abnormalities that are suspected when a flag is activated, it was prudent to
privilege sensitivity over specificity and keep both the "Blast/Abnormal lymphocytes" and the "Immature
granulocytes" flagging thresholds at the factory default settings in order not to miss any cases of clinical importance.
On the other hand, the thresholds of "Atypical lymphocytes" flag can probably be safely raised to 150 and the "Left
Shift" flag to 190, thus reducing the number of unduly triggered samples while maintaining the sensitivity clinically
acceptable.
Keywords: CBC, Flags, Sysmex XN, WBC differential count, Sensitivity, Specificity, Ain Shams University.
INTRODUCTION
our laboratory to improve their positive predictive
One of the most commonly requested blood tests
value (PPV) for specific abnormalities, consequently,
in clinical practice is the complete blood count (CBC)
the number of unnecessary manual differential WBC
[1]. Although it is ideal for each blood count to include
counts is reduced.
a stained blood film examination, unnecessary blood
film reviews expand workload and substantially lower
PATIENTS AND METHODS
laboratory productivity; thus, time- and cost-effective
This study was conducted in the main laboratory
rationalization is required [2].
of the Tertiary Care Ain Shams University Hospitals
A major benefit of improved capabilities and
that serve a significant number of both inpatients and
performance of automated hematology analyzers
outpatients.
recording differential white blood cell (WBC) counts
The study included 400 blood samples from adult
is to decrease the number of blood films requiring
patients. The differential WBC count on the samples
microscopic review [3]. Instrument flags are the factor
was requested by the clinician, and one or more of the
affecting the decision on when to make, stain and
WBC flags were triggered using the factory default
examine a blood film. The majority of automated
settings, then, a blood film was examined. Over the
hematology analyzers are equipped with factory-set or
course of five months, the samples were collected
factory-recommended values for the flagging
(approximately 20 samples from daily work routine).
thresholds. However, laboratories can adjust those
According to laboratory procedure, two mL
thresholds based on their patients' clinical needs and
venous blood samples were obtained using K3 EDTA
clinical staff variables [4]. To balance the threat of
(tripotassium ethylenediaminetetraacetic acid) and
missing pathological cells with laboratory efficiency,
processed within two hours of collection.
cutoffs must be carefully optimized [5].
Automated CBC and differential WBCs count
The objective of the current study was to assess
were performed using the XN-1000 automated
the performance of the factory-set thresholds at which
analyzer (Sysmex, Kobe, Japan). Only the 4 WBC-
Sysmex XN -1000 WBC specific flags are triggered in
specific flags with user-definable thresholds were
relation to the findings of manual WBC differential
studied: (1) Blasts/Abnormal lymphocytes (Blast/Abn
count and -if possible- to optimize those thresholds in
lymph), (2) Atypical lymphocytes (Atypical lymph),
1579
Received:22/08/2022
Accepted:25/10/2022
c:\work\Jor\vol901_236
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1588-1591
Urinary Tract Infection after Surgical Correction of Female
Patients with Congenital Adrenal Hyperplasia
Mohamed Ahmed Ateya 1, Noha Arafa 2, Mona Hassan Hafez2, Hani Morsi1, Ahmed M Shouman1
1 Pediatric Urology Unit, Urology department, 2The Diabetes Endocrine and Metabolism Pediatric Unit,
Children's Hospital, Cairo University, Cairo, Egypt
Contribution of authors: Mohamed Ahmed Ateya, Email address: dr.mohamedateya@kasralainy.edu.eg.
Mobile Phone: 01003799533
ABSTRACT
Background: Congenital adrenal hyperplasia (CAH) is the most common cause of virilized females with disorders of
sexual differentiation (DSD) with46XX karyotype.
Objective: To prospectively investigate the correlation between surgical correction using single surgical technique
(partial urogenital sinus mobilization) and the occurrence of urinary tract infection in female patients with congenital
adrenal hyperplasia (CAH). Methods: Our study included 27 CAH female patients who follow up in urology and
endocrinology clinic in Cairo university hospitals. We prospectively followed the patients over a period of 4 years.
Prader grade of virilization of the patients ranged from II to V. Before surgical correction patients were assessed by
filling questionnaire by their parents, doing urine analysis and urine culture. Postoperative assessment by same tools
was done after one month, then every three months. Follow up period extended from 26 to 42 months. Results: Two
patients were classified as Prader type two (7.4%), ten patients as Prader type III (37.1 %), thirteen patients as Prader
type IV (48.1%) and two patients as Prader type V (7.4%). All patients were well controlled before surgery with
preoperative 17- OH progesterone ranging from 0.16 to 6 ng/dl (Mean ±SD: 1.532 ±1.77). All patients had negative
preoperative urine cultures for infection .Postoperative urine analysis and cultures were positive for infection in seven
patients (25.9%) after one month of surgery.
Conclusions: Long term urinary tract infection rates don't increase after surgical reconstruction of female patients with
partial urogenital sinus mobilization even If early postoperative urinary tract infection rates were high.
Keywords: partial urogenital sinus mobilization, CAH, urinary complications, UTI.
INTRODUCTION
the pubourethral ligaments raises the concerns about
Congenital adrenal hyperplasia (CAH) is the most
urological outcome and possibility of increasing rate of
common cause of virilized females with 46XX DSD (1).
incontinence and urinary tract infection (3).
Despite it is a rare disease, but we have a good flow
A modification of the technique has been made in
of patients from all over Egypt as our center in Cairo
the form of Partial urogenital sinus mobilization with
university hospitals is a referral center which enabled us
limited division of the pubourethral ligaments with
to have a sufficient number of cases for our prospective
theoretical preservation of continence and decreasing
study. In the past before the era of corticosteroids, most
urinary tract infections (4).
of these patients used to die from sever corticosteroid
However
postoperative
urinary
outcomes
deficiency early in their lives, but after the discovery of
including urinary tract infection are not well studied and
cortisone therapy most of them experience normal life
whether changing the anatomical distribution of the
as long as their endocrinal profile is under control.
introitus in the direction of feminizing genitoplasty has
This leads to facing the fact that these children
an effect on urinary tract infection rate or not. Here, we
will need genital reconstruction for better cosmetic and
present our center experience with partial urogenital
functional outcome. Many factors affect linear growth
sinus mobilization and its effect on postoperative
in children with CAH. In order to restore normal adult
occurrence of urinary tract infections.
final height patients should be appropriately controlled
PATIENTS AND METHODS
clinically and biochemically and adherence to medicinal
Type and setting of the study
therapy as well as continued clinical and laboratory
This prospective study included 27 CAH female
surveillance (2).
patients were followed up in urology and endocrinology
Many surgical techniques have evolved over years
clinic in Cairo university hospitals over a period of 4
to fulfill these goals; however, every technique has its
years.
own advantages and disadvantages. The introduction of
Patient Population
the concept of urogenital sinus mobilization without
All patients included were toilet trained above the
separating the urethra from the vagina has a great impact
age of three years. Patients with any urological problem
on surgical outcome. Urogenital sinus mobilization has
like recurrent urinary tract infections, incontinence,
successfully mobilized the urethra and the vagina to the
urinary stones, neurological disorders, voiding
perineum without tension and without circumferential
dysfunction or other urinary tract anomalies were
dissection of the vagina with little affection on vaginal
excluded. Any previously operated patients were
vasculature which is reflected on the results and
excluded from the study and only patients who were
decreasing rate of complications, however division of
first time to operate were included. Any case of
1588
Received: 10/09/2022
Accepted: 12/11/2022
c:\work\Jor\vol901_237
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1592-1596
Quantitative Stool Culture of Candida in Egyptian Children with
Autism Spectrum Disorder
Rania M. Abd El Halim1, Malaka Z. Amer1, Ghada Elsayed Salem1,
Dalia Hosni Abdelhamid1, Reham M. El Hossiny*2
Departments of 1Clinical pathology and 2Department of Pediatrics, Faculty of Medicine, Ain Shams University, Egypt
*Corresponding author: Reham Elhossiny, Mobile: 01001506555; Email: r-elhossiny@hotmail.com
ABSTRACT
Background: A group of neurodevelopmental diseases known as autism spectrum disorder (ASD) is characterized by
difficulties with social interaction and communication as well as limited or repetitive activities.
Objective: To estimate the quantity of Candida in stool of autism spectrum disorder (ASD) patients compared to
normal children and to find the association between Candida colony count and severity of ASD.
Patients and Methods: The study involved 40 children with autism and 40 typically developing children who were
recruited from the pediatrics and adolescent psychiatric clinic at the pediatric hospitals of Ain Shams University. The
research included participants who ranged in age from 3 to 14 years, (mean age of 6.30±2.40 years). Stool sample was
collected from each patient in a sterile container, cultured on Sabouraud Dextrose Agar (SDA) and colony count was
determined. Identification of isolated Candida species was done using chromogenic media.
Results: The study revealed statistically significant difference in Candida isolation rate among patient and control
group with p-value (p=0.006). Candida species were isolated from 23 patients (57.5%) and from 10 children in control
group (25%), but there was statistical insignificant difference in Candida colony count between severe autistic group
compared to mild to moderate autistic group. There were 14 patients (60.9%) with C. Albicans; 2 patients (8.7%) C.
Glabrata; 6 patients (26.1%) C. Krusei and one patient (4.3%) C. Utilis.
Conclusion: Children with ASD had increased rates of intestinal Candida species colonization, which may be a
symptom of a condition associated to immune system abnormalities that may contribute to the etiology of ASD. In
ASD, C. albicans was the most common isolate.
Keywords: Quantitative Stool Culture, Candida, Autism Spectrum Disorder.
INTRODUCTION
A variety of neurodevelopmental diseases
A fungus that resembles yeast called Candida
collectively known as autism spectrum disorder (ASD)
albicans lives in practically every human. It feeds on the
are largely distinguished by difficulty in social
dark, wet mucous membranes that border the digestive
interactions, verbal and nonverbal communication, and
system, vagina, and mouth. It can be found in little
stereotypical or repetitive behaviors (1).
colonies. Candida albicans can infect people, especially
The etiological pathway and pathogenesis of
those with weak immune systems (5).
ASD is still controversial. However, maternal infection
C. albicans generates ammonia (NH3) as a
during pregnancy, maternal obesity and diabetes,
metabolite, which has been believed to be associated
excessive early childhood vaccination, heavy metal
with autism when present in excess. Propionic acid
toxicity, severe infection in the first 2 years of life,
might be converted to beta-alanine, which shares
involvement of bacteria, viruses and fungi, long-term
structural
similarities
with
the
inhibitory
exposure to antibiotics in early life [intestinal microbial
neurotransmitter GABA (gamma, aminobutyric acid), in
dysbiosis, gastrointestinal (GI) problems; leaky gut
the presence of ammonia metabolites in the
syndrome;
allergies,
immune
dysfunction,
gastrointestinal system. It is a neurotransmitter found in
neuroinflammation, developmental abnormalities of the
the mammalian central nervous system. Its main
nervous system, neurotransmitter imbalances (serotonin,
functions include controlling muscle tone by inhibiting
dopamine,
-aminobutyric
acid
(GABA),
receptors and lowering neuronal excitability throughout
noradrenaline), and metabolic factors deficiency.
the nervous system (6). Children with suspected or
Autism development may be also influenced by
identified ASD have had several Candida species
oxidative stress, environmental variables, and
isolated from their feces (7).
genetics(2).
Aim of the work was to estimate the quantity of
Children with ASD have been found to have a
Candida in stool of autism spectrum disorder (ASD)
high prevalence of gastrointestinal discomfort,
patients compared to normal children and to find the
including bloating, diarrhea, constipation, and
association between Candida colony count and severity
abdominal pain, suggesting that the gut microbiota may
of ASD.
play a role in the pathogenesis of gastrointestinal
symptoms associated with ASD (3). The so-called
PATIENTS AND METHODS
"microbiome-gut-brain axis" is a significant relationship
The study involved 40 children, diagnosed as
between the CNS and the gut microbiota (4).
autism spectrum disorder; all of them fulfilled DSM -V
1592
Received: 02/07/2022
Accepted: 08/09/2022
c:\work\Jor\vol901_238
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1597-1603
Study of Serum and Ascitic Fluid Lipopolysaccharide Binding Protein as
Potential Markers of Infection in Spontaneous Bacterial Peritonitis
Neveen George El-Antouny1, Ahmed Abdul Naby Al-Sayed*1,
Ahmed Abdul-Saboor Mohammed2,Heba Shafeak Abd elkhalik1
Departments of 1Internal Medicine and 2Clinical Pathology, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Ahmed Abdul Naby Al-Sayed, Mobile: (+20)1150529560, E-Mail: ahmedalfady1990@gmail.com
ABSTRACT
Background: Hemodynamic instability in cirrhotic individuals and the onset of bacterial infection are both linked to
elevated levels of Lipopolysaccharide binding protein (LBP).
Objective: The aim of the current work was to evaluate the significance of lipopolysaccharide binding protein (LBP)
level in serum and ascitic fluid in spontaneous bacterial peritonitis (SBP) patients as a marker for infection.
Patients and Methods:A total of 112 patients were enrolled in this case control study and were split into two categories:
Group (A):consisted of 56 individuals with chronic liver disease (CLD) having ascites exacerbated by spontaneous
bacterial peritonitis (SBP) through clinical and laboratory examinations. Group (B): consisted of 56 individuals with
chronic liver disease (CLD) and ascites who had no detectable infection based on clinical and laboratory tests.
Results: In group A; significant positive correlations were found between serum LBP, HB, and total protein. Also, a
negative remarkable correlation between serum LBP, INR, PTT, PT, serum creatinine, direct bilirubin, total bilirubin,
PLT, and ascitic fluid LBP. In group (B);significant positive correlations were found between serum LBP, AST, and
TLC. Also, a negative remarkable correlation between serum LBP, PTT, serum urea, serum creatinine, and total
bilirubin.
Conclusion: It could be concluded that serum LBP demonstrated a highly significant difference between the two groups
with a substantial difference as regard the diagnosis of spontaneous bacterial peritonitis, both in terms of sensitivity and
specificity. Serum LBP may be considered as a diagnostic tool for SBP in cirrhotic patients with ascites.
Keywords: Lipopolysaccharide Binding Protein, Spontaneous Bacterial Peritonitis.
INTRODUCTION
molecule CD14 and the Toll-like receptor 4, triggering
Ascitic fluid becomes infected with bacteria
a cascade that results in cytokine production and an
(often a single species) when there is no clear indication
inflammatory response(4).
of a peritoneal or other tissue source for the sepsis that
The concentration of lipopolysaccharide binding
results in peritonitis (also known as "spontaneous
protein (LBP) is thought to reflect chronic contact with
bacterial peritonitis" or "SBP"). Patients with cirrhosis
bacteria and endotoxins. Patients with cirrhosis and
are more likely to get SBP than urinary tract infections
ascites who have elevated levels of lipopolysaccharide
(UTIs), pneumonias, skin/soft tissue infections, or
binding protein (LBP) are at increased risk for
septicemia (1).
developing life-threatening bacterial infections. The
Diagnostic testing of ascitic fluid (AF) taken
concentration of LBP in the peripheral blood has been
during abdominal paracentesis is used to identify cases
utilized as a proxy for bacterial translocation. After an
of spontaneous bacterial peritonitis (SBP). Due to its
episode of bacteriemia, serum LBP levels remain
great sensitivity, the polymorphonuclear leucocytic
elevated for an extended period of time and can be used
(PMNLs) count of 250 cells/mm3 has long been used as
as a reliable diagnostic for the diagnosis of bacterial
the gold standard for SBP diagnosis. Translocation of
translocation (BT)(5).
bacteria seems to be the primary mechanism behind
Hemodynamic instability and the onset of
spontaneous bacterial peritonitis (SBP) (2).
bacterial infection are both linked to elevated LBP
This process, known as bacterial translocation
levels in cirrhotic patients. In liver cirrhosis, LBP
(BT), involves the movement of bacteria or bacterial
remains a viable surrogate measure of BT. Patients who
endotoxins over the intestinal mucosa and into the
are free of infection at baseline but are at high risk for
mesenteric lymph nodes and other extra intestinal
developing an infection during follow-up could be
locations. Patients with cirrhosis have an increased risk
identified using LBP levels as a surrogate measure(6).
of death due to infections. Many researchers believe that
This study was aimed to evaluate the
bacterial translocation is the basic mechanism
significance of lipopolysaccharide binding protein
connected to infection development in cirrhosis. Serum
(LBP) level in serum and ascitic fluid in spontaneous
LPS (Lipopolysaccharide) -LBP complex levels may
bacterial peritonitis (SBP) patients as a marker for
rise in individuals with Spontaneous bacterial
infection.
peritonitis because bacterial endotoxins stimulate LBP
PATIENTS AND METHODS
production (3).
This case control study included a total of 112 chronic
Hepatocytes secrete a soluble acute phase
liver disease (CLD) patients, attending at Out-Patient
protein called lipopolysaccharide-binding protein
Clinics, Department of Internal Medicine, Zagazig
(LBP), which aids in the binding of bacterial
University, during the period from January 2022 to
lipopolysaccharide (LPS) to the cell membrane
August 2022. Research laboratory and immunology
1597
Received:22/08/2022
Accepted:25/10/2022
c:\work\Jor\vol901_239
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1604-1610
Modification of The Round Block Technique in The Management of
Early Stages of Breast Cancer: A Randomized Controlled Clinical Trial for
The Assessment of Oncological Safety and Cosmetic Outcomes
Sherief M. Mohsen*, Hossam Attia AboElazm, Mohamed El Azazy
Department of General Surgery, Faculty of Medicine, Ain Shams University, Egypt
*Corresponding author: Sherief M. Mohsen, Mobile: (+20) 01001662303,
ORCID: 0000-0003-0402-8548, E-Mail: Dr.sheriefmohsen@outlook.com
ABSTRACT
Background: The round block technique (RBT) is an oncoplastic technique used in the excision of peri-areolar breast
lesions especially in small to medium-sized breasts with moderate ptosis. Objective: Our study aims to introduce the
technique of modified round block technique (MRBT) and to compare RBT and MRBT in peripherally located tumors
as regards the oncological safety and cosmetic outcomes.
Patients and methods: From October 2018 to October 2021, a randomized controlled clinical trial was conducted on
40 female patients with early stages of breast cancer. Patients selected had tumors at least 2 cm away from the nipple-
areola complex (NAC) and an expected excision volume not exceeding 20% of the breast volume. Patients' demographic
data and tumor characteristics were recorded and analyzed. Results: The MRBT group has a significantly shorter
operative time (P-value 0.016). Positive margin involvement was recorded in 2 cases requiring re-excision in the RBT
group. Six patients developed seroma formation which was significantly higher in the MRBT group (P-value 0.048). A
significantly lower mean change in areolar diameter was observed in the MRBT group (P-value 0.032). Two cases
developed local recurrence, one in each group. No cases of distant metastasis were encountered during the follow-up.
MRBT group has a significantly higher cosmetic outcome than RBT (P-value 0.03). Conclusion: The MRBT is an
oncoplastic technique suitable for the excision of breast tumors in different breast quadrants especially peripherally
located tumors in patients with small to medium-sized breasts and when the excision volume is not exceeding 20% of
the breast volume.
Keywords: Breast conservation, Oncoplastic, Round block technique.
INTRODUCTION
tumors and increasing the safety margin without an
Breast malignancy is now considered the most
impact on the aesthetic outcomes; Eventually
prevalent site--specific malignancy in females and the
improving the psychological impact on the patients
major cause of death related to cancer in women
following mastectomy and aesthetically unacceptable
between in the age of 20 to 60 years (1).
deformities of breast-conserving surgery (4,5).
The principles of breast cancer surgery have
The round block technique (RBT) is an oncoplastic
evolved over the last few decades with a shift from a
technique used in the excision of peri-areolar breast
modified radical mastectomy (MRM) to wide local
lesions especially in small to medium-sized breasts with
excision (WLE) and adjuvant radiotherapy. This shift is
moderate ptosis (6).
primarily because of the advancements in
The aim of our study is to introduce the technique
understanding the pathology and biology of breast
of modified round block technique (MRBT) and to
cancer. The multi-modality in the therapies to combine
compare RBT and MRBT in peripherally located
local and systemic control, comprising breast-
tumors as regards the oncological safety and cosmetic
conserving surgery and radiotherapy, endocrine
outcomes.
treatment, and chemotherapy, has led to a decrease in
the postoperative morbidities without affection of the
PATIENTS AND METHODS
oncological results. Hence, the breast-conserving
From October 2018 to October 2021, a
therapy (BCT), comprising wide local excision and
randomized controlled clinical trial was conducted on
axillary surgery (either sentinel lymph node biopsy
40 female patients with early stages of breast cancer
(SLNB) or axillary LN clearance, followed by
(T1, T2 / N0, N1 / M0) in the Breast Unit in the Faculty
radiotherapy, is now the standard treatment of choice in
of Medicine, Ain Shams University.
patients with early stages of breast cancer (2,3).
Patients selected had tumors at least 2 cm away
It is worth mentioning that the introduction of
from the nipple-areola complex and an expected
neoadjuvant chemotherapy for patients with locally
excision volume not exceeding 30% of the breast
advanced breast cancer can aid in the reduction of the
volume. Patients with locally advanced breast cancer or
tumor size, rendering inoperable tumors operable. In
retro areolar breast cancer were excluded from the
addition, this expands the role of breast-conserving
study. Also, patients with any contraindication to chest
surgery in the management of such cancers. The
radiotherapy were excluded from the study.
concept of oncoplastic breast surgery has been recently
The patients were randomized into 2 groups: The
introduced. It incorporates plastic surgery techniques in
first group (Group A) comprising 24 cases to perform
the field of breast surgery allowing larger excisions of
RBT, and the second group (Group B) comprising 16
1604
Received: 12/08/2022
Accepted: 15/10/2022
c:\work\Jor\vol901_240
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1611-1616
Diagnostic Value of Interleukin 1 Receptor Antagonist (IL-1RA) in
Children with Refractory Epilepsy
1 Rhoyda Essam Moustafa Atteq, 1 Ahmed Galal Siam,
2 Doaa Metwaly AbdElmonem, 1 Amr I.Risha
1 Pediatrics department, Faculty of Medicine, Zagazig University, Egypt
2 Clinical pathology department, Faculty of Medicine, Zagazig University, Egypt
Corresponding author: Rhoyda Essam Moustafa Atteq, Email: rhoydaatik@gmail.com, Mobile: 01006444259
ABSTRACT
Background: Clinical studies have shown that prolonged seizures result in increased cytokine production in the central
nervous system. Aim of work: To focus on diagnostic value of interleukin-1 receptor antagonists in refractory epilepsy.
Patients and methods: This case-control investigation was done in Pediatric Neurology Unit and Pediatric Neurology
Clinics, Faculty of Medicine, Zagazig University. Children were classified into: patient group: 59 children with refractory
epilepsy aged between 1 year and 16 years old and control group: 59 healthy children who are age and sex corresponded to
the patient population. Serum level of IL-1Ra was assessed. Results: There is significant higher value of plasma of
interleukin1 receptor antagonist in studied refractory epilepsy group compared to the healthy control group.
Conclusion: Interleukin-1 receptor antagonist can differentiate the control group and the seizure group.
Keywords: IL-1RA, Refractory Epilepsy, diagnosis.
INTRODUCTION
Epilepsy is a chronic disease of the brain
(IL-1Ra), they all attach to the IL-1 receptor. IL-1 is
characterized by an enduring (i.e., persisting)
primarily membrane-bound, whereas IL-1 is primarily
predisposition to generate seizures and by the
secreted. Interleukin-1beta (IL-1) while interleukin-1
neurobiologic, cognitive, psychological, and social
receptor antagonist (IL-1Ra) is anticonvulsant and
consequences of seizure recurrences )1(.
neuroprotective, appears to be proconvulsant and
Despite receiving competent medical care, more
neurotoxic. )11(. Based on epileptogenic foci surgically
than 30% of all people with epilepsy experience
excised from DRE patients, the IL-1 signaling pathway
uncontrolled seizures or adverse effects from
has been linked to the development of human epilepsy )12,
medication.)2(. A condition known as refractory epilepsy
13(. Recent research has shown a connection between IL-
is one where at least two antiepileptic drugs have not been
1 and IL-1R1 levels and epilepsy severity. )14-16(.
able to prevent seizures. )3(. According to some sources, it
We therefore sought to focus on diagnostic value
raises the chance of damage, which then raises the
of interleukin-1 receptor antagonists in refractory
likelihood of dying, as well as the possibility of cognitive
epilepsy.
and psychological problems. )4(.
It is the immune system's intended to defend the
PATIENTS AND METHODS
host from threats that can come from both the outside
This Case-control study was done in Pediatric
(such as bacteria and viruses) and the inside (such as
Neurology Unit and Pediatric Neurology Clinics, Faculty
malignant transformation). )5(.In general, cytokines are
of Medicine, Zagazig University.
created and released in response to antigenic stimuli.
Recently, it has been discovered that patients with
Population:
seizures exhibit aberrant cytokine and immune cell
Children attending at pediatric inpatient and outpatient
expression. Numerous studies have demonstrated that the
clinic were classified into:
immune system controls the synthesis and release of
Patient group: 59 Children with refractory
cytokines, and that by acting as seizure mediators, these
epilepsy diagnosed as having at least two
cytokines can worsen brain damage.)6,7(.
effective antiepileptic medications without
Cytokines are soluble, powerful glycoproteins
success, and the patients are taking their
that play a role in the control of growth, activation of
antiepileptic medications as prescribed. They
immune cells, and inflammatory and immunological
aged between 1 year and 16 years old.
responses. The glial cells in the CNS secrete them.
Control group: 59 Healthy children who are age
Experimental research has demonstrated that epileptic
and sex matched with the patient group.
seizures are associated with an increased generation of
Inclusion criteria:
inflammatory cytokines. In this context, interleukin-1 (IL-
Both sexes were included
1) cytokines are given a lot of attention.)8-10(.
Patients diagnosed as having refractory epilepsy
The IL-1 cytokine family consists of IL-1 alpha
when at least two antiepileptic drugs that are
(IL-1), IL-1 beta (IL1) and IL-1 receptor antagonist
efficient have not been able to manage seizures,
1611
Received: 22/08/2022
Accepted: 25/10/2022
c:\work\Jor\vol901_241
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1617-1623
Airway Management in Morbidly Obese Patients: A Comparison of
Intubating Laryngeal Mask Airway-FastrackTM and Air-QTM Intubating
Laryngeal Airway as A Conduit for Bronchoscopic Tracheal Intubation
Heba M. Elassar, Khadeja M. Elhossieny, Amani A Aly*
Department of Anesthesia and Surgical Intensive Care, Faculty of Medicine, Zagazig University, Sharkia, Egypt
*Corresponding author: Amani A Aly, Email:dola.salah2009@gmail.com, Mobile: 01287220016
ABSTRACT
Background: It can be difficult for anesthesiologists to manage the airway of morbidly obese patients. Devices like the
intubating laryngeal mask airway (ILMA) -FastTrachTM) and Air-QTM were specially designed to make tracheal intubation
easier while ensuring ventilation and oxygenation. This study compared the efficiency of these two supraglottic airway
devices (SAD) for fiberoptic intubation in adult morbidly obese patients.
Methods: Eighty morbidly obese (BMI>40 kg/m2) patients planned for elective surgery requiring tracheal intubation and
general anesthesia participated in the study. Patients were allocated to the ILMA group or the Air-Q group. A fiberoptic
bronchoscope was used to intubate the trachea through the SAD. The primary endpoint was the time to intubate the trachea.
The time to insert the SAD, the insertion success rate of the SAD and tracheal tube, the laryngeal view, and any adverse
events related to the procedure, were the secondary outcomes.
Results: The mean tracheal intubation time was shorter through the Air-QTM compared to the ILMA-FastrachTM (41.4 ±6.1
s vs 76.22 ±10.2 s, P< 0.001). The mean insertion time of the Air-QTM was significantly shorter than that of the ILMA-
FastrachTM (18.9 ±0.7 s vs 25.1 ±1.3 s, P < 0.001), The Air-Q had a significantly better success rate for tracheal tube insertion
on the first attempt, but the overall intubation success rate was comparable for both devices. Conclusion: Air-QTM was
associated with a shorter time of device insertion and fiberoptic intubation, and a higher first-attempt insertion success rate
of the tracheal tube than ILMA-FastrachTM.
Keywords: Morbid Obesity, ILMA, Air Q, Fiberoptic Bronchoscopy.
INTRODUCTION
Morbid obesity which is defined as BMI 40 kg/m2
tracheal intubation while maintaining ventilation and
is rising globally which makes it necessary for
oxygenation which is crucial in morbidly obese patients
anesthesiologists to recognize the crucial anatomical and
as they have a short safe apnea period (time from apnea
physiologic abnormalities that characterize these
due to muscle paralysis until oxygen saturation decreases
individuals (1).
to a potentially fatal level) compared to normal weight (1,
It is more difficult to intubate the tracheas of
6).
morbidly obese patients who may have obstructive sleep
Although ILMA-Fastrach was considered the
apnea, a high Mallampati class (III or IV), or a large neck
standard SAD for tracheal intubation., The Air-Q is
circumference (2). When managing those patients, minutes
provided in adult and pediatric sizes, in both single-use
or even seconds matter. Since they are liable to rapid
and reusable versions, and it has some potential features
oxygen desaturation, which establishes a central point in
to facilitate blind as well as bronchoscopic guided
morbidity and mortality identified with anesthesia. For
tracheal intubation. Among the possible advantages of
this reason, the anesthesiologist must always be ready to
Air-Q are the device's small and wide tube, the lack of an
address airway issues among those patients (3).
epiglottis elevator, and the easily removable proximal
Supraglottic airway devices have not only been a vital
connector. Moreover, a regular PVC tube can be used to
component of patient airway management, but also a
intubate the trachea through it (7).
potentially lifesaving tool included in most airway
According to our best knowledge, this was the first
management algorithms (4).
randomized, controlled interventional trial evaluating the
The Difficult Airway Society's guidelines
effectiveness of fiber-optic intubation in adult morbidly
described fiberoptic guided tracheal intubation through
obese patients through two commonly used SAD devices,
SAD in Plan B for the management of unpredicted
the ILMA-Fastrach and the Air-Q.
difficult intubation. However, it can also be utilized to
We, therefore, conducted prospective, randomized
control a predicted difficult airway. The success in
research to compare fiber-optic guided tracheal intubation
tracheal intubation through SAD is influenced by which
through these two SADs in adult morbidly obese.
device is used to manage a challenging airway (5).
We hypothesized that the Air-Q would provide
Devices, like (ILMA -Fastrach) and intubating the
shorter fiber-optic guided tracheal intubation time and a
laryngeal airway with Air-Q, can be used to facilitate
higher intubation success rate than the ILMA.
1617
Received: 22/08/2022
Accepted: 25/10/2022
c:\work\Jor\vol901_242
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1624-1628
Outcome of Microscopic Unilateral Laminotomy for Bilateral
Decompression of Acquired Lumbar Spinal Stenosis
Essam Mohamed Youssef, Adel Saad Ismaeil, Ahmed Mohammed Elawamry, Jalal Mahmoud Swayeb*
Department of Neurosurgery, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Jalal Mahmoud Swayeb, Mobile: (+20) 01271010598, E-mail: jalalswayeb@gmail.com
ABSTRACT
Background: Degenerative lumbar spinal stenosis (LSS) remains one of the most common indications for lumbar spine
surgery in elderly patients. Aim of the study: to assess the results of a minimally invasive bilateral decompression surgery
with a unilateral laminectomy (ULBD).
Patients and methods: an upcoming clinical trial investigation was conducted at the Neurosurgery Department of Zagazig
University hospital during the period from November 2021 to August 2022. 24 patients were included in our study.
Demographic, Clinical outcomes were assessed, both before and after surgery, The Visual Analogue Scale was used to rate
leg and low back discomfort (VAS). Before and after surgery, disability was assessed using the Oswestry Disability Index
(ODI) 3 months postoperatively. Pre- and postoperative measurements of the size of the spinal canal and the approximate
cross-sectional area (CSA) of the dural sac were made.
Results: VAS for low back pain (LBP) improved from 6.83 ± 2.65 to 1.79 ± 0.70, while VAS for leg pain improved from
6.54 ± 3.04 to 1.87 ± 0.59. ODI significantly decreased from 57 ± 6.75 % to 18.58 ± 5.01 %. A-P diameter increased from
9.12 ± 0.46 to 13.60 ± 0.61 mm, while. ADSCSA of the stenotic levels increased from 90.67 ± 4.32 to 167.37 ± 26.74 mm2.
Conclusion: ULBD techniques is effective and safe procedure for LSS treatment, with good postoperative outcome.
Keywords: Laminectomy, Laminotomy, Lumbar spinal stenosis.
INTRODUCTION
fails, whether there is or is not a neurological deficiency,
Spinal stenosis in the lower back (LSS) refers to
surgery is recommended (motor or sphincteric).
the lumbar spinal canal's anatomical constriction and is
In order to without first releasing the imprisoned
linked to a variety of clinical problems. According to
neuronal components compromising the integrity of the
reports, there are five incidences of LSS per 100,000
afflicted segment, surgery is used to treat bilateral sciatica
people per year. Neurogenic claudication, which is caused
in LSS (5).
by localized bony and/or discoligamentous constriction of
The procedure known as laminectomy is
the spinal canal, is the defining sign of LSS (1).
frequently done to treat lumbar spinal stenosis. The main
One cause of LSS is disc degeneration, which
issues with this operation are the deterioration of the
causes the canal to shrink ventrally and, as a result, the
ligaments and bones in the spine, along with instability
neural foramen and lateral recess to narrow as well. The
and peridural scar development. Numerous techniques,
facet joints are put under more load as a result of increased
including
unilateral
laminotomies,
bilateral
segmental motion caused by ligamentous laxity, which is
laminotomies, and open-door laminoplasty, have been
biomechanically affected. This subclinical instability
proposed to address these serious drawbacks. However,
causes osseous hypertrophy in the bone structures, which
because of the complexity of these treatments and a lack
manifests as facet joint hypertrophy. The ligamentum
of follow-up information regarding postoperative
flavum folds inwards due to height reduction and exhibits
stability, they have never really taken off (4, 8). This study's
fibrotic hypertrophy. Last but not least, disc degradation
goal was to evaluate the efficiency of unilateral minimally
and the apparent instability of spondylolisthesis may be
invasive
surgery
laminectomy
for
bilateral
brought on by laxity of ligaments and capsules even while
decompression (ULBD).
these reactive processes fail to stabilize the segment (1, 2)
The location of the spine has an impact on the
PATIENTS AND METHODS
nerve root compression caused by these pathoanatomical
The research was done at Zagazig's Neurosurgery
modifications. The neural foramina, central canal, or
Department. University hospital during the month of
lateral recess are three separate anatomic sites where
November until 2021 to August 2022. This prospective
narrowing can be precisely defined (3- 7).
clinical trial study was conducted on 24 patients to treat
The advancement of magnetic resonance imaging
acquired lumbar spinal stenosis bilaterally. The research
and the growing understanding of pathoanatomy have
was undertaken after gaining the ethical approval of
combined to allow for a more precise distinction between
Zagazig University/College of Medicine. Written
the diseases of bone and soft tissue stenosis including
informed consent of all the participants was obtained. The
their types and the degree of the stenosis(6). When
study protocol conformed to the Helsinki Declaration, the
medically conservative treatment for LSS decompression
1624
Received: 07/09/2022
Accepted: 10/11/2022
c:\work\Jor\vol901_243
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1629-1632
Carbapenem Resistance Related with Phenazine Genes in Clinical
Pseudomonas aeruginosa Isolates
Tiba A. Al-Mohammed1, Huda. M. Mahmood2
1 Department of Biology, College of Science, University of Anbar, Anbar, Iraq.
2 Department of Biotechnology, College of Science, University of Anbar, Anbar, Iraq.
Corresponding Author: Huda. M. Mahmood, Email: huda.mahmood@uoanbar.edu.iq, Mobile: 07740497788
ABSTRACT
Background: Pseudomonas aeruginosa is a commonly known opportunistic bacteria that can produce a wide range of
biologically active compounds. The ability of certain strains to generate extra pigments such as yellow pyoverdin, dark
red pyorubin, and pyomelanin (dark black), as well as the two primary dyes, were pyocyanin (blue-green) and
fluorescein (yellow-green). Aims: To investigate the frequency of some virulence factors genes (phz M, phz S ), of
carbapenem resistance P. aeruginosa local isolates.
Methods: Clinical samples were taken from wounds, burns, urine, nose, and ear swabs, and 110 isolates of
Pseudomonas aeruginosa were obtained from two hundred and ten samples gathered from affected patients, and
diffusion method was utilized to assess the resistance of the bacterial isolates. Also was used molecular detection of (
Phz M, Phz S) genes by using PCR technique. Results: Most of the isolates (40) % were found in burn samples whereas
in wounds samples (16.3)%, urine (23.7)%, and ear swabs (20)%. In the present study, a prevalent large percentage of
P. aeruginosa isolates exhibited high levels of resistance to meropenem (20)% and the lowest level to Imipenem (5.5)%.
Molecular analysis showed the phz M and phz S genes identified in all of the carbapenem resistance P.aeruginosa.
Conclusions: Large percentage of P. aeruginosa isolates exhibited high levels of resistance to meropenem (20%) and
the lowest percentage to Imipenem (5.5%). The results showed that all isolates have phenazine genes (Phz S, Phz M).
Keywords: Carbapenem Resistance, Genotype Distribution, Phenazine Pigments, Pseudomonas aeruginosa.
INTRODUCTION
METHODS
Pseudomonas aeruginosa is a commonly known
Sample collection and isolation protocol :
opportunistic bacteria that can produce a wide range of
Clinical samples were taken from wounds, burns,
biologically active compounds. Certain strains can be
urine, nose, and ear swabs, and 110 isolates of
able to generate extra pigments such as yellow
Pseudomonas aeruginosa were obtained from two
pyoverdin, dark red pyorubin, and pyomelanin (dark
hundred and ten samples gathered from affected
black), as well as the two primary dyes were pyocyanin
patients from National Center for Educational
(blue-green) and fluorescein (yellow-green) (1).
Laboratories Specialized Burns Hospital, Al-Ramadi
Pseudomonas aeruginosa produces significantly many
Teaching Hospital, during the period from November
compounds which support their pathogenicity,
2021 to February 2022. Microscopical, biochemical,
phenazine is this one class of compound, with
and cultural characteristics are used to identify and
pyocyanin, the molecule produced from the substrate
classify Pseudomonas aeruginosa.
shikimic acid (2).
The creation of blue pus is one of the most
Antimicrobial susceptibility test :
focused keys of essential infections caused by this
Diffusion method was utilized to assess the
bacteria (3). Strains that are unable to produce pyocyanin
resistance of the bacterial isolates according to CLSI-
are less pathogenic and more susceptible to the immune
2021): A few colonies (2-4) were added in (2 ml) brain-
system response (4). The phz gene operons produce
heart broth and cultured to obtain a bacterial suspension
phenazine-1-carboxylate (PCA) and two particular
with a McFarland turbidity, A cotton swab was used to
genes, phz M and phz S, that produce pyocyanin(5).
culturing the bacterial suspension into Muller Hinton
Carbapenem antibiotics, including imipenem and
agar plates. Anti-microbial discs were positioned upon
meropenem, are potent against infections caused by P.
the medium's surface and incubated for 24 hours at
aeruginosa (6). Pseudomonas aeruginosa develops
37°C. The diameter of each antibiotic disk's inhibitory
resistance to carbapenems through a variety of
zone was measured and compared to the CLSI-2021
mechanisms, such as the defect outer membrane
standard inhibition zone.
proteins, production of -lactamase, overexpression of
efflux pumps, the emergence of chromosomal AmpC
Molecular identification:
beta-lactamase gene, might acquire resistance to
Molecular detection of (Phz M, Phz S) genes by
carbapenems in P. aeruginosa(7). As result, presently
using PCR technique and Bioneer kit.
would get more challenging to treat (8).
1629
Received: 05/08/2022
Accepted: 07/10/2022
c:\work\Jor\vol901_244
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1633-1639
Value of 3D Ultrasonographic Assessment of Placental Volume and Perfusion Indices in The First Trimester as
a Predictor to the Occurrence of Preeclampsia
Mohamed Ahmed Wasfy, Mahmoud Abubakr Negm, Basem Hamed
Obstetrics and Gynecology Department, Faculty of medicine, Zagazig University, Egypt
Corresponding author: Mohamed Ahmed Wasfy, Email: Mu.wasfy@gmail.com Mobile: (+20)1226340453
ABSTRACT
Background: Preeclampsia (PE) is one of the hypertension illnesses associated with pregnancy, affecting 3-5% of pregnant
women, and is a significant cause of maternal morbidity and perinatal mortality. Detection of placenta changes in the first
trimester by three-dimensional power-Doppler ultrasound can be used to detect preeclampsia early.
Objective: The aim of the current work was to demonstrate if 3D- Indicators of placental volume and vascular flow in the
first trimester might predict preeclampsia.
Patients and methods: This prospective cohort study included 324 pregnant women with singleton pregnancies, attending
at Prenatal Care Outpatient Clinic, Zagazig University Hospitals for regular antenatal care between weeks 11 + 0 and 13
+ 6 of pregnancy. Transabdominal the 3D power Doppler ("placental biopsy") was used to assess placental vascularization.
Making use of the Virtual Organ Computer-aided Analysis (VOCALTM) imaging tool, the obtained spherical volume was
analyzed. three vascular indices, were calculated: Index of vascularization (VI), vascularization- flow index, as well as flow
index (VFI).
Results: A comparison of placental volume of healthy pregnancy group and preeclamptic pregnancies in the current study
showed a statistically significant considerable distinction (P value 0.001). The mean volume in the two groups was
84.9±22.3 and 45.6±11.4 cm3, respectively. The volume of the placenta was higher in the healthy pregnancy group compared
to preeclamptic pregnancy group. In addition, a comparison between normal pregnancy and pregnancies with PE, in terms
of FI, VI, and VFI, indicated a difference that is statistically significant (P value 0.001). The averages of FI, VI, and VFI in
the two groups were (95.4±9.1, 24.7±8.1, 13.1±3. 7) and (16.2±5.8, 54.6±10.9, 8.1±2.1) respectively. These findings clearly
reveal that placentas from preeclampsia complicated pregnancies have lesser blood vessels (reduced VI) and lower blood
flow (reduced FI). According to our findings, this ultrasonographic technology can forecast the development of PE.
Conclusions: It could be concluded that the quantitative measurement of placental vasculature and volume using
noninvasive 3D Power Doppler and the VOCALTM technique during the first trimester may be utilized to predict
preeclampsia. Patients who later develop preeclampsia tend to have decreased placental volume and poorer 3DPD indices
in this critical area during the first trimester.
Keywords: preeclampsia, tree-dimensional ultrasound, screening, vascular indices, Doppler.
INTRODUCTION
Preeclampsia constitutes the commonest medical
disorder diagnosed by obstetricians in clinical practice
Normal intervillous space formation within
representing 7% to 9% of every pregnancy. It is the main
healthy fetal-maternal relations depend on the first
factor in maternal and perinatal mortality around the
trimester connection. Small-caliber spiral arteries are
world (1).
transformed by trophoblasts into large uteroplacental
The placenta, which serves as a fundamental
vessels that carry blood to the intervillous space and,
connection between the fetus and the mother for
eventually, the placenta is compressed is important to this
endocrine function, metabolic exchange as well as
inadequate spiral artery remodeling, leading in reduced
additional physiological processes, is crucial for maternal
blood supply has been connected to the pathophysiology
neonatal health.
of preeclampsia (3).
As a result, evaluation of the placenta with
The start of preeclampsia may not be anticipated
ultrasonography throughout pregnancy is a crucial
only by risk factors and maternal history, particularly in
component of pregnancy care.
nullipara women. Prenatal care focuses mostly on
In the later stages of pregnancy, placental
assessing the fetus's development and is the cause of
ultrasonography is primarily used to determine the
many antenatal hospitalizations. As a result, much study
position of the placenta and diagnose anomalies.
has been devoted to improving the prediction of
However,
the
development
of
high-resolution
preeclampsia (4).
transvaginal ultrasonography has changed how we
Advances in ultrasound technology and
perceive placental development research, also believed to
understanding of the pathophysiology of preeclampsia
be early pregnancy placental examination might be
have rekindled efforts to establish a screening approach
valuable in recognizing the risks for later diseases (2).
for the illness, with the emphasis shifting to identifying a
1633
Received:22/08/2022
Accepted:25/10/2022
c:\work\Jor\vol901_245
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1640-1644
Relation of Three-Dimensional Circumferential Strain Rate to Mediators of
Intestinal Dysbiosis in Children with Chronic Systolic Dysfunction
Alyaa A. Kotby, Mona M. El Ganzourya, Nevin M. Habeeb, Nora El Samman, Nanies M.S. Soliman
Pediatrics Department, Pediatric Cardiology Division, School of Medicine, Ain Shams University, Egypt.
Corresponding author: Nanies Mohamed Salah el Din Soliman, email: naniessoliman@gmail.com;
Mobile no: 00201005101028, ORCID ID : http://orcid.org/0000000317873409
ABSTRACT
Background: Changes that may occur in intestinal microbiota have been shown to result in abnormal levels of
intermediates, which can adversely affect the cardiovascular status.
Objectives: We aimed to study trimethylamine-N-oxide level (TMAO) in patients with chronic systolic dysfunction as
a marker of intestinal dysbiosis and correlate it with cardiac status and echocardiographic findings.
Patients and methods: Twenty-five children with chronic cardiac dysfunction underwent sample collection for TMAO
level. They have been compared to twenty-five age and sex-matched controls. Patients were assessed with conventional
transthoracic echocardiography and three-dimensional speckle-derived strain imaging.
Results: Median age was 4.5 years. Patients had significantly lower ejection fraction (EF) and fractional shortening
(FS) (P <0.001), and lower global, radial, circumferential and longitudinal 3-D strain rates (p<0.001). TMAO was
significantly higher in patients (p<0.05). Best cut-off value was >6.2 um with sensitivity= 96% and specificity= 100%.
TMAO correlated with Ross class, hospitalization rate as well as EF, FS, LV dimensions and volumes, and 3 D
circumferential and radial strain rates. Linear regression analysis showed circumferential strain being an independent
predictor of TMAO levels in the blood.
Conclusions: TMAO levels are increased in patients with chronic systolic dysfunction, which is related to their clinical
status as well as their echocardiographic parameters. Three-dimensional circumferential strain rate seems to be an
independent predictor of TMAO levels.
Keywords: Plasma trimethylamine-N-oxide, Three-dimensional strain rate, Dilated cardiomyopathy.
INTRODUCTION
Regardless to its cause, chronic cardiac
left ventricular mechanics from a single three-
dysfunction in children results in neurohormonal and
dimensional acquisition [8].
molecular derangements as a consequence of the
The main aim of the study was estimation of TMAO
chronic congestive state and reduced cardiac output [1].
levels in children with chronic systolic dysfunction as a
Cardiomyopathy is one of the commonest causes of
marker of altered gut microbiota and to correlate its
cardiac dysfunction in the young age, with dilated
levels with cardiovascular status in these patients.
cardiomyopathy being the most common identity in this
PATIENTS AND METHODS
group [2]. In contrast to heart failure (HF) secondary to
As a case-control study, twenty-five children
structural heart disease, the outcome of the disease
and adolescents with dilated cardiomyopathy were
remains poor, and the estimated 5-year survival rate is
compared to twenty-five sex and age-matched controls.
around 50% [3].
We recruited patients from the Pediatric Cardiology
Disruption of the normal gut microbiota is a
Department during the period from December 2018 to
common finding in patients with reduced ejection
March 2020.
fraction heart failure (HFrEF) who suffer a prolonged
Patients aged <18 years with the diagnosis of
state of immune dysfunction and inflammatory status
primary dilated cardiomyopathy with low ejection
which predispose to intestinal villi hypoxic atrophy
fraction heart failure were recruited in the study.
leading to impaired functions and enhanced
Primary dilated cardiomyopathy was defined as left
permeability [4]. The latter can significantly increase the
ventricular ejection fraction < 55% and LVEDD
passage of gut toxins into the blood stream, which in
exceeding 2 SD Z score excluding primary myocardial
turn further contributes to the inflammatory state in the
disease, non-dilated and secondary types of
body [5].
cardiomyopathy.
The gut microbes metabolize dietary choline to
Patients with concomitant morbidities, especially liver
trimethylamine, that is metabolized in the liver into
and renal dysfunctions or overt intestinal failure, were
trimethylamineNoxide (TMAO). Some reports have
excluded from the study.
shown possible relations between TMAO and enhanced
thrombosis and other life-threatening events including
Sample size: Using the Epi info program for sample
CNS thrombosis, myocardial ischemia, chronic kidney
size calculation, setting confidence interval at 95% and
disease and overall mortality [6,7].
margin of error at 10 and based on the work by Sandek
Speckle-tracking Imaging is an advanced
et al, a sample size of 25 patients with heart failure was
echocardiography mode that analyzes left ventricular
considered appropriate to achieve the study objectives
deformation. The three-dimensional STE has the
[9].
advantage of being more accurate in assessing complex
Ethical considerations:
1640
Received: 06/09/2022
Accepted: 09/11/2022
c:\work\Jor\vol901_246
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1645-1650
Health Related Quality of Life for Patients with Diabetic Foot Amputation
Rehab Hamdy Mahmoud Ahmed*, Baghdad Hussein Mahmoud, Nora Salah Eldin Saad
Department of Medical-Surgical Nursing, Faculty of Nursing, Helwan University, Egypt
*Corresponding author: Rehab Hamdy Mahmoud, Mobile: (+20) 01151716385, E-Mail: Rehabhamdy@nursing.helwan,edu.eg
ABSTRACT
Background: In the latter stages of many illnesses, such as diabetes mellitus, limb amputation is a life-altering treatment
that has social, psychological, and functional repercussions that lower the patient's quality of life.
Objective: The current study aimed to assess the health-related quality of life for patients with diabetic foot amputation.
Patients and methods: A descriptive exploratory study was conducted at the Outpatient Clinic affiliated to Beni-Suef
University Hospital. A total of 70 diabetic patients, 3 to 18 after amputation operation for follow up, were recruited
using a purposive sample. Data of participants were collected using two tools; (I): Structured interviewing questionnaire,
it included three parts; socio-demographic characteristics of patients, medical history of patients and knowledge
assessment questionnaire. (II) World Health Organization quality of life SF36 questionnaire.
Results: About 51.4% of studied patients were in the age group 50 - <60 years, 58.6% of them had unsatisfactory total
knowledge level regarding diabetic foot and amputation, and 60% of them had unhealthy or poor quality of life. There
was no statistically significant correlation between total knowledge and total quality of life regarding diabetic foot
amputation. Conclusion: Developing and implementing an educational programme for patients with diabetic foot
amputation for improvement of their quality of life is strongly and urgently needed.
Keywords: Amputation, Diabetic foot, Quality of life.
INTRODUCTION
The prevalence of diabetes mellitus (DM), a
cardiovascular illnesses are linked to lower levels of
chronic illness, is rising globally. A collection of
prosthesis use and physical activity. Thus, in this
metabolic illnesses known collectively as diabetes are
exposed group, maintaining an adequate amount of
defined by the presence of hyperglycemia. The diverse
physical exercise is crucial for community involvement
pathophysiology includes problems in the metabolism
and general health (5).
of carbohydrates, fats, and proteins as well as
The quality of life of people who have diabetic
impairments in insulin production, insulin action, or
foot is impacted and is associated with significant
both. Retinopathy, nephropathy, and neuropathy are
morbidity and death. Foot ulcers affect 15% to 20% of
among the long-term particular consequences of
diabetic people throughout the course of their lifetime,
diabetes (1).
and the number of foot ulcers is rising at a rate of 2%
Diabetes-related hospitalizations are most
each year. Patients with a history of amputation,
frequently brought on by diabetic foot problems, which
deformity, or foot ulcer, however, are more likely to rise
account for 50% of all diabetes admissions and 24% of
by 17% to 60%. Patients with diabetic foot have lower
total medical expenses. The most frequent reason for
limb amputation mortality rates that are around 22% at
non-traumatic lower extremity amputations is diabetic
30 days, 44% at 1 year, and 77% at 5 years (6).
foot problems. Patients with diabetes have a 15-46 times
Following an amputation, quality of life suffers
increased risk of lower limb amputation than people
along with decreased mobility and discomfort. Patients
without diabetes (2,3).
can have psychological and social effects, and
The phrase "health-related quality of life"
psychological issues might include sadness, anxiety,
(HRQOL) has been defined in a variety of ways, but the
and in very extreme situations, suicide.
most popular definition centers on the patient's capacity
There is a correlation between mobility, use of a
for self-determination, independence, and control over
prosthesis, and perceived HRQOL among patients with
the illness processes. The idea also assesses the person's
amputation (4, 6). Mobility is one of the most significant
feeling of psychological, bodily, and social well-being,
variables for excellent HRQOL since low functional
as well as their judgement of their own level of life
status reduces the patient's ability to live independently.
satisfaction. Amputations cause significant alterations
The current study aimed to assess the health
in one's everyday functioning and quality of life.
related quality of life for patients with diabetic foot
Amputation-related limitations on the body's structures
amputation.
and functions have an impact on a person's level of
activity and social engagement (4).
PATIENTS AND METHODS
Patients who have had a lower limb amputated
A descriptive exploratory study was conducted at
(LLA) deal with difficulties and restrictions in daily
the Outpatient Clinic affiliated to Beni-Suef University
mobility. Because walking with prosthesis entails
Hospital. The clinic has one room, with one bed for
independence and community involvement, it is a key
receiving one patient which is located at the ground
factor in determining quality of life. Poorer walking
floor.
ability, worse functional ability, and a higher risk of
1645
Received: 12/08/2022
Accepted: 15/10/2022
c:\work\Jor\vol901_247
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1651-1654
Laser Therapy for Treatment of Syringoma: Review Article
Ola Mohamed Hafez Taha*, Nagwa Ali Diab, El-Sayed Mohamed Galal Khater
Department of Dermatology, Venereology & Andrology, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Ola Mohamed Hafez Taha, Mobile: (+20) 01024012672, E-Mail: olataha36@gmail.com
ABSTRACT
Background: Often seen in a periocular distribution, syringomas are benign skin-adnexal tumours of eccrine origin that
manifest as little dome-shaped papules and may affect the aesthetic look of the face. The neck, belly, or genitalia outside
are all possible locations. There has been progress in the treatment of syringomas and other dermatological issues thanks
to the development of laser technology in recent years. Many advancements in both technology and technique have been
made in the treatment of syringoma using lasers since the first attempts were made.
Objective: Review of the literature on Laser Therapy for Treatment of Syringoma.
Methods: We looked for data on laser therapy and syringoma treatment in medical journals and databases like PubMed,
Google Scholar, and Science Direct. However, only the most recent or extensive study was taken into account between
January 2000 and May 2021. References from related works were also evaluated by the writers. There are not enough
resources to translate documents into languages other than English, hence those documents have been ignored. It was
generally agreed that documents such as unpublished manuscripts, oral presentations, conference abstracts, and
dissertations did not qualify as legitimate scientific study.
Conclusion: Among ablative lasers, fractional laser modality has been shown to be the safest option. Despite its
usefulness in combating Syringoma, the drug is not without side effects.
Keywords: Laser Therapy, Treatment of Syringoma.
INTRODUCTION
Often seen in a periocular distribution, syringomas
are benign skin-adnexal tumours of eccrine origin that
manifest as little dome-shaped papules and may affect
the aesthetic look of the face. It can also be present on
the neck, belly, or external genitalia (1).
Syringoma is derived from the Greek word syrinx,
which meaning tube. Eccrine duct tumours are benign
adnexal tumours based on their histological features.
When cells multiply in the duct's lumen, they form
spiral structures that restrict the flow of perspiration and
prevent it from exiting the skin (1).
Syringoma affects 0.6% of the population, most
commonly affecting girls throughout adolescence, with
Figure (2): Syringoma on forehead (3).
an age peak between the years 20 and 30 (1-3).
Laser Therapy of Syringoma:
There has been progress in the treatment of
syringomas and other dermatological issues thanks to
the development of laser technology in recent years.
Many advancements in technology and enhanced laser
procedures have been made since the first attempts were
made to treat syringoma with laser (4).
Ablative lasers for syringoma:
1- Carbon dioxide laser:
One of the earliest kinds of laser was a carbon
dioxide (CO2) laser. Because of its high water
absorption, it was rapidly identified as an appropriate
surgical laser. The wavelength of light emitted by a CO2
laser is 10,600 nm, which is far in the infrared region of
the electromagnetic spectrum. Through a process of
heating and evaporating intracellular water, it damages
Figure (1): Syringoma on eyelids (2).
the tissue it is directed towards. Because skin has such
a high concentration of water, the CO2 laser is ideally
suited for its accurate, risk-free ablation and good
hemostasis (4).
1651
Received: 09/09/2022
Accepted: 12/11/2022
c:\work\Jor\vol901_248
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1655-1662
Association between C - reactive protein to Serum Albumin Ratio with the Severity of
Coronary Artery Disease in Non-ST Elevated Myocardial Infarction Patients
Hany H. Ebaid1, Khaled A. Elrabbat1, Mohamed A. Hamoda1, Mohamed R. Khalil2
1Cardiology Department, Benha University Hospital, Benha, Egypt
2Cardiology Department, Agoza Hospital, Giza, Egypt
*Corresponding author: Mohamed R. Khalil, Mobile: (+20) 01552743150, E-Mail: mohamedreda0929@gmail.com
ABSTRACT
Background: Non-ST-segment elevation Acute Cronary Syndrome (NSTE-ACS) stays as the most common cause of
mortality in people with cronary artery disease (CAD).
Objective: The purpose of this research was to assess the probable association between the severity of CAD disease (by
using the Syntax score) and c-reactive protein/albumin ratio (CAR) calculated by measuring serum levels upon
admission. Patients and Methods: A prospective study that included 100 patients who were admitted to Agoza Hospital
and Benha University Hospital with clinical features of NSTEMI and treated with percutaneous coronary intervention
(PCI). We divided the patients into 2 groups: according to Syntax score, group 1 included 59 patients with Syntax score
22. Group 2 included 41 patients with Syntax score > 22. Results: Regarding laboratory findings in the studied
patients, neutrophil was significantly higher in group 2 (7.6) than in group 1 (6) (P < 0.001). Platelets were significantly
higher in group 2 (332%) than in group 1 (293) (P < 0.001). Median CRP was significantly higher in group 2 (14.8)
than in group 1 (6) (P < 0.001). Median CAR was significantly higher in Group 2 (35.6) than in group 1 (14.6) (P <
0.001). Neutrophil to lymphocyte ratio (NLR) was significantly higher in group 2 (3) than in group 1 (2.5) P < 0.001).
Left main cronary artery (LMCA) disease, three vessels disease (3VD), bifurcation, complete total occlusion (CTO),
Lesion > 20 mm and severe tortuosity were significantly higher in group 2 than in group 1. Conclusion: GRS, LMCA
disease, TVD, bifurcation, CTO, Lesion > 20 mm, severe tortuosity, neutrophil, platelets, median CRP, median CAR
and NLR were significantly higher in those with Syntax score > 22 than those with syntax score 22. CAR was revealed
to be an independent predictor for the high SS group, with a stronger correlation to the complexity and severity of CAD.
Keywords: C - reactive protein - Serum albumin ratio - Severity of coronary artery disease - Non-ST elevated
myocardial infarction.
INTRODUCTION
done in Cardiology Department, Agoza Hospital and
NSTE-ACS stays as the commonest cause of
Benha University Hospital.
mortality in people with CAD (1).
2-Study population: The study was done on 100
The most popular method of assessing CAD
patients who were admitted to Agoza Hospital and
severity, the synergy between PCI with TAXUS and
Benha University Hospital with NSTEMI and were
cardiac surgery Syntax score (SS), has been linked to an
treated with PCI.
increased risk of mortality in patients with both ACS
and stable CAD (2). By identifying the risk factors for
Inclusion criteria: All patients with NSTEMI e.g.
intermediate-high SS, the prognosis of NSTE-ACS
patients suffering from chest pain with no persistent ST-
patients could be better by being closely monitored
segment elevation, with ECG showing ST segment
before, during, and after hospitalization and referral for
deviation (transient elevation or persistent depression),
emergency
coronary
angiography
and
T wave abnormality including inverted, flat or pseudo-
revascularization. Inflammation contributes to the
normalization or even normal ECG (6).
worsening and instability of atherosclerotic plaques (3).
Exclusion criteria: Patients with past history of CAD
The inflammatory response may be assessed by
treated with PCI or CABG, patients with cancer,
acute phase reactants (APRs). CRP and serum albumin
patients with active infection, patients with connective
are related to the existence of CAD, increased CAD
tissue disorders, patients with chronic kidney disease
severity, and cardiovascular adverse events (4).
and patients with liver disease.
It has been proven that CAR is a stronger indicator
B. Operational design :
of the inflammatory condition than either CRP or
Initial assessment: Complete full history taking and
albumin alone. It has also been linked to a bad prognosis
clinical examination of all patients.
in those who are already suffering from serious illnesses
Investigations included Complete blood picture
like cancer (5). The purpose of this study was to
(CBC), serum creatinine and lipid profile. High
recognize the probable relation between the severity of
sensitive CRP: (Normal: 1.0-3.0 mg/dL) (7). Serum
coronary artery disease as determined by the syntax
albumin: (range: 3.5 to 5.5 (g/dL) (8).
score and CAR, which was determined by measuring
1. Cardiac biomarkers (9):
serum level of levels upon admission.
Cardiac troponin I: If the first levels of
cardiac troponins that was measured at
PATIENTS AND METHODS
presentation are negative, serials are obtained at
A. Technical design:
3 to 6 hours after beginning of symptoms
1-Study type and region: This prospective study was
(Normal range: between 0 and 0.04 ng/mL)
1655
Received: 11/08/2022
Accepted: 14/10/2022
c:\work\Jor\vol901_249
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1663-1667
Assessment of Grommet Tube Insertion versus Myringotomy with
Intratympanic Steroid Injection in Treatment of Otitis Media with Effusion
Ahmed Suliman Mohammed Saleh*, Ahmed Hassan Sweed, Ahmed Mohamed Anany, Ezzat Ahmed Merwad
Department of Oto-Rhino-Laryngology, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Ahmed Suliman Mohammed Saleh, Mobile: (+20)01150905292, E-Mail: aleh8084@gmail.com
ABSTRACT
Background: Due to the short duration of effect, simple myringotomy and aspiration of fluid do not yield significant
therapeutic outcomes.
Objective: To compare the efficacy of myringotomy with intratympanic dexamethasone injection versus grommet tube
insertion in treatment of Otitis Media with effusion (OME).
Subjects and Methods: At Oto-Rhino-Laryngology, Department of Zagazig University Hospital, during the period
from 2021 to 2022 on 13 patients (26 ears) with persistent OME. Ears were divided into two groups: Group (A) included
right ears that underwent the radial grommet tube. Group (B) included left ears that underwent the circumfrential
myringotomy with intratympanic dexamethasone
Results: There was statistically no significant difference as regards tympanosclerosis and persistent discharge between
both right and left ears. At right ears, 15.4% of cases showed both persistent discharge and tympanosclerosis while
38.5% of left ears showed tympanosclerosis and no residual discharge. There was a statistically significant difference in
the rate of recurrence between the right and left ears 6 months after surgery, with 23.1% of left ears reporting recurrence
while 100% of right ears showed no recurrence.
Conclusion: Myringotomy with grommet tube insertion with or without adenoidectomy is a classical method in
treatment of chronic OME with potential complications especially otorrhea with less significant low recurrence rate. On
other hand, circumferential myringotomy with ITD an effective method in treatment of chronic OME with less
postoperative complications equivalent postoperative hearing threshold, but with higher recurrence rate.
Keywords: Grommet tube insertion, Myringotomy, Intratympanic steroid injection, Otitis Media with effusion.
INTRODUCTION
in the decrease of granulation tissue (2). This research
Multiple factors contribute to the development of
purpose was to compare the efficacy of myringotomy
otitis media with effusion (OME). When middle ear
with intratympanic dexamethasone injection versus
effusion lasts for less than three weeks, the condition is
grommet tube insertion in treatment of OME.
classified as acute OME. Between three weeks and three
months, it is classified as subacute, and longer than three
SUBJECTS AND METHODS
months, it is classified as chronic. The pathogenesis of
Subjects:
chronic OME cannot be reduced to a single factor. It's
At Oto-Rhino-Laryngology, and Head and Neck
likely the result of a complex combination between
Surgery Departments, Zagazig University Hospital, 13
inherited susceptibility and environmental factors like
patients (26 ears) with persistent OME and scheduled for
infection and allergies (1).
surgery after being diagnosed clinically and investigated
Secretory change of the epithelium lining the
by audiometry and tympanogram. The ears were divided
middle ear cavity, sub-epithelial edoema, and infiltration
into two groups: Group (A) included right ears underwent
of phagocytes and lymphocytes are hallmarks of OME.
radial myringotomy with grommet tube insertion and
The fluid in the middle ear might be the product of
group (B) that included left ears underwent the
transudation, exudation, or active secretion by the
circumferential myringotomy with intratympanic steroid
epithelial cells that line the cavity (2). In children, otitis
(dexamethasone) injection.
media with effusion is the most common cause of hearing
loss. When OME is treated early, it can prevent
Inclusion criteria: Patients with persistent OME and
permanent hearing loss and language delays in children.
scheduled for surgery after being diagnosed clinically and
While OME treatment has been debated, many questions
investigated by audiometry and tympanogram.
remain (3).
Exclusion criteria: Patients with mucocilliary disorders,
Since the effects of a simple myringotomy and
previous surgery OME, recurrent OME, syndromic
aspiration of effusion only last for a few days, they cannot
disorder (Down syndrome), and patient refusal.
be considered therapeutically effective. However, there
are risks associated with putting in a ventilation tube
This is what all of the participants in this research
(VT), and one of the most common is tube otorrhea,
had to go through:
which has an incidence rate of 29%. As a result, otologic
1. A thorough review of the patient's medical history.
symptoms are not always effectively treated with standard
The main complaint can be taken from parents of the
methods (4).
child or from patient himself, like otalgia, hearing
In addition to antibiotic therapy, steroid injections
loss, tinnitus and fullness in ear
using a tympanostomy tube or intratympanic
2. For exclusion of any systemic diseases or syndromes
dexamethasone (ITD) were found to be more successful
associated with otitis media with effusion
1663
Received: 11/08/2022
Accepted: 14/10/2022
c:\work\Jor\vol901_250
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1668-1673
Impact of After School Physical Classes, Nutritional Status and
Socioeconomic Status on Psychosocial Behavior in Governmental
Primary School Children in El-Minia City, Upper Egypt
Salwa Mohamed Rabie Taha*1, Emad G. Kamel2, Nermin Ali Hamdy1, Maha Ali Hasan1
Departments of 1Neurology and Psychiatry and 2Public Health, Faculty of Medicine, El-Minia University, Egypt
*Corresponding author: Salwa Mohamed Rabie, Mobile: (+20) 01142741126, E-Mail: znaty2018@yahoo.com
ABSTRACT
Background: A child's psychosocial behavior may be significantly impacted by elements such as nutrition, physical
exercise, and socioeconomic issues since they are crucial for healthy growth, development, and conduct.
Objective: The aim of the current study is to assess the effect of after school physical activity, nutritional status and
socioeconomic status on psychosocial behavior problems of primary school students.
Subjects and methods: Two schools in Minia city were chosen randomly. Apparently healthy male students of the
primary 6th grade in both schools were included in the study. A structured questionnaire was applied to collect socio-
demographic and nutritional data. Students from the first school (the active group) had 2 extra after-school physical
classes for 6 months. Nutritional status assessment was carried out through measurements of weight and height.
/Results: The studied sample included 88 male students; the active group included 42 students and the control group
included 46 students. Almost half of each group belonged to families with low-educated mothers (52.3% in the active
group vs 45.6% in the control group). Low-income families were more in the active group than in the control group
(61.9% vs. 45.6%). The active group got a higher score than the control group (P<0.001), according to Physical
Assessment Score. Students with psycho-social problems with a total score 15 according to PSC-17 were 16
(18.2%). Logistic regression analysis revealed that child order (P=0.02) and maternal education (P=0.024) were strong
predictors of psychosocial behavior of children followed by physical fitness (P=0.03) and number of meals per day
(P=0.05). Conclusions: Birth order, mother education, physical exercise and number of meals consumed per day are
the most powerful predictors of psychosocial behavior of children.
Keywords: School physical classes, Psychosocial behavior, Social factors, Children.
INTRODUCTION
misbehavior behaviors (such as lying and stealing),
A balanced diet and regular exercise are essential
despair, and dysfunctional interpersonal relationships.
for normal growth and development as well as the
Children also engage in activities including gambling,
avoidance of chronic diseases. Therefore, encouraging
robbery, murder, school absences, inferiority complex,
young people to adopt healthy eating and exercise
stigma, and prejudice [6]. Reid [9] discovered that there
habits is an important public health measure [1].
was a higher correlation between food insecurity and
Numerous research have demonstrated the beneficial
externalizing behaviors than internalizing behaviors.
effects of physical activity and good eating on conduct,
However, additional research found a link between
mental health, and academic achievement [2,3,4].
persistent food insecurity and both internalizing and
Young people's everyday physical exercise has a
externalizing issues [10,11].
positive impact on their health in several ways.
Children in Egypt make up one-fifth of the
Regular exercise increases muscular strength,
population. Regional differences in child poverty in
strengthens bones and muscles, lowers the risk of
Egypt may be seen; in rural and Upper Egypt, it is
acquiring chronic diseases, boosts self-esteem, and
more prevalent (30.5% of children live in poor homes
relieves stress and anxiety. Programs that promote
against 12.6% in urban regions) [12]. Poor sanitation
physical exercise have been shown to have positive
and hygiene, as well as insufficient food, are all
benefits on academic achievement, including higher
symptoms of poverty. Inadequate stimulation in the
test scores in arithmetic, reading, and writing as well
home, high levels of mother stress and depression, and
as less disruptive conduct [2]. The inability to get food
low maternal education are all linked to poverty [13].
in a manner that is acceptable to society or the
The aim of the current study is to assess the effect
restricted or unpredictable availability of wholesome
of after school physical activity, nutritional status and
meals are both considered to be signs of food
socioeconomic status on psychosocial behavior
insecurity [5]. Many researches have been done to
problems of primary school students.
determine how children's nutritional, physical, and
mental health is impacted by food hardship. According
PATIENTS AND METHODS
to this research, children who are food insecure have
Primary schools in Minia city are 53 schools, 18 of
lower assessments of their mental and physical health
them are private schools that were excluded from the
as well as unfavorable emotional, behavioral,
study. Two schools were chosen randomly, "El
academic, and cognitive indicators [6,7,8].
Lamaty" school and "Shalaby" school. Only apparently
Children who live in houses where there is a lack
healthy male students of grade 6 in both schools were
of food frequently display violent behavior,
included in the study. These were 122 students.
1668
Received: 12/08/2022
Accepted: 15/10/2022
c:\work\Jor\vol901_251
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1674-1679
The Relationship between the Level of the Pregnancy Associated Plasma
Protein-A (PAPP-A) and Some Reproductive Hormones in
Serum of Iraqi Women Undergoing ICSI Protocol
Zainab Omar Yousif*, Lina A. Salih
Department of Biology, collage of sciences, University of Baghdad, Iraq,
*Corrosponding author: Zainab Omar Yousif, E-mail: almamarzainab@gmail.com
ABSTRACT
Background: Pregnancy Associated Placental Protein-A (PAPP-A) is a zinc-binding metalloproteinase with a key
role in the insulin-like growth factor (IGF) pathway. The IGF system plays an essential role in follicular development,
including steroid hormone synthesis, growth, recruitment, and apoptosis of follicles of women undergoing
intracytoplasmic sperm injection (ICSI).
Objective: The objective of this study is to measure Pregnancy Associated Plasma Protein-A (PAPP-A) in serum of
infertile women undergoing ICSI, and to investigate the association of PAPP-A with some reproductive hormones
level. A total of 45 infertile women.
Results: The results of this study was Serum PAPP-A level was not significant with hormones level (FSH, LH PRO
and AMH) except E2 hormone was significant.
Conclusion: Outcome show that no relation between studied reproductive hormones and serum PAPP-A except E2
levels that are high cause the egg to mature and release from the ovary.
Keywords: PAPP-A, E2, Infertility and hormones.
INTRODUCTION
get pregnant the PAPP-A level be higher in normal
Infertility is described as the inability to get pregnant
women than in infertile women (6).
after 12 months of sexual activity, and it affects 15%-
17% of couples globally, with around 50% of them being
SUBJECTS AND METHODS
connected to female infertility problems like (risk factor
The sample used to design this study was infertile
and known causes, environmental factors, weight
women from the Al-Wazyria Hospital, the Infertility and
changes, age and life style and ovarian and hormonal
IVF Center, Baghdad / Iraq, from December 2021 to
function problems) (1).
April 2022. This research has 45 infertile women who are
There is many infertility management that help to
set to start their ICSI cycle. The respondents' ages range
solve the problem by either hormonal treatment or
from 19 to 45 years.
Assisted Reproductive Techniques (ART) such as Intra-
Blood samples (5ml ) were drawn from each women
Uterine Insemination (IUI), In Vitro Fertilization (IVF)
from vein by disposable syringe on day 2 of the
and Intra-Cytoplasmic Sperm Injection (ICSI) (2).
menstrual cycle to measure hormones (FSH, LH, PRO,
Intracytoplasmic sperm injection (ICSI) is a
E2 and AMH) before starting control ovarian stimulation
technique of assisted reproductive technology used to
determined by using mini VIDAS system (bio Merieux ,
treat infertility, a single sperm cell is directly injected
France), and in one day before oocyte retrieval to
into the ooplasm during ICSI. ICSI provides a variety of
measure PAPP-A in serum, were put into a plain or gel
therapy options, involving the use of spermatozoa with
tube allowed to clot for 30 minutes and then centrifuged
slow progressive motility and gametes surgically
at 3000 rounds per minute rpm within 10 minutes to
extracted from the epididymis and testicles of those with
separate the serum, by ELISA. About (1.5ml) of serum
azoospermia (3).
sample was transferred by sterile micropipette into sterile
Pregnancy-Associated Plasma Protein A (PAPP-A)
Eppendorf tubes for following test and kept frozen at -20
is a glycoprotein and a highly selective metalloproteinase
°C until time of analysis.
that attaches to glycosaminoglycan's on the cell surface
A thorough medical history, gynecological and general
and associated in the cleavage of IGFBP, specifically
examination, and full infertility investigations were
IGFBP4,5, resulting in an increase in bioactive IGF.
performed on all infertile women. These investigations
PAPP-A also acts as a growth-promoting enzyme within
included husband's seminal fluid analysis, hormonal
the tissue, producing bioactive IGF when it comes into
testing,
trans-vaginal
ultrasounds,
and
contact with IGF receptors (4).
hystrosalpingography for uterine cavity and tubal
Pregnancy Associated Plasma Protein-A (PAPP-A)
patency, and/or laproscopy for tubal patency and the
is found in little amounts in the serum of males and non-
isolation of Polycystic Ovaries Syndrome (PCO).
pregnant females, but at rise concentrations in the serum
of pregnant females (5).
Ethical consent:
Last studies expression that low expression of
A full history has been obtained from each
PAPP-A increased the risks, PAPP-A in normal women
women including: personal history, menstruation
before pregnant is lower than infertile women, and after
history and infertility status. All of them were made
aware of the study's subject and signed a written
1674
Received:08/09/2022
Accepted:11/11/2022
c:\work\Jor\vol901_252
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1680-1683
Clinicopathological Significance of A20 Genetic Mutation in
Diffuse Large B-Cell Lymphoma
Rana M. Shaat¹*, Hasan A. Abd El Ghaffar¹, Sameh Shamaa², Hanaa M. Abdel-Masseih¹, Osama Elbaz¹
Clinical Pathology Department¹, and Oncology Medicine Department²,
Faculty of Medicine, Mansoura University, Egypt
*Corresponding author: Rana M. Shaat, Phone Number: +2 01033500076,
ORCID: 0000-0001-5200-0641, Email: ranashaat88@gmail.com
ABSTRACT
Background: Activation of pathway of nuclear factor kappaB (NF-B) which is caused by genetic alterations has been
reported in B cell lymphoma. A20 gene is considered main regulator component of NF-B signaling. Its function is mainly
suppression of this pathway. Deletions and/or mutations in A20 gene cause inactivation of this pathway which were found
in various hematologic malignancies.
Objective: The current study aims to determine the prevalence of A20 gene mutations and their relationship with the clinical
and laboratory profile in diffuse large B-cell lymphoma (DLBCL).
Patients and methods: A total 100 DLBCL patients were investigated for A20 gene mutation by real time polymerase
chain reaction. Results: A20 gene mutation GA mutant genotype was found in 18% of the patients, where 77.8% of them
were ABC-DLBCL subtypes. GA heterozygous genotype was frequently associated with stage IV and extra-nodal
infiltration, and shorter overall survival (OS).
Conclusion: Our study suggests a role of A20 gene mutation in DLBCL pathogenesis as well as its prognosis.
Keywords: Tumor necrosis factor alpha induced protein3, Nuclear Factor kB, Diffuse large B-cell lymphoma, Case series,
Mansoura University.
INTRODUCTION
as CBC and flow cytometry and bone marrow
DLBCL is considered as the most frequent type of B
examination for infiltration. Diagnosis of DLBCL was
cell lymphoma, representing 40% of non-Hodgkin
done by IHC according to Hans algorithm .
lymphomas ¹.
DLBCLis considered a heterogeneous tumor with
DNA extraction:
variable genetic changes, clinical background, treatment
Fresh lymph nodes were removed from all patients
outcome and prognosis ². NF-B signaling is a very
then delivered into a container containing saline to be
important part for activated B cells diffuse large
stored in -80 C until time for genotyping. DNA was
lymphoma (ABC-DLBCL) to achieve survival ³. NF-B
extracted from lymph nodes by QIAamp DNA Mini Kit
signaling interruption could induce apoptosis of
from Qiagen (Catalog No. 51304, Germany) following
lymphoma cells .
the instruction of the manufacturer. The DNA quality was
Tumor necrosis factor alpha induced protein3 which
confirmed using Nanodrop2000.
is also known as (A 20), an enzyme modifying ubiquitin
Detection of A20 gene mutation was done by taqman
which negatively regulates NF-B. Somatic mutations in
SNP genotyping assay real time PCR using master mix
A 20 gene cause inhibition of its function which is seen in
preparation (Applied biosystems, lot 00723780, Foster,
most cases of the disease of study . The incidence of this
USA). Sequence-specific primers and two probes for the
gene mutation in ABC subtype is significantly increased
SNPs were also used amplify the targeted sequence.
. Thus, the current study aims to determine the
prevalence of A20 gene mutation with clinical and
The probes for A20 gene: One was labelled with
laboratory parameters in DLBCL patients besides its role
"VIC" dye for the Allele 1 (A) sequence & the other was
in the prognosis of the disease.
labelled with "FAM" dye for the other Allele (G)
sequence. The SNP ID is rs143002189 and the
PATIENTS and METHODS
chromosomal location is Chr6:137881310. The context
This is an observational cohort study conducted on
Sequence
[VIC/FAM]
was:
100 DLBCL cases. These cases were selected from
ACGAATGCTTTCAGTTCAAGCAGAT[A/G]TATGG
inpatient and outpatient clinics of Oncology Center
CTAACCGGAAACAGGTGGGT
Mansoura University from December 2019 to September
Allelic interpretation was performed by computing
2022.
fluorescence intensity. The analysis of the results were
Any DLBCL patients with a history of other cancers
done by "SDS software1.7" (Appllied Biosystem, Foster,
or autoimmune diseases were excluded. Complete history
USA) and genotyping was determined. Each sample is
taking and staging according to the Rai stage were done
interpreted according to the 2 alleles & Genotypes
for all cases. Laboratory investigations were carried out
(Homozygous or heterozygous).
1680
Received:14/08/2022
Accepted:17/10/2022
c:\work\Jor\vol901_253
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1684-1689
Management of Congenital Clasped Thumb in Patients with
Distal Arthrogryposis 3 Years Follow-up
Mahmoud El-Badawy Thabet*, Mohamed Abdel Aziz Aly, Hossam Fathi Mahmoud
Orthopedic Department, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Mahmoud El-Badawy Thabet, Mobile: (+20) 01125286540,
E-mail: mahmoudbadawy526@gmail.com
ABSTRACT
Background: Congenital clasped thumb is a deficiency of active extension of the thumb with flexion and adduction
deformity after the age of 3 months. In distal arthrogryposis, congenital clasped thumb is characterized by global
metacarpo-phalangeal (MCP) joint instability; severe narrow 1st web space and palmar contracture.
Objective: The present study aimed to describe patients' characteristics, and the results of treatment of congenital
clasped thumb in distal arthrogryposis.
Patients and methods: A total of 24 congenital clasped thumbs in 14 patients (9 boys and 5 girls) underwent release of
tight first web space structures, Ghani flap, and MCP joint chondrodesis with or without flexor pollicis longus
lengthening. There were 10 bilateral and 4 unilateral cases. The mean age of the patients was 4 years old (ranging from
3 to 5). Results: According to the parent parents of the participants, all patients were fulfilled with the thumb function
and appearance. Union of the chondrodesis was achieved in 21 thumbs. There was statistically significant improvement
of thumb abduction, rotation and opposition.
Conclusions: The 1st web space contracture release, Ghani flap and MCP chondrodesis is a good surgical option for
management of congenital clasped thumb in distal arthrogryposis.
Keywords: Congenital clasped thumb, Distal arthrogryposis, Modified dorsal rotational flap.
INTRODUCTION
Patients were operated in the period from March
Congenital clasped thumb by definition is a
2016 to March 2019. There were 10 bilateral and 4
deficiency of active extension of the thumb with flexion
unilateral cases. The patients' mean age was 4 years old
and adduction deformity after the age of three months.
(range from 3 to 5). The minimum follow-up period was
The extension loss involves mainly the metacarpo-
3 years. Supple type and complex clasped thumb
phalangeal (MCP) joint and sometimes, the
patients rather than those with distal arthrogryposis
interphalangeal (IP) joint (1).
were excluded.
McCarroll (2) classified the clasped thumb
The following data were collected from the included
according to the deformity flexibility into supple and
patients:
complex types. Complex type is commonly associated
Medical history taking: There were 5 (35.7%) cases
with arthrogryposis with the inability to correct the
with positive family history. Positive consanguinity was
deformity passively. Arthrogryposis or multiple joint
present in 10 (71.4%) cases. Drug intake during
contracture syndrome is a group of disorders
pregnancy was present in 3 (21.4%) cases. In 2 of them,
characterized mainly by contractures of two or more
contraceptive pills were taken and in the third case, the
joints in multiple body areas (3). Distal arthrogryposis is
antibiotic was taken for fever treatment.
a subtype of arthrogryposis that involves primarily the
hands and feet. There are more than ten types of distal
Clinical examination: It included evaluation of the
arthrogryposis (4,5).
web space narrowing, the severity of the deformity, and
Congenital clasped thumb in distal arthrogryposis
associated hand anomalies. Camptodactyly was present
is characterized by global MCP instability, narrow first
in 24 hands with different severity. There were 21 hands
web space with deficient skin, and palmar contracture
with mild to moderate camptodactyly, and only 3 were
involving the skin and the subcutaneous tissues (6). This
severe which necessitated surgical treatment. Ulnar drift
study aims to describe patients' characteristics, and the
hand was present in 17 (70.8%) hands. Wrist extension
outcome of management of congenital clasped thumb in
deformity was present in all hands but there was no
distal arthrogryposis.
associated radial deviation of the index in this study.
A pre-operative X-ray of the hand was done for all cases
PATIENTS AND METHODS
to identify the appearance of the ossific center of the
A retrospective study was conducted on 24 clasped
base of the proximal phalanx of the thumb which was a
thumbs in 14 patients with distal arthrogryposis (9 boys
precondition for surgical intervention.
and 5 girls). All patients underwent release of tight first
web space structures and MCP joint chondrodesis with
Surgical technique:
or without flexor pollicis longus (FPL) lengthening,
Abdel-Ghani (7) flap was marked by 2 lines; the first
according to the technique described by Abdel-Ghani
line was drawn along the first metacarpus and the
flap (7).
second line was extended in a curved fashion from the
2nd metacarpus head to end at the 5th metacarpus nearly
1684
Received: 29/08/2022
Accepted: 02/11/2022
c:\work\Jor\vol901_254
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1690-1697
Adherence to Sorafenib Therapy Is Not Affected by Treatment-Related Side Effects or
Demographic Characteristics of Iraqi Patients with Hepatocellular Carcinoma
Tuqa Haitham Qasim 1, Mohammed Abdul-Hassan Jabarah AL-Zobaidy *1, Mazin Jody 2
1 Department of Pharmacology, College of Medicine, University of Baghdad, Iraq
2 Department of Medicine, College of Medicine, University of Baghdad, Iraq
* Corresponding author: Mohammed Abdul-Hassan Jabarah AL-Zobaidy,
Mobile: 009647705982654, Email: mohammed.a@comed.uobaghdad.edu.iq
ABSTRACT
Introduction: Sorafenib is an orally active multiple kinase inhibitor for the treatment of advanced renal cell carcinoma and
hepatocellular carcinoma (HCC) patients. However, measuring the experience of patient-reported symptoms may provide
additional information to compare the efficacy and toxicity of treatments.
Objective: The aim of the current study was to investigate the association between hepatocellular carcinoma patients'
adherence to treatment and their demographic characteristics.
Patients and methods: An open-label cross-sectional study was conducted at the Oncology Teaching Hospital, Al-Amal
Hospital, Imam Al-Kadhimin Medical City in Baghdad, Iraq, from November 2021 to July 2022. A total of 52 patients
taking sorafenib for their HCC were recruited in our study. Adherence to treatment was assessed using Morisky Medication
Adherence Scale. Results: A total of 52 patients were enrolled in current study. Fatigue was the most common adverse
event as it was experienced by 90.4% of participants, followed by anorexia, anemia, nausea and diarrhea (71.2%, 67.3%,
65.4%, and 59.6%, respectively), while only 26.9% of participants had vomiting. In addition, all participants showed low-
moderate adherence to treatment. Also, there was non-significant association between demographic data of patients or
treatment-related adverse effects.
Conclusion: Patients with hepatocellular carcinoma on sorafenib treatment exhibit low-moderate levels of adherence. The
latter had not affected by sorafenib-related adverse effects or demographic characteristics of patients.
Keywords: Adherence, Adverse effects, Hepatocellular carcinoma, Multikinase inhibitor, Sorafenib, Cross sectional study,
University of Baghdad, Iraq.
INTRODUCTION
Liver cancer represents the sixth among all types of
epidemiological studies, both environmental and ethnic
tumors globally (1). Also, hepatocellular carcinoma (HCC)
factors are key determinants of HCC (4). The possible
is the predominant primary liver cancer and the third
mechanisms involved in the pathogenesis of HCC are
largest cause of mortality (2). Also, men are 2-3 times more
described in Figure 1.
likely than women to be affected (3). According to
Figure (1). Mechanisms of hepatocarcinogenesis (4).
1690
Received: 27/7/2022
Accepted: 29/9/2022
c:\work\Jor\vol901_255
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1698-1706
Evaluation of Adverse Drug Events Relating to Cardiac Disorders in
Iraqi Public Sector
Bassma O. Salman 1*, Mohamed Y. Jamal 1, Manal M. Younus 2
1 Department of Clinical Pharmacy, College of Pharmacy, University of Baghdad, Baghdad, Iraq.
2 Iraqi Pharmacovigilance Center, Directorate of Technical Affairs, Ministry of Health and Environment, Baghdad, Iraq.
*Corresponding author: Bassma O. Salman, Mobile: 07713743574, Email: bassbassma9@gmail.com
ABSTRACT
Introduction: The cardio-vascular disease is a reason for mortality and morbidity is a serious and expanding issue.
Cardiotoxicity is a frequent adverse pharmacological reaction, and the anthracycline class of anticancer medications, in
particular, causes significant cardiotoxicity. Oxidative stress, free radical production, and hypoxia are common mechanisms
causing cardiotoxicity. Objective: The aim of the current study is to determine which pharmaceuticals and adverse drug
reaction cardiac problems are detected in Iraqi Public Sector.
Material and methods: By examining the reported adverse medication responses in terms of their seriousness, severity,
preventability, and expectedness. Individual case safety records from the Ministry of Health and Pharmacovigilance of Iraq
were examined retrospectively in this study.
Results: The study comprised 2453 reports of adverse medication reactions with 1101 individual case safety reports. The
medicine with the most adverse drug reactions was tozinameran. Cardiac diseases were the cause of the majority (46.73%)
of negative medication responses. In terms of the degree of adverse medication responses, the majority were found to be
light [Level 1 (38.4%). Patients under the age of 18 experienced much more severe adverse medication responses than did
adults and the elderly. According to a severity evaluation, the majority of adverse medication responses (47.6%) were not
severe. The majority of negative drug reactions (97.9%) were likely avoidable.
Conclusion: Most reported cardiac adverse drug reactions were low in intensity, predictable, not life-threatening, and most
likely preventable. The lack of information in the Individual Case Safety Report (ICSR) impacted how the reports were
evaluated, necessitating the creation of training initiatives to create a stronger reporting system.
Keywords: Cardiotoxicity, Cardiovascular Diseases, Morbidity, Retrospective Studies, Iraq.
INTRODUCTION
related to medication use, and communication with and
Pharmacovigilance refers to the studies and
education of stakeholders and patients. When a new
procedures centered on the detection and evaluation,
pharmaceutical product initially enters the market, the
comprehension, and avoidance of any other effects related
Marketing Authorization Holder (MAH) must give the
to drug problems (1). Pharmacovigilance has recently
Summary Product Characteristics (SPC), may be changed
broadened its scope to include vaccines, medical
by CAs (Controlling Authorities) based on recently
equipment,
biologicals,
and
blood
products
discovered signals as part of this smooth after-sales
complementary and alternative medicines. Numerous
monitoring, which is essentially intended to protect the
other issues are also pertinent to science, including subpar
public (3).
medications, medicine mistakes, not being effective data,
The proliferation of fake medications, which causes
the use of medications for conditions for which they have
significant morbidity and mortality, the happening of
not been accepted and for which little scientific evidence
preventable unfavorable effects of drugs, a rise in the cost
exists support, case studies of both acute and long-term
of healthcare due to adverse drug events, an increase in
toxicity, estimation of drug- associated death, drug
the inappropriate use of medications, the development of
misuse, abuse, and unfavorable interactions between
drug resistance, treatment failures necessitating the switch
medications and foods, chemicals, and other medications.
to m
ore expe
nsi
ve
m
edications, and ultimate death are all
The objectives of pharmacovigilance are to enhance
effects of ineffective pharmacovigilance systems (weak
the use's impact on patient safety of treatments, as well as
or absent pharmacovigilance systems) (4).
public safety on the administration of drugs. They also
Adverse effects of drugs "A response to a substance
include encouraging safe, logical, and more effective use
that is noxious and undesired and occurs at dosages
of medications that is also cost-effective, as well as
usually employed in man for the prophylaxis, diagnosis,
promoting understanding education and clinical training
or therapy of disease, or alteration of physiological
in pharmacovigilance (2).
function" is how the WHO defines an adverse drug
Activities related to pharmacovigilance include
reaction (5). Alternative phrases like "toxic impact" or
data collection and management on medication safety,
"side effect" should be avoided in favor of "adverse
analysis of particular case reports to find new "signals,"
effect." A toxic effect is uncommon at normal levels and
proactive risk management to reduce any potential risks
arises as an exaggeration of the desired therapeutic Effect.
1698
Received: 27/07/2022
Accepted: 29/09/2022
c:\work\Jor\vol901_256
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1707-1712
A Comparative Study of The Diagnosis of Toxoplasma Gondii in
Human Placenta by Traditional Method, Restriction Fragment Length
Polymorphism, and The Immunohistochemistry Method
Saafa Ressan Abdullah Al-Kaeebi 1*, Ghaidaa Abass Jasim Al- Jubouri 2
1 College of Nursing, Al-Qadisiya University, Iraq.
2 College of Veterinary Medicine, Al-Qadisiya University, Iraq.
* Corresponding author: Saafa Ressan Abdullah Al-Kaeebi, Mobile: 009647801827487 Email: safaa.abdullah@qu.edu.iq
ABSTRACT
Introduction: Toxoplasma gondii is an animal source of great importance in veterinary and public health.
Objective: The aim of this study was to detect genotyping of T. gondii by PCR-RFLP and to detect infection in placental
tissue by immunohistochemistry (IHC) and to determine whether there is a correlation between the results obtained by this
method and those obtained by through the traditional Impression method.
Material and methods: A total of 100O samples of placenta were selected for women who had aborted in the first months
of pregnancy. In the beginning, all samples were stained with Gimsa stains using the steps of the Impression method, in
which 40 (40%) samples were diagnosed with Toxoplasma infection, and 60 (60%) samples were not infected with
Toxoplasma. The GRA6 gene was then amplified using the PCR method for all 40 positive tissue samples. In addition, an
MseI exonuclease (PCR-RFLP) was added to all PCR products resulting from the amplification of the gene.
Results: After performing PCR-RFLP, it was discovered that the number of samples belonging to type I is 19, 13 for type
II, and 2 for type III. The percentages were 47.5%, 32.5%, and 5% for the 3 types, respectively. Only 4 unknown and 2
negative samples were recorded. As for using the tissue immunohistochemistry method, and after tissue cutting of the 40
samples and the use of DAB, the result was 38 samples infected with toxoplasma plasma, which constituted 95%, while 2
samples were not infected with a percentage of 5%.
Conclusion: Several techniques can be used, but the immunohistochemistry technique is considered as a confirmatory test
to classify aborted women into T. gondii infected women and non T. gondii infected women, and that PCR -RFLB method
enables the identification of the most important species of Toxoplasma widespread.
Keywords: Toxoplasma gondii, Impression method, PCR-RFLP, immunohistochemistry, Experimental study, Al-Qadisiya
University.
INTRODUCTION
isolation of the parasite, serological tests, genomic
Toxoplasma gondii is a single parasite caused
method, and immunohistochemistry detection (6).
Toxoplasmosis. This parasite is an intracellular binding
Epidemiological studies have identified the most
parasite, commonly known as toxoplasmosis; it causes
important and dangerous modes of transmission of the
toxoplasmosis, a common disease among others. In
parasite: owning cats, eating raw or unwashed fruits and
humans and animals, in addition to being spread among
vegetables, eating raw or undercooked lamb, beef and
individuals suffering from immunodeficiency, while
minced meat products, animal husbandry, and handling
immune healthy people are asymptomatic, the incidence
soil (7,8). Serological methods depend on sensitivity and
ranged from less than 10% to about 90% depending on
specificity (based on the complex immune mechanism)
the diagnosis of parasite antibody counters (1). The
including affinity (9). The LAT test is the standard test for
parasite is characterized by its ability to invade all
Toxoplasma
antibody
detection
worldwide,
nucleated cells and multiply inside them and move to
immunofluorescence tests (lFAT) and rarely by ELISA
various organs in the host's body, leading to the spread of
(10,11). Immunohistochemistry can detect antigens in cells
infection in the body, which indicates the parasite's
of a tissue section depending on the principle of
ability to penetrate different life barriers such as the
specificity of the binding of antibodies specifically to
placenta (2). From pregnancy, it leads to various congenital
antigens in biological tissues (12).
malformations of the fetus and this may lead to
miscarriage (3).
MATERIALS AND METHODS
Due to the fact that the clinical signs resulting from
Sample collection. The study samples were collected
toxoplasmosis infection are not clear, so they cannot be
from the Maternity and Children Hospital in Al-
relied upon for diagnostic purposes. Therefore, laboratory
Diwaniyah and Al-Furat Private Hospital, where 100
diagnosis is the main method for detecting the infection.
placentas were collected from aborted women during the
There are many laboratory diagnostic methods that have
first months of pregnancy in the maternity halls of these
been used in research and studies (4,5). Impression smear,
hospitals.
1707
Received: 27/07/2022
Accepted: 29/09/2022
c:\work\Jor\vol901_257
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1713-1720
Comparison of The Laparoscopic Approach Versus The Vaginal Route
Closure of Vaginal Cuff during Total Laparoscopic Hysterectomy
Mohamed Abd Elaleem Ibrahim Nassef1, Samia Mohamed Eid1,
Ehab Mohammed El helw1, Adel Fathi Mohammed2
1Department of Obstetrics and Gynecology Department, Damietta Faculty of Medicine - Al-Azhar University, Egypt
2Department of Surgical Oncology, Oncology Center-Mansoura University, Egypt
*Corresponding author: Mohamed Abd Elaleem Ibrahim, Mobile: (+20) 01014051556, E-Mail: nasf20062000@gmail.com
ABSTRACT
Background: One significant procedure in the field of gynaecology with several indications is the hysterectomy.
Hysterectomy has become less intrusive and has less risks thanks to improvements in surgical technique and materials.
Total laparoscopic hysterectomy (TLH) is currently a popular practise in gynecologic surgery.
Objective: To compare the effects of the laparoscopic approach versus the vaginal route for the management of vaginal
cuff closure during total laparoscopic hysterectomy.
Patients and methods: The present study was a randomized controlled study conducted on 40 women attending the
outpatient gynecology clinic of Al-Azhar University Hospital (New Damietta) and were planned to undergo
hysterectomy for benign causes according to the inclusion/exclusion included in the study. The present study was
conducted on two groups Group A had vaginal suturing for vaginal vault after total laparoscopic hysterectomy; Group
B had laparoscopic suturing for virginal vault after total laparoscopic hysterectomy.
Results: Operative time in minutes and suturing time showed significant increase in group 2 (laparoscopic suture) when
compared to group A (vaginal suture) (P=0.012 and >0.001) respectively. VAS score show significant increase in group
A when compared to group 2 (p<0.001). Post-operative complications, post-operative vaginal bleeding, Vaginal cuff
hematoma, Vaginal dehiscence, post-operative infection showed significant increase in group A when compared to
group 2. Blood loss showed significant increase in group A when compared to group 2 (p=<0.001). Previous CS and
BMI didn't significant correlation with operative time in minutes (p>0.05).
Conclusion: Laparoscopic vaginal cuff closure for complete laparoscopic hysterectomy appears to be secure, simple,
and efficient. However, it requires more time than vaginal suture closure.
Keywords: Laparoscopic approach, Vaginal route closure of vaginal cuff, TLH.
INTRODUCTION
difficulties can be reduced by closing the vaginal cuff
Following a caesarean birth, hysterectomy the
correctly and using the right suture material (4).
most common kind of often performed surgical
In the history of gynecologic surgery, there have
procedure on the female vaginal tract (1).
been many different methods used to close the vaginal
As the final stage of TLH, the vaginal cuff is sewn.
cuff during hysterectomy, including laparoscopic
Depending on the surgeon's preferences, a range of
interrupted figure-of-eight suturing, interrupted
methods and sutures are available. Interrupted or
suturing, knotted double-layer running suturing, and
continuous suturing, extracorporeal or intracorporeal
barbed running suturing are all used (5).
procedures, and transvaginal cuff closure are among
The vaginal cuff closure, which has several
options for laparoscopic suturing (2).
variants in surgical technique and materials, is an
Due to the challenging nature of laparoscopic
important part of hysterectomy. This article provides a
suturing procedures, the most important part of the
summary of intracorporeal suturing and knot-tying
vaginal cuff closure challenging aspect of TLH. The
techniques at the level of a junior resident in obstetrics
need for specialized surgical skills, a steep learning
and gynaecology and contains several validated models
curve, and a lengthy process are all significant
that have been developed to gauge resident competence
drawbacks of surgery. In a questionnaire research,
level in vaginal cuff closure (4).
surgeons admitted that the technical challenges of TLH
This study aimed to compared the outcomes of the
prevent them from conducting it as frequently as
vaginal and laparoscopic approaches for managing
abdominal or vaginal hysterectomy (3).
vaginal cuff closure after complete laparoscopic
Following TLH, vaginal cuff complications
hysterectomy.
include dehiscence, infection, hematomas, and healing
SUBJECTS AND METHODS
issues are rather common. The vaginal cuff dehiscence
rate after laparoscopic and vaginal hysterectomies
Study setting: Al-Azhar University Hospital (New
ranges from 0.1% to 0.2%. On the other hand,
Damietta).
minimally invasive methods are thought to have a rate
Study design: Blind randomized controlled study.
that is 510 times greater (3).
Study population: The patients were recruited
Early coit after surgery, early excessive exercise,
from women attending the outpatient gynecology
diabetes, and corticosteroid usage all raise the chance of
clinic of Damietta Hospital Al-Azhar University
vaginal cuff problems. Nevertheless, cuff closure
and were planned to undergo hysterectomy for
benign causes according to the inclusion/exclusion
1713
Received: 10/09/2022
Accepted: 12/11/2022
c:\work\Jor\vol901_258
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1721-1730
Pediatric Vascular Injuries, Patterns of Injury and Outcome
Joseph Morris Philip*1, Mohammed E. Ahmed1, Samir M. Attia2, Ahmed D. Mohammed3
Departments of 1Emergency and Critical Care, 2
Vascular Surgery and 3Pediatrics, Faculty of Medicine, Mansoura University, Egypt
*Corresponding author: Joseph Morris Philip, Mobile: (+20)01558888434, Email: josephmoorris@gmail.com
ABSTRACT
Background: Paediatric vascular injuries differ from adult subjects in that significant injuries are more challenging to
be detected since they are asymptomatic, are associated with spasm, or have other more serious life-threatening injuries
which take priority in the resuscitation.
Objective: This study was carried out to review the pattern of vascular injury in pediatrics, and its effect in outcome.
Methods: This work was prospective observational clinical study that was carried out on pediatric trauma patients
presented at Emergency Department (ED) in Mansoura University Emergency Hospital over period of one year, from
September 2021 to August, 2022. The study included 103 patients.
Results: The current study demonstrated that the majority of injuries were penetrating (62.1%), while 37.9% were blunt.
Most of injuries were in the upper extremities, involving mostly brachial artery (28.3%), brachial vein (21.7%), and
ulnar and radial vessels (23.3%). Regarding operative management lines, primary repair was performed in the majority
of the cases (31.6%), followed by repair with vein patch (26.3%), and ligation (24.6%). The majority of the cases were
admitted in ward (69.9%), while 30.1% were admitted in ICU. A statistically significant association was detected
between injuries of the upper extremities and median duration of hospital stay among the studied cases.
Conclusion: It can be concluded that optimal management of vascular injuries in children necessitates expedient
diagnosis and treatment, with readily available access to a multidisciplinary team who have experience in paediatric
trauma. The selective usage of arteriography is beneficial in injury diagnosis and subsequent surgical or non- surgical
management. Computed tomography angiography can be a significant tool for initial evaluation.
Keywords: Pediatric extremity vascular injuries, Pediatric Trauma Society, Blunt trauma, Penetrating trauma.
INTRODUCTION
significance of familiarity with such techniques for
Non-iatrogenic vascular injuries in children are
effective management (6).
not common. It was estimated that major trauma centers
Vascular surgeon staffing is most commonly
treat less than 5 patients every year (1). Rapid diagnosis
responsible for managing complex vascular injuries and
is essential, with a 97% recovery rate in children in
a previous study showed that free-standing children's
whom proper diagnosis was made. The treatment of this
hospitals were less likely than dual-certified centers to
population is complex. Paediatric trauma cases might
have vascular surgeons staff or immediate availability
present with undiagnosed vascular injuries which are
(7). Blunt trauma is responsible for the majority of MVIs
masked by vasospasm and the existence of associated
in trauma patients of all ages; however, a penetrating
multi-system injuries. Additionally, vascular injuries
mechanism of injury occurs with more frequency
are often associated with other life threatening, and
(almost 50%) in children (8). Paediatric Trauma Society
therefore distracting, conditions. Lastly, there are no yet
demonstrated a decrease in mortality with tourniquet
available guidelines for the management of paediatric
use in pediatric combat casualties (9).
trauma patients (2).
In children, vascular trauma of extremities are
AIM OF WORK
uncommon with an incidence of < 1%. Though vascular
The current study was done to review the
injuries in paediatric population are linked to lower
pattern of vascular injury in pediatrics, and its effect in
mortality compared to in adults, the incidence of limb
outcome.
loss and poor functional outcomes are similar. In the
previous decade, guidelines for managing extremity
PATIENTS AND METHODS
vascular injuries in adult patients have been developed.
This was prospective observational clinical
However, there are no yet available guidelines for the
study carried out on pediatric trauma patients presented
management of paediatric trauma patients, and adult
to Emergency department (ED) in emergency Mansoura
guidelines might not be appropriate for children (3).
university hospital over a period of one year from
Due to their smaller vessels and the associated
September 2021 to August 2022.
spasm, children present distinct management-related
The study included pediatric trauma patients
challenges (4). Moreover, endovascular techniques is
aged less than 16-years old arrived to ED with vascular
usually difficult because of vessel size and is usually
injury and treated by members of ED. But we excluded
discouraged due to children's increased life span and
patients aged more than 16 years old & less than one
further vessel growth (5). Open vascular exposures are
year and with no vascular injury can be detected.
rarely encountered in surgical training, highlighting the
1721
Received: 09/09/2022
Accepted: 12/11/2022
c:\work\Jor\vol901_259
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1731-1736
Development and Validation of Libyan Accent Bi-Syllabic and Monosyllabic
Speech Perception Test in Adults: Data from Zagazig University
Soha Abdelraouf Mekki1, Elham Magdy Hassan2, Amel Faraj Ali Dayhum1, Dalia Helal Galhom1
Departments of 1Audio-vestibular Medicine Unit E.N.T. and
2Phoniatrics E.N.T., Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Amel Faraj Ali Dayhum, Mobile: (+20)01028430091, E-mail: amola272017@gmail.com
ABSTRACT
Background: The purpose of this study was to develop and verify the test materials for a speech perception testing for
adults in Libya. Such materials are useful for administering speech evaluations to native Arab adults who speak with a
Libyan accent.
Objective: This study is a component of a larger initiative to prepare and validate the speech materials for the Arabic-
speaking community in Libya.
Methods: In this cross-sectional study, two lists of bisyllabic (spondees) words and monosyllabic phonetically balanced
words were constructed . The two selected 100- bisyllabic and monosyllabic word lists were presented to 120 normal
hearing participants with the age range of 18 to 50 years. Tests of validity and reliability were conducted to assure the
suitability of this material for the speech regocnition test and speech discrimination score (SRT and SDS).
Results: The two developed Libyan word lists (SRT and SDS) showed high face and content validity, kappa P-value
was <0.001 with high signifiicant, Cronbach`s alpha coefficient was 0.82, 0.71 for the (SRT and SDS) respectively, and
intra-class correlation coefficients reliability (p<0.001) were also statstically significant.
Conclusion: The data analysis shows that the SRT of both Libyan and Egyptian lists have high degree of validity and
reliability. Meanwhile, SDS of Libyan accent list is of higher statistical significance than Egyptian list. As a result, the
scale's development of the Libyan accent has strong psychometric characteristics, making it suitable for usage in the
Libian region.
Keywords: Speech audiometry, SRT (bisyllabic), SDS (monosyllabic) of arabic Libyan accent.
INTRODUCTION
percentage either at a level close to the SRT or the mean
Speech audiometry, which measures a person's
of the pure tone thresholds (7).
capacity for understanding and processing speech, is
SDS has been developed for several languages and
regarded as a standard audiological evaluation since it
dialects. However, for the Arabic language, a few
enables us to distinguish between the sounds, words,
attempts have been made to develop a standardized
and syllables spoken by the speaker (1). The effect of
Arabic test that can reliably be used beyond specific
hearing loss on a person depends on how much their
country (8).
ability to understand speech is impacted (2).
To our knowledge, this is the first study in Zagazig
Improvement in speech perception is seen to be
University Hospitals for development of speech
one of the main objectives of treating hearing
audiometry by Libyan accent including bisyllabic and
impairment. The rehabilitation method is effectively
monosyllabic of SRT and SDS respectively. Hence, this
chosen, planned, carried out, and evaluated using
study was conducted in order to improve the
speech audiometry (3).
audiological assessment of Libyan patient.
Variable speech audiometry testing has been
created and enhanced during the past 50 years to
Topics and Approaches:
evaluate various speech characteristics, such as speech
This cross-sectional research was carried out and
reception thresholds (SRT), which checks the validity
verified at the Libyan organization as a form of test
of pure-tone test findings. Meanwhile, speech
development study, in primary care unit.
discrimination score (SDS) is useful in the differential
analysis of the auditory system's lesion location (4).
SUBJECTS AND METHODS
According to ASHA, the SRT is the minimal
Constructing an item:
hearing threshold at which a person can recognize 50%
Expert audio-vestibular medicine consultants created
of the spoken information. SRT testing is reliable in its
the test items and phoniatric specialist from the Zagazig
agreement with puretone threshold (5).
University reviewed the international and Arab studies
The SDS is considered an essential component of
on SRT and SDT tests. Additionally, the entire list of
speech audiometry. It assesses a person's capacity to
roughly 200 renowned words was used to create
accurately understand and repeat a list of phonetically
substitute word lists that were equivalent to the original
presented words when they are offered at a pleasant
exam bisyllabic and monosyllabic words from the
supra-threshold level (6). SDS is done employing
Libyan Arabic dialect. The target was to find two (SRT
phonetically or phonemically balanced sets of single-
and SDS) lists, each list consisting of 100 bisyllabic
syllable words. It is measured in form of correct
(spondee) words and100 monosyllabic (PB) words
suitable for adults aged between 18 and 50 years.
1731
Received: 05/09/2022
Accepted: 08/11/2022
c:\work\Jor\vol901_260
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1737-1743
Predictors of Stroke Outcome in Children Admitted to
Assuit University Children Hospital
Maher Mokhtar Ahmed1, Ismail Lotfy Mohamed1, Ahlam Abdelbaset Mohamed*1
1Department of pediatrics, Faculty of Medicine, Assuit University, Egypt
*Corresponding author: Ahlam Abdelbaset Mohamed
E mail: ahlamloma39@gmail.com, Mobile phone: 00201067815663
ABSTRACT
Introduction: It is possible to distinguish between ischemic and hemorrhagic strokes based on the abrupt loss of brain
function they cause. Thrombotic disease is the most frequent cause of ischemic stroke, which affects children more
frequently than adults, accounting for 30% to 60% of occurrences. Although less frequent in children, arteriovenous
malformation is the main cause of hemorrhagic stroke.
Objectives: To detection of the rate, the possible etiology and outcome in pediatric patients with stroke "ischemic or
hemorrhagic".
Patients and methods: a prospective cohort study conducted, in different Pediatric Units "the Intensive Care Unit,
Intermediate Care Unit and Neurological Department", Assuit University Children Hospital from the first of January
2020 to the end of December 2021. 52 patients with stroke were included and subjected to clinical history and full
examination and detailed information about stroke; type, severity, and etiology and subsequent complications: arterial
ischemic stroke (AIS) or hemorrhagic stroke (HS), stroke location, and needed investigations were done.
Results: A stroke is characterised by a sudden loss of brain function brought on by a reduction in cerebral blood flow,
divided into ischemic and hemorrhagic stroke. it was found that vasculopathy was the only significant predictor for
stroke recurrence and also recurrence and hydrocephalus were significant predictors for death among pediatric patients
with stroke.
Conclusion: There is a high mortality rate among pediatric patients with stroke; either ischemic or hemorrhagic.
Establishing stroke recurrence predictors may enable more efficient therapy, which may lower the incidence of cases.
Keywords: Stroke, Vasculopathy, Arterial ischemic stroke
INTRODUCTION
frequent cause of ischemic stroke is thrombotic, which
A stroke is characterised by a sudden loss of brain
affects children more frequently and accounts for 30%
activity brought on by a reduction in cerebral blood
to 60% of occurrences.
flow. It can happen at any stage of life, but how it
Hemorrhagic stroke, however less frequent in
manifests itself varies with age, artery involvement, and
children, is primarily brought on by arterio-venous
underlying risk factors. Particularly those under the age
malformation. Studies like the International Pediatric
of one-year, younger children typically appear with
Stroke Study (IPSS) have identified systemic risk
non-specific symptoms like seizures and disturbed
factors for paediatric stroke, including meningitis,
mental state, whereas older children typically show with
sepsis, and encephalitis as well as cardiac disorders,
focal neurologic abnormalities like hemiplegia (1).
trauma, and sickle cell disease. However, in the
Hemorrhagic and ischemic strokes in children can
majority of cases, no systemic disease was discovered
both occur. Ischemic stroke is characterised as localised
(3).
brain tissue injury inside a vascular region brought on
The main aim of the study was the detection of the
by a reduction in blood flow or oxygenation. In terms of
rate, the possible etiology and outcome in pediatric
processes and distribution, it is distinct from diffuse
patients with stroke "ischemic or hemorrhagic".
hypoxic-ischemic damage. In addition to venous
infarction, which is brought on by a loss of flow in a
PATIENTS AND METHODS
draining cerebral vein or venous sinus, ischemic stroke,
This study was a prospective cohort study
which accounts for 55% of paediatric strokes, can also
conducted, in different Pediatric Units "the Intensive
be categorised as arterial ischemic stroke (AIS), which
Care Unit, Intermediate Care Unit and Neurological
is brought on by a lack of arterial flow. Intra-
Department", Assuit University Children Hospital from
parenchymal hemorrhage and spontaneous (non-
the first of January 2020 to the end of December 2021.
traumatic) subarachnoid bleeding are both considered
52 patients with stroke were included.
hemorrhagic strokes. A main venous sinus that drains
the brain parenchyma is obstructed by a clot in cerebral
Inclusion criteria: Gender: boys and girls, age: from 1
sino-venous thrombosis (CSVT) (2).
month up to 18 years, patients who were diagnosed as
Children have different risk factors for stroke than
stroke (hemorrhagic or ischemic) by CT or MRI and
adults do. Obstructive atherosclerosis, arteriopathy,
acceptance of caregivers to participate in the study.
cardiovascular disease, and arrhythmias are the main
risk factors in adults; same conditions are rarely risk
Exclusion criteria: Neonates (less than one month),
factors in children. The two main causes of stroke in
stroke caused by trauma, children or parents who
children are ischemic and hemorrhagic. The most
refused to participate in this study.
1737
Received: 09/09/2022
Accepted: 12/11/2022
c:\work\Jor\vol901_261
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1744-1751
Formulation and Evaluation of Prednisolone Acetate Microemulsion Ocular Gel
Reem Abdualfaris Al-Rubaye1, Khalid Kadhem Al-Kinani2
* National Center for Drug Control and Research, Ministry of Health and Environment, Baghdad, Iraq
** Department of Pharmaceutics, College of Pharmacy, University of Baghdad, Baghdad, Iraq
Corresponding Author: Reem Abdualfaris Al-Rubaye, Telephone: +9647818821151,
E-Mail: reem.abdulfaris1200m@copharm.uobaghdad.edu.iq
ABSTRACT
Background: Prednisolone acetate is a glucocorticoid used to treat steroid-responsive inflammation repeatedly during the
day, and the primary concerns with its 1% suspension and 0.5% commercial ointment include impaired vision and poor
patient compliance. Objective: The aim of the current study was to create a prednisolone acetate ophthalmic
microemulsion-loaded gel to improve dose accuracy, bioavailability, and consequently the efficacy of prednisolone
acetate in treating inflammatory ocular disorders and patient adherence. Material and methods: A unique formulation
was created by combining prednisolone acetate microemulsion with a different gelling agent to create a microemulsion-
loaded gel. Results: The melting points determined from differential scanning calorimetry (DSC) and the capillary tube
technique are extremely close to the standard, indicating the purity of the prednisolone acetate utilized. The best recipe
(G2), a microemulsion-loaded gel with 1% carbopol934, had a white milky hue, high homogeneity, spreadability, and
gelling capability. The drug content was 99.76%. The pH of the produced gels is comparable to that of eye tears and is not
irritating to the eye. The FTIR data show that there is no interaction between the pure medicines and any of the excipients.
When integrated into an optimal microemulsion-loaded gel formulation, drug release as obtained in Sorensen phosphate
buffer saline (pH 7.4) attained an average of 97.51% in 8 hours. Ex vivo permeation studies further validated the two-fold
increase in drug flow through the cornea from MEs-loaded gel compared to marketed ointment.
Conclusion: Prednisolone acetate microemulsion-based gel (G2) ocular drug delivery system provides a potential strategy
for enhancing corneal contact, penetration, and flux for ME-loaded gel formulations compared to the control; Extended
precorneal retention in the eye resulting in prolonged medication release, increased bioavailability, and patient
compliance.
Keywords: Prednisolone acetate, Carbopol934, Microemulsion, In-vitro drug release, Ocular drug delivery.
deeper ocular tissues. Despite this, nanotechnology is
INTRODUCTION
now part of a new age in which breakthroughs in new
From an anatomical and physiological perspective,
technology have enabled the development of various
the eye is a special organ since it has a variety of
nanosystems capable of overcoming (the enormous
structurally very diverse and physiologically very
complexity of the eye's structure, including its
different parts. For instance, the cornea is a human tissue
anatomical
and
physiological
obstacles).
The
that is not supplied with blood (1). Protecting internal eye
development of materials on a micro scale is
structures, assisting with the eye's refractive power, and
characterized as nanotechnology (5). Microemulsions are
concentrating light rays on the retina with the least
defined as dispersions of water and oil in the presence of
amount of scatter and optical deterioration are just a few
a surfactant and cosurfactant combination (Smix) that
of its crucial corneal tasks (2). The eye, an important
reduces interfacial tension. (MEs were categorized as
visual organ, is composed of two main parts, anterior
o/w, w/o, or bicontinuous based on the nature of
segment and posterior segment (3).
dispersion and disperse phase. These systems are often
Drug distribution to the eye is a difficult endeavor
distinguished by their clear appearance, greater
owing to the eye's intrinsic and complex anatomical and
thermodynamic stability, tiny droplet size (<200 nm),
physiological barriers. These barriers are also dependent
and good drug solubility, as well as their use as a drug
on the mode of delivery, which might be topical,
reservoir for lipophilic and hydrophilic medicines (6).
systemic, or injectable. Because of its convenience of
Furthermore, they achieve prolonged release of a
administration and high patient adherence, topical
medication administered to the cornea as well as deeper
instillation of dosage forms such as solutions,
ocular structural penetration than the original drug (7).
suspensions, and ointments is the recommended method
One of the most dreadful aftereffects of intraocular
for anterior segment distribution (4). The main issue with
surgery is post-operative endophthalmitis (POE), for
these traditional topical administration methods is their
which 1% prednisolone acetate (PA) ophthalmic solution
limited bioavailability. Furthermore, several precorneal
must be used at least three to four times daily (8,9).
variables impact topical dosage form bioavailability,
Prednisolone acetate, a glucocorticoid used to treat
resulting in less than 5% of the injected dose reaching
steroid-responsive inflammation of the palpeberal and
1744
Received: 05/10/2022
Accepted: 31/12/2022
c:\work\Jor\vol901_262
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1752-1759
Effect of Topical Combined Beta-Blockers and Carbonic Anhydrase Inhibitors on
Corneal Epithelial Thickness by Anterior Segment Optical Coherence Tomography
Fatma Khaled Nasser Ali*, Hamdy Ahmed El-Gazzar,
Ahmed Abdel-shafy Tabl, Mohamed Abdel-Zaher Awwad, Taher Kamel Eleiwa
Department of Ophthalmology, Faculty of Medicine, Benha University, Egypt
*Corresponding author: Fatma Khaled Nasser Ali, Mobile: (+20) 01067271686, Email: doctortotti123@gmail.com
ABSTRACT
Background: Prolonged usage of topical antiglaucoma medications may result in ocular surface disease (OSD) that
impairs both life quality and medication adaptation. Objective: The aim of the current study is to assess corneal
epithelial thickness (CET) changes using anterior segment optical coherence tomography (AS-OCT) in patients using
topical combination of beta-blockers and carbonic anhydrase inhibitors (CAIs).
Patients and Methods: A total of 100 eyes of 80 participants were assessed in a randomized controlled clinical trial.
Group A included 50 eyes of 40 glaucoma patients treated with combined topical Beta-blockers and CAIs with at least
3-month duration, while Group B included 50 eyes of 40 healthy participants with completely normal
ophthalmological examination. All candidates received AS-OCT imaging with subsequent automated CET and total
corneal thickness (CT) mapping.
Results: Group A had a mean age of 49.84 (SD 4.83) years, while Group B had a mean age of 49.44 (SD 4.81) years
(P=0.679). CET was considerably lower in all regions in Group A 45.94 (SD 3.96) µm compared to Group B 54.54
(SD 3.16) µm; (P-value<0.001). Regarding CT, 8 out of 25 regions were significantly lower in eyes of Group A
compared to Group B. There were significant positive correlations between break up time test (BUT) and CET in
Group A. Conclusion: Topical antiglaucomatous medications seem to affect CET in glaucoma patients as CET was
thinner in glaucoma patients, in all regions, than controls, while these medications seem to focally affect CT in some
regions. Further studies are required to assess the clinical implications of these findings.
Keywords: Beta-blockers, Carbonic Anhydrase Inhibitors, Glaucoma, Corneal epithelial thickness, Optical coherence
tomography.
INTRODUCTION
invasive and had multiple sources of error, corneal
High intraocular pressure (IOP) and progressive
epithelial thickness (CET) is presently used to assess
optic neuropathy are frequently linked with glaucoma
ocular surface damage (13).
(1). Using a topical IOP-lowering medication on a daily
Measuring corneal epithelial thickness (CET)
basis causes ocular discomfort owing to its effects on
may provide a novel tool to evaluate corneal epithelial
the ocular surface (2,3).
changes (CET). This evaluation has become possible
It is probable that both the active ingredient and
by using the noninvasive imaging tool known as
the preservatives of IOP-lowering eye drops contribute
anterior segment optical coherence tomography
to their negative effects on the ocular surface (4). The
(ASOCT) (14). CET is an important and unique
most popular preservative in antiglaucoma medications
parameter which provides information about the ocular
is benzalkonium chloride (BAK), a quaternary
surface in the early stages of corneal epithelial changes
ammonium compound that has been found to generate
during glaucoma treatment (13,15).
considerable corneal cytotoxicity (2,3,5).
In order to have a better knowledge about corneal
Using topical antiglaucoma medications on the
epithelial abnormalities in glaucoma patients, this
long run may cause ocular surface disease (OSD),
study analyzed the corneal epithelial thickness (CET)
which decreases life quality and medication adaptation
using ASOCT in patients on topical glaucoma
(4,6). Fifteen to 50% of glaucoma patients have serious
medication (topical combined beta-blockers and
side effects, such as local allergic responses, chronic
CAIs).
conjunctival inflammation, aberrant tear film, and
corneal epitheliopathy (79).
PATIENTS AND METHODS
Glaucoma medications have great effects on the
A randomized controlled clinical trial was
cornea including all epithelial layers, stroma, and
conducted on 80 participants recruited from
endothelium (10). The corneal epithelium, exposed to
Ophthalmology Outpatient Clinics Benha University
continuous glaucoma therapy, exhibits cellular
Hospitals. Participants were split into two distinct
alterations and inflammatory infiltration that may
groups:
interfere with its influence in ocular surface
- Group A (Topical combined Beta-blockers and
homeostasis and corneal trophism (5).
Carbonic Anhydrase Inhibitors eye drops group): 40
Several objective tests, Schirmer, tear film break-
patients treated with topical combined Beta-blockers
up time (TBUT), and in vivo confocal microscopy
and Carbonic Anhydrase Inhibitors eye drops
have been utilized to identify ocular surface disease
(Dorzolamide HCL 2% & Timolol Maleate 0.5%) for
(OSD) (11,12). Due to the fact that prior methods were
more than 3 months.
1752
Received: 23/08/2022
Accepted: 26/10/2022
c:\work\Jor\vol901_263
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1760-1763
Treatment Options of Onychomycosis: Review Article
Nermeen Sabry Ibrahim Elsayed*1, Alshimaa Mohamed Ibrahim1,
Hala Mohamed Morsi1, Eman Salah Elgharabawy2
Departments of 1Dermatology, Venereology & Andrology and
2Medical Microbiology and Immunology, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Nermeen Sabry Ibrahim Elsayed, Mobile: (+20) 01000296188, E-Mail: nermeenasabry25@gmail.com
ABSTRACT
Background: The most frequent nail problem observed in clinical practice is onychomycosis, a fungal infection of the
toenails or fingernails caused by dermatophytes (also known as tinea unguium), non-dermatophyte moulds, or yeast. Many
patients with Onychomycosis are resistant to most therapeutic modalities, making it difficult to determine the appropriate
course of treatment. This may contribute to the high rate of recurrence.
Objective: Review of the literature on treatment options of onychomycosis.
Methods: In an effort to learn more about onychomycosis, we looked through resources like PubMed, Google Scholar,
and Science Direct. However, only the most recent or extensive study was taken into account between January 2012 and
May 2022. Relevant literature references were also evaluated by the writers. There are not enough resources to translate
documents into languages other than English, hence those documents have been ignored. It was generally agreed that
documents such as unpublished manuscripts, oral presentations, conference abstracts, and dissertations did not qualify
as legitimate scientific study.
Conclusion: Topical antifungals are ineffective if applied to the nail plate without first debriding the nail bed, whereas
oral therapy for Onychomycosis is limited by medication interactions and possible hepatotoxicity. Combinations of
systemic and topical treatments seem to be the most successful overall.
Keywords: Onychomycosis, Topical antifungals are ineffective, Treatment options.
INTRODUCTION
In clinical practice, the most common nail problem
is onychomycosis, a fungal infection of the fingernails
or toenails caused by dermatophytes (also called tinea
unguium), non-dermatophytic moulds, or yeast.
Onychomycosis can affect the matrix, the bed, or the
plate of the nail unit (1).
The thickening, discoloration, and separation of the
nail plate from the nail bed are all clinical
manifestations; this is a serious problem because it can
cause local pain, paresthesias, difficulty with activities
Figure (1): Nail plate is entirely infected with fungi,
of daily living and social interactions, as well as serious
causing it to become brittle and prone to splitting, a
physical and occupational limitations and a decrease in
condition known as total onychomycosis (5).
life quality (2).
About 5.5% of people all over the world suffer with
Treatment:
infectious onychomycosis, a fungal infection of the
Many patients with Onychomycosis are resistant
nails. This fungus is responsible for up to 50% of all nail
to most therapeutic modalities, making it difficult to
infections and 30% of all superficial fungal skin
determine the appropriate course of treatment. This may
infections (3).
contribute to the high rate of recurrence. The degree to
Different environmental media, like hotel carpets,
which a patient benefit from treatment depends on a
public showers, and pool decks, are viable sources from
number of different prognostic markers. An effective
which we might collect and cultivate the fungi; the
method for evaluating the severity of onychomycosis
moist, restricted environment of tight shoes and
and predicting a patient's response to treatment is the
microtrauma of the nail might enable rupture of the
Onychomycosis severity index (OSI). Patients with
hyponychium seal and infection of the nail bed, leading
mild disease have a better chance of recovery with
to onychomycosis in the toenails.
treatment than those with moderate disease, and vice
While in fingernails it might occur owing to
versa for those with severe disease (6).
continuous exposure to water for employees or
housewives (4).
1760
Received: 09/09/2022
Accepted: 12/11/2022
c:\work\Jor\vol901_264
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1764-1769
Relation between Hypercoagulability Effect of COVID-19 and the
Occurrence of Acute Coronary Syndrome
Ragab Abd Elsalam Mahfouz, Mohey-Eldin Abo Elfetouh Eldeeb,
Randa Essam Mohammed Hamouda, Ahmed Said Eldamanhory
Cardiology Department, Faculty of Medicine - Zagazig University, egypt
Corresponding author: Randa Essam Mohammed Hamouda, Email: Randaahmed40@gmail.com, Mobile: 01202121120
ABSTRACT
Background: The coronavirus illness of 2019 (COVID-19) is caused by the severe acute respiratory syndrome coronavirus
2 (COVID-2) (SARS-CoV-2). Although systemic inflammation and lung complications can result in significant morbidity
and mortality, cardiovascular issues can also occur.
Aim of The Work: Reducing risk of myocardial infarction in patients with COVID-19.
Subjects and methods: This Case-control study was conducted in Shark El-Madina hospital in Alexandria on 129 covid-
19 patients divided into group A: 43 suspected COVID-19 patients who developed Acute coronary syndrome (ACS), group
B: 43 suspected COVID-19 patients who hasn`t developed ACS and group C: 43 patients with myocardial infarction who
were not suspected for COVID-19. All patients underwent thorough general and local history taking, a physical exam,
routine tests (CBC, CRP, ESR and blood gases) and CT chest as well as specialised tests like the ECG, ferritin, PT, PTT,
INR, D. dimer, Troponin, and LDH.
Results: There was differences between the three groups in terms of Troponin level, D-dimer, Ferritin, CRP, ALT, AST
and PT
Conclusion: Based on our study findings, we concluded that hypercoagulability of Acute coronary
syndrome is more likely to manifest in people with Covid 19 infection.
Keywords: Acute coronary syndrome, Hypercoagulability, COVID-19.
INTRODUCTION
neurological, cardiac, and vascular surgical emergencies)
Lombardy has the largest population density
are being developed in order to concentrate urgent
(roughly 10 million people) in Italy. Four months after the
activities in a small number of facilities, increase the
first confirmed case of coronavirus disease 2019
number of intensive care beds designated for COVID-19
(COVID-19) caused by severe acute respiratory
patients, and prevent other hospitals from closing down as
syndrome coronavirus 2 (SARS-CoV2) infection on
a result of general overcrowding (7). Eight regions make
February 21, 2020, the disease has been diagnosed in
up the Lombardy standard STEMI network, which has a
more than 90,000 people in Lombardy (1). Sadly, more
total of 55 catheterization labs (caths-labs), the majority
than 16,000 people died as the virus reached its height in
of which provide 24/7 PPCI (8). Previous publications
March and April 2020. Then, in May and June, there was
provide a thorough explanation of the changed network
a slow but steady slide (2).
for STEMI during pandemics (9). Briefly stated, a one- or
Time-dependent systems' efficacy and efficiency
two-person model of centralization "Macro-Hubs" was
may be negatively impacted by emergencies like the
used in each area based on the projected Time spent
COVID-19 epidemic, with potentially disastrous clinical
transporting patients, regional considerations, and the
outcomes (3). Pandemic COVID-19 significantly
capacity to accept all incoming patients (10).
decreased how many admissions there were for acute
Additional requirements included performing PPCI
coronary syndromes (ACS) in Italy, which may have
on establishing separate pathways from triage to an
impacted the timing of primary percutaneous coronary
isolated care unit for STEMI patients with suspected or
intervention (PCI) for ST-elevation myocardial infarction
proven COVID-19 (ensuring the availability of an
in individuals (STEMI) (PPCI), potentially increasing
interventional cardiology, nursing, and support personnel
fatality and complication rates (4). National and
PPCI team) and accepting all arriving STEMI patients on
international
scientific
bodies
have
offered
a 24/7 basis. As a result, 13 "Macro-hubs" with various
recommendations on how to manage ACS patients,
numbers of spoke centres were discovered (11).
whether or not they have COVID-19 infection. These
recommendations have been made in nations where there
PATIENTS AND METHODS
has been a significant virus outbreak (5, 6).
Sharks were the subject of this case-control study. El-
The Lombardy healthcare authorities issued a
Madina hospital in Alexandria on 129 covid-19 patients
decree on March 8th urging a modification to all regional
divided into group A: 43 suspected COVID-19 patients
networks for the management of time-critical clinical and
who developed ACS, group B: 43 suspected COVID-19
surgical emergencies (STEMI, stroke, major traumas,
patients who hasn`t developed ACS and group C: 43
1764
Received: 17/08/2022
Accepted: 20/10/2022
c:\work\Jor\vol901_265
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1770-1775
Ambulatory Blood Pressure Monitoring as Predictor of
Diabetic Cardiovascular Complications
Mohammed Zakariya Haroun, Kamal Saad Mansour, El Sayed Mohamed Farag, Moataz Ali Hassan
Cardiology Department, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Mohammed Z. Haroun, Mobile: (+20)01094045223, Email: moh.zak.2551991@gmail.com
ABSTRACT
Background: Blood pressure (BP) readings taken at a doctor's office or clinic have historically served as the foundation
for the diagnosis, treatment, and estimation of mortality risk for patients with hypertension.
Objective: The present study aimed to measure the relative predictive value of office-based BP versus ambulatory BP
for cardiovascular complications in diabetes patients.
Patients and methods: This cohort study included 48 adult diabetic patients from Cardiology Department, Zagazig
University. The examined cases had at least two consecutive BP clinic measures with a validated automatic oscillometric
instrument or the conventional approach using a sphygmomanometer.
Results: Office systolic blood pressure ranged from 107 to 138 mmHg with a mean of 126.88 mmHg. Office diastolic
blood pressure ranged from 53 to 79 mmHg with a mean of 71.98 mmHg. Mean 24-hour systolic blood pressure ranged
from 105 to 147 mmHg with a mean of 122.69 mmHg. Mean 24-hour diastolic blood pressure ranged from 51 to 90
mmHg with a mean of 70.5 mmHg. There was statistically significant positive correlation between office SBP and both
daytime and night ambulatory systolic blood pressure. There was statistically significant positive correlation between
office DBP and both daytime and night ambulatory diastolic blood pressure. There was statistically significant positive
correlation between office MBP and both ambulatory mean 24-hour systolic and diastolic blood pressure
Conclusion: Ambulatory blood pressure monitoring (ABPM) is linked to the development of cardiovascular problems
from diabetes and diabetic retinopathy at a mean ambulatory BP level of less than 122.5/70.5 mmHg.
Keywords: Blood pressure monitoring, Diabetes patients, Cardiovascular complications.
INTRODUCTION
masked hypertension," which reflect blood pressure
Blood pressure (BP) is measured using the
measurements that do not represent the true patient
auscultatory method with a sphygmomanometer and
status (6).
stethoscope. According to the American College of
This study aimed to measure the relative
Cardiology/American Heart Association (ACC/AHA),
predictive value of office-based BP versus ambulatory
normal systolic and diastolic blood pressure for adults
BP for cardiovascular complications in diabetes
is <120 mm Hg and <80 mm Hg, respectively (1).
patients.
Changes in blood pressure (BP) occur frequently during
aging and during normal physiologic responses to stress
PATIENTS AND METHODS
and exercise. An increase in BP becomes a clinical
A Cohort study that was conducted at Cardiology
disorder when this change causes a threat to biologic
Department, Faculty of Medicine, Zagazig University.
functions and during this time is defined as a pathologic
Inclusion criteria: Patients with diabetes (HbA1c value
elevation in BP or systemic hypertension (2).
6.5%) or previous criteria for fasting glucose ( 126
In patients 65 years of age and older, the target
mg/dL) or 2-hour glucose ( 200 mg/dL) in age above
blood pressure is <130/80 mmHg. Higher blood
18 years.
pressures earn the progressively severe labels of
elevated blood pressure, stage I hypertension, stage II
Exclusion criteria:
hypertension, and hypertensive crisis (3). This increase
Patients had BP measurements over140/80 mmHg,
in BP is due to complex and varied components, which
age < 18 or >80years old, pregnant female, patients had
are not only due to aging factors but also to unique
evidences of acute stroke or myocardial infarction
environment and lifestyle factors. With advanced age,
within the past 6 months and patients who had evidence
microscopic and macroscopic changes to the heart,
of disease or conditions responsible for secondary
vascular system, and autonomic nervous system may
hypertension.
occur, which can dramatically affect blood pressure (4).
Ambulatory BP has been known to help start
All patients were subjected to the following:
treatment of hypertension in patients with differential
I- Office BP Assessment
cardiovascular risks, which may include low-risk
Trained investigators were observed at least two
patients with white coat hypertension, or with high risk,
consecutive clinic BP measurements using a traditional
including sustained hypertensive patients (5). With better
method by sphygmomanometer or validated automatic
understanding of the dynamic changes in blood
oscillometric device after the participants were rested in
pressure, health care providers now emphasize
a seating position for 10 min. Systolic blood pressure
appropriate blood pressure techniques and have
(SBP), diastolic blood pressure (DBP) and Mean blood
established medical diagnoses such as "white coat and
Pressure (MBP) were recorded.
1770
Received: 12/08/2022
Accepted: 15/10/2022
c:\work\Jor\vol901_266
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1776-1780
Perinatal outcome in Umbilical Cord Entanglement
Alaa El din Mahmoud Ismail, Ahmed Mohamed Alaa El din Mahmoud Youssef,
Ghada Gamal Ali*, Ahmed M. A. Sobh
Department of Obstetrics and Gynecology, Assiut University, Faculty of Medicine, Assiut University, Assiut, Egypt
*Corresponding author: Ghada Gamal Ali, Mobile: (+20) 01287963447, Email: ataxia87@yahoo.com
ABSTRACT
Background: Prematurity and congenital abnormalities happened as a result of umbilical cord entanglement. It is
possible to link cord-related problems, in which the foetal circulation is hampered by obstruction of the umbilical veins,
to a major fraction of instances of intrauterine foetal death.
Objectives: To evaluate how the results of the delivery are affected by nuchal umbilical cord (UC) loops during labour.
Patients and Methods: A cross-sectional study included 470 women with singleton deliveries between 37-41 weeks of
gestation from May 2019 till November 2020. Nuchal cord presence was categorized as either present or missing. The
quantity of loops and the delivery results were noted, if applicable. After birth, the length of the umbilical cord was
measured to see if nuchal cord loops were present.
Results: The participants were classified into cases group (those with nuchal cord, n-220) and control group (without
nuchal cord, n=250). The length of UC was significantly higher in the cases group (89.30 ± 14.44 vs. 73.57 ± 18.66 cm,
P<0.0001) No significant differences between both groups regarding the rate of Apgar scores 7 (P-0.21), neonatal care
unit admission (P-0.96) and perinatal mortality (P-0.26). Meanwhile, the length of UC was significantly higher in those
with multiple nuchal loops (n=36) than single nuchal loop (n=184) (100.35 ± 1042 vs. 86,84 ± 14.07 cm. P<0.0001).
The rate of Apgar scores 7, neonatal care unit admission and perinatal mortality was significantly higher in women with
multiple nuchal loops than with single nuchal loop (P-0.007, 0.011, 0.043, respectively).
Conclusions: Multiple nuchal cord loops increase the risk of prenatal morbidity and death in newborns. Nuchal cord
loops are more frequent when the UC is long.
Keywords: Umbilical cord, Perinatal mortality, Nuchal cord loops, Entanglement.
INTRODUCTION
The placenta and foetus are fundamentally
death (2). The aim of the study was to evaluate how the
connected via the umbilical cord (UC), which supports
results of the delivery are affected by nuchal umbilical
life. It includes a consistent bond between the mother
cord (UC) loops during labour.
and foetus and permits foetal mobility, which is
essential for foetal maturation in general and
PATIENTS AND METHODS
neuromotor development in particular. The UC's design
A cross-sectional study included 470 women
gives it a special blend of mechanical toughness and
with singleton deliveries between 37-41 weeks of
flexibility. However, a number of umbilical cord issues
gestation from May 2019 till November 2020. Nuchal
that might be hazardous to the foetus can be identified
cord presence was categorized as either present or
by the qualities of the chord (1, 2).
missing. The quantity of loops and the delivery results
The cord may become tangled around it or in
were noted, if applicable. After birth, the length of the
another area of the foetus. This incident happens in 16
umbilical cord (UC) was measured to see if nuchal cord
to 30 percent of births (3). An umbilical chord that
loops were present.
completely encircles the foetal neck is known as a
The study group included both primigravida
nuchal cord (4).
and multigravida and excluded multiple pregnancies
Foetal movement that is facilitated by an excess
and any previous uterine surgeries. Details of delivery
of amniotic fluid next to the umbilical cord results in
of baby including mode of delivery, Apgar score,
cord entanglement (5).
neonatal intensive care unit (NICU) admission were
The clinical significance of the nuchal cord and
evaluated.
the quantity of loops are still up for debate. It is still
After the baby was delivered, the umbilical
unclear how to handle the detected nuchal cord during
cord's length was measured. It was clamped twice and
pregnancy and how many loops should be placed
then cut in the middle.
around the neck (2).
Flexible tape was used to measure the length in
Cord anomalies are linked to a number of issues,
centimetres and add it from the cut end to the foetal
including foetal hypoxia during birth, growth
umbilicus and placental connection umbilical cord.
retardation, respiratory issues, and labour difficulties.
Umbilical chord measures were divided into short,
Because of their impact on umbilical blood flow,
normal, and long cords depending on whether they were
nuchal cords are one of the factors that put a foetus at
less than 39 cm, between 39 cm to 95 cm, or greater than
danger of dying (6).
95 cm (7).
Multiple loops on the nuchal cord have been
associated with a higher risk of foetal morbidity and
1776
Received: 09/09/2022
Accepted: 12/11/2022
c:\work\Jor\vol901_267
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1781-1788
Anti-Cancer Effect of Mentha pulegium L.
Walaa Najm Abood 1*, Anas A. Humadi 2
1 Department of Microbiology, College of Veterinary Medicine, University of Diyala, Iraq
2 Department of Pathology, Faculty of Vet. Medicine, University of Diyala, Iraq
*Corresponding author: Walaa Najm Abood, Mobile: 0096 47723485498,
ORCID: 0000-0001-5629-8385, E-mail: walaaabood@gmail.com
ABSTRACT
Background: Many chemotherapy drugs used for treatment cancer, but has many side effects. A lot of studies assessed
natural extract as anti-cancer agent and reduced cells proliferation.
Objective: The present study was done to investigate the anti-cancer effect of M. pulegium leaves ethanol extract fractions
and investigate the active component by GC-MS spectrum analysis. Methods: Cytotoxicity and anti-cancer ability of M.
pulegium extract was investigated by exposing tumor cell line (MDA-MB-231, MCF7 & PC3) and Human hepatic cell line
(WRL68) to different doses from M. pulegium extract. We evaluated the ability of MTHF2 in induction apoptosis process
in the treated cancer cell by using AO/EB stain for estimation of apoptotic cells.
Results: M. pulegium extract was no toxic effect on the WRL68 while decreasing in the viability percent of treated MCF7,
MDA-MB-231 and PC3 cell in doses dependent manner, lost their normal shape to be around, detached floating in culture
media with reduction in the number then become under growth inhibition. Alteration in the nuclei of the normal cell was
clearly showed by Fluorescent microscope image to cells stained with double AO/EB stain, which nuclei of apoptotic cell
appeared fluorescent green, condensed chromatin, DNA fragmented with formation of apoptotic bodies. MTHF2 was
applied to GC-MS analysis for diagnose the active compounds, identified twenty two active compounds; the most abundant
are Ethyl Oleate in the percentage of 62.68% and Octadecanoic acid, ethyl ester in the percentage of 66.06%. Both
compounds have a high antioxidant effect. Conclusion: M. pulegium leaves extract fraction 2 has anti-cancer effect by
inhibition the cancer cell proliferation throughout enhanced apoptosis process.
Keywords: Anti-cancer, Apoptosis, Mentha pulegium L., Anti-proliferation, Experimental study, University of Diyala.
INTRODUCTION
and industry purpose )10(. The present study was done to
Mentha pulegium L. is one of the important and have
investigate the anti-cancer effect of M. pulegium leaves
many used in traditional medicine. The native area is
ethanol extract fractions and investigate the active
Eastern Mediterranean, but distributed in different
component by GC-MS spectrum analysis.
countries throughout the world. It is used as spices add to
meat or drink as tea. M. pulegium leaves tea used in
METHODS
traditional medicine in Iraq in the treated bowel
Chemicals: Ethanol was purchased from Fisher
syndrome, relaxing, and reducing menstrual pain. Many
Scientific, UK. PBS buffer from Dulbecco A, Oxoid,
previous studies go throughout M. pulegium to
England. Silica gel G60, 70-230 mesh from Merck,
investigate the biological properties and chemical
Darmstadt, Germany. WRL 68 cell line, MCF7 cell line,
components. M. pulegium leaves methanol extract was
MDA-MB-231 cell line and PC3 cell line (American type
investigated for antibacterial activity and the result was
culture collection, ATCC, Rock-ville, MD).DMEM
showed a high effect on gram- positive and gram -
media by Sigma-Aldrich, UK. Fetal bovine serum by
negative bacteria )1(.
Biowest, France. DMSO by Fisher Scientifc, UK.
The essential oils from M. pulegium showed
Acridine Orange (AO) and Ethidium Bromide (EB) were
bacteriostatic and bactericidal activity )2(. Other previous
purchased from Fisher Scientific, UK.
studies extract chemical nanoparticles such as Silver,
Extraction of plant and fractionation: Leaves of M.
Bismuth Oxide, Zinc Oxide and Copper from M.
pulegium (voucher number EM4.12) were purchased
pulegium leaves extract )3-5( and from another medicinal
from the native market then cleaned, left to air- dry. After
plants as antioxidant and anti-immunosupression )6(. The
that made powder by using an electric blender and it is
medicinal plants used in the medicine application as anti-
applied for extraction and fractionated as described
inflammation in wound healing)7(. M. pulegium leaves
previously by Abood et al. (11).
extract have highly total phenolic and flavonoid content
M. pulegium cytotoxicity and anti-cancer ability: The
with high antioxidant properties )8(. The HPLC analysis
cytotoxicity and anti-cancer ability of M. pulegium leaves
for M. pulegium leaves extract was indicated for present
extract was investigated by exposing tumor cell line
many active compounds with biological activity )9(. Also,
(MDA-MB-231, MCF7 & PC3) and Human hepatic cell
GC-MS spectrum analysis was showed the existence of
line (WRL68) to different doses at final concentration
many compounds that important in the pharmacological
125, 250, 500, and 1000 µg/mL from M. pulegium leaves
1781
Received: 28/08/2022
Accepted: 30/10/2022
c:\work\Jor\vol901_268
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1789-1795
Inappropriate Medications Use Among Elderly Patients in Babylon Province
Aymen A. Bash1, Esaim Fadhel Khalfa2, Qasim Jawad Al- Daami2
1 Department of Pharmaceutics, College of Pharmacy, University of Babylon, Iraq
2 Department of Pharmaceutical Chemistry, College of Pharmacy, University of Babylon, Iraq
Corresponding author: Aymen A. Bash. Email: phar.aymen.a.bash@uobabylon.edu.iq.
Mobile: 009647801260693, Orcid: 0000-0001-9140-661X
ABSTRACT
Background: Inadequate or inappropriate medication treatment is a major risk factor for medication-related diseases.
Determining the prevalence of potentially inappropriate prescription and drug-disease interactions in hospitalized patients
is an important step to resolving these problems.
Methods: A sample of 500 geriatric patients hospitalized between June 2021 and December 2021 were included in the
study. Medication prescribed before (usual medication), during, and at hospital discharge was considered.
Results: The prevalence of prescription of at least one inappropriate drug on hospital admission, during hospitalization, and
at discharge was 9.8 %, 3.6%, and 2.4 % respectively. The drugs most frequently implicated in hospital admission were
diazepam, digoxin, iron products, chlorpheniramine, and amitriptyline. The significant adverse drug-disease interaction on
hospital admission, during hospitalization, and at discharge was 13.0%, 3.2%, and 3.4%, respectively. The variables number
of drugs at admission and the number of diseases and the pain item of the COOP/WONCA score were statistically
significant.
Conclusions: The study reveals the existence of potentially inappropriate drug prescriptions or potentially adverse drug-
disease interaction in hospitalized patients in our environment. Polypharmacy, polypathology, and the presence of chronic
pain were associated with potentially inappropriate prescriptions.
Keywords: Drugs, adverse effects; medication prescription.
INTRODUCTION
should not exceed certain limits. Several of these drugs
Drug-induced diseases in the elderly are gaining
were considered unsuitable because safer alternatives
importance as the population of older adults has
exist or because their side effects are extremely unsuitable
increased. The previous researches suggest that
for the elderly, in addition to that, some agents were
inadequate or inappropriate medication treatment is a
considered inappropriate due to their questionable
major risk factor for these medication-related diseases.
efficacy (4, 5).
Inadequate medication is defined as when the risk
The criteria for improper use are also referred to the
outweighs the benefit. The risk-benefit ratio of some
use of drugs that exceed the maximum dose or that exceed
drugs is influenced by the changes in pharmacokinetics
the usual duration and that therefore causes a high
and pharmacodynamics related to the aging process.
frequency of adverse reactions and are of questionable
Prescribing an inappropriate drug to the elderly
necessity (6). For example, iron products should not
population exposes them to a risk of morbidity and
exceed the dose of 325 mg/day; if the doses are higher,
mortality. Adverse drug reactions (ADRs) are the most
they are not absorbed, but their adverse reactions increase
serious consequences of inappropriate prescription.
(4). On the other hand, if the user is unique or very
ADRs, when they are not recognized, can in turn lead to
infrequent, it is also considered inappropriate, since the
the prescription of additional medications to the detriment
desired effect is not achieved. Beers et al also identified
of the quality of life. Consequently, the aforementioned
the drugs that should be avoided in patients with a history
ADRs can result in superfluous hospitalizations and an
of one of the 14 diseases, which they called a drug-disease
increase in morbidity and mortality (1,2).
interaction (6), in addition to the identification of four
Recent meta-analysis studies estimated that 4.7% of
drug-drug interactions that must be avoided (e.g.
all hospitalizations were due to ADRs. Studies limited to
warfarin, either with aspirin, NSAIDs, dipyridamole or
the elderly found frequencies as high as 17%. The most
ticlopidine) and three drugs with specific recommended
effective way to prevent ADRs in old-age patients is by
doses in elderly: 1) Digoxin, at maximum dosage limit of
reducing the number of inappropriate prescriptions (3).
0.125 mg/day, except in patients with atrial fibrillation; 2)
In 1991 Beers et al. developed the Explicit Criteria for
short half-life benzodiazepines with maximum total daily
Inappropriate Medication in the elderly, which were later
dose (oxazepam >60 mg, zolpidem >5 mg, lorazepam >3
updated in 2019 using the expert consensus technique and
mg, alprazolam >2 mg); and, 3) ferrous sulfate, at a
evidence-based medicine concepts (4). They include drugs
maximum dose of 325 mg/day (7).
that should be avoided in geriatric patients and other drugs
Stuck et al. (8) modified Beers' original list by
whose dosage, frequency of administration or duration
applying it to patients cared for at home. This list is called
1789
Received: 05/10/2022
Accepted: 31/12/2022
c:\work\Jor\vol901_269
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1796-1800
Correlation between ST2 concentration and Cardiorenal syndrome
Farah A. Al-Marzook1*
1Health and Medical Technical College, AL-Zahraa University for Women, Karbala, Iraq
Corresponding author: Farah Al-Marzook, Mobile: +96 47801629318, ORCID: 0000-0001-5365-2393,
Email: farah.amir@alzahraa.edu.iq
ABSTRACT:
Background: Cardiorenal syndrome, a term used to describe a variety of heart and kidney illnesses, is characterized by
the dysfunction of one organ resulting to the dysfunction of the other.
Objective: The aim of the current study to evaluate some biochemical indicators, linking hematologic analysis and
kidney function test with interleukin-1 receptor family biomarker
(ST2), and investigating the early diagnosis and prediction of chronic renal syndrome.
Patients and methods: A total of 60 cases were recruited; comprising 20 controls and 40 patients with chronic kidney
disease and cardiovascular disease. The patients were aged between 25 and 65 years old. Levels of ST2 were measured
in both the case and the control groups. Result: In comparison with the control group, patients with cardiovascular
diseases had higher concentrations of haematological features than do patients with chronic kidney disease. Also, when
compared to controls, those with chronic kidney disease had statistically significant (P<0.05) increase in their serum
levels of urea and creatinine. When compared to other groups, the levels of the biomarker ST2 were significantly higher
in chronic kidney disease patients. Conclusions: Adults with chronic kidney disease had higher circulating ST2 levels
and a higher mortality rate. RBC negatively affects ST2 levels as a result there is a link between ST2 levels and the risk
of anaemia in chronic kidney disease patients.
Keyword: Interleukin-1 receptor family biomarker, ST2 Concentration, Chronic kidney disease, Cardiorenal Syndrome,
Case control study, AL-Zahraa University for Women.
INTRODUCTION
cells include the IL-33 (interleukin-33) receptor, which
The numerous biochemical mechanisms that make
ST2 binds to. This contact leads to in myocyte
up the crosstalk between the heart, kidneys, and
dysfunction and tissue fibrosis instead of a positive
vascular system allow these organs to work together to
signal transduction. ST2 monitors complement
sustain key physiological functions. The term
natriuretic peptide levels and is especially unaffected by
"cardiorenal syndrome" also known as "Reno cardiac
renal function in predicting HF-related mortality and
syndrome" refers to heart or kidney disease that
hospitalizations (5).
compromises the other organ and ultimately leads to
The aim of the current study to evaluate some
failure of both. The detrimental effects of one organ on
biochemical indicators, linking hematologic analysis
another may be immediate or delayed, and they may
and kidney function test with ST2, and investigating the
involve a complex feedback system that controls
early diagnosis and prediction of chronic renal
hormones, inflammatory substances, and oxidative
syndrome.
stress reactions (1). The phrase "cardiorenal syndrome"
refers to the progression of renal insufficiency to heart
PATIENTS AND METHODS
failure (HF) and vice versa (2). Chronic renal syndrome
From April 2021 to June of 2021, the current study
(CRS) is one of the worst prognostic indicators because
was conducted in Iraq. This investigation was carried
it worsens morbidity and mortality in individuals with
out at the Artificial Kidney Unit of the Al-Kafel
heart failure (HF), acute kidney injury (AKI), or chronic
Hospital in the Province of Karbala.
renal illness (3).
There are five primary types of CRSs. Acute
Study Design: A case control study included 60
cardiac failure of Type I, sometimes referred to as
samples; of which 40 patients had chronic kidney
abrupt CRS, causes renal injury. Chronic Type II CRS,
disease (CKD) and cardiovascular disease (CVD) and
also known as chronic heart failure, harms the kidneys.
20 represented the control group. The patients were
Acute kidney injury that causes acute heart failure, like
aged between 25 and 65 years old. Patients and controls
uremic cardiomyopathy, is one of the features of Type
were recruited daily till fulfilling the sample size.
III or acute nephrocardiac illness. Chronic kidney
disease that leads to diastolic heart failure and kidney
Collection of Blood Samples: Using 5 millilitres of
failure is the defining feature of Type IV, also known as
sterile synergies, blood samples were drawn from the
chronic nephrocardiac sickness. The most severe type
vein. Sample put into test tube as instructed. When
of diabetes, type IV, is caused by a systemic infection
blood was extracted, it was allowed to clot for ten
and leads to kidney and heart failure (4).
minutes at room temperature, centrifuged for fifteen
The endothelial cells lining the LV and aortic
minutes at 6,000 rpm, and the serum was then taken out
outflow tract produce the decoy protein ST2 in response
and immediately frozen at -80 °C for use in the study's
to biomechanical load. Cardio myocytes and satellite
laboratory analysis.
1796
Received: 27/08/2022
Accepted: 30/10/2022
c:\work\Jor\vol901_270
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1801-1808
Effect of Technostress and Work Stress on the Productivity of
Staff Members of The Faculty of Medicine
Alaa A. Ismail*, Elsayed H. Abdelhamid, Ghada M. Khalil, Noha M. Abdelsalam
Department of Public Health and Community Medicine, Faculty of Medicine, Zagazig University, Zagazig, Egypt
*Corresponding author: Alaa A. Ismail, Mobile: (+20) 01115393075, E-Mail: a.637494@gmail.com
ABSTRACT
Background: Technology is used in every aspect of life. On the level of professional life, it has great benefits in
increasing productivity. Unexpectedly, it could negatively impact productivity through technology-induced stress
(Technostress).
Objectives: This study aimed to study the effect of technostress and work stress on productivity. In addition to studying
other associated factors of productivity.
Patients and methods: This was a cross-sectional study conducted on 337 staff members of the Faculty of Medicine of
Zagazig University from July to September 2022. A survey was used to collect the questionnaire.
Results: Age, years spent on the job, degree, and training were significantly associated with productivity. Three out of
five techno-stressors (techno-complexity, techno-insecurity, techno-uncertainty) in addition to role conflict were
associated with productivity. Techno-uncertainty is the only significant predictor of productivity.
Conclusions: Technostress is a new but important phenomenon that could affect productivity so we should pay attention
to it. In addition to that, some other factors associated with productivity such as training and role conflict are believed
to be modifiable factors.
Keywords: Technostress, Work stress, Productivity, Staff members.
INTRODUCTION
decreased performance (10), increased work stress (7),
The COVID-19 pandemic and its associated
decreased job satisfaction (11), decreased employee
lockdown resulted in a lot of changes in the work
engagement (12) up to job turnover intention (13).
environment. Some workers such as educators could
This study aimed to study the effect of technostress
proceed with their work from home with the help of
and work stress on productivity. In addition to studying
technology. Without a doubt, technology and internet
other associated factors of productivity.
were crucial for protecting employees' jobs from the
COVID-19 pandemic (1).
SUBJECTS AND METHODS
Sadly, there is a dark side of technology named
Study design and setting:
technostress (Tech.S) which was first introduced by the
This cross-sectional study was carried out in the
American Psychologist Craig Brod who discussed how
Faculty of Medicine, Zagazig University, Sharkia
could technology affect the psychology of individuals
Governorate, Egypt, from July to September 2022. A
and cause stress and so he defined Tech.S as a "modern
survey study was used.
disease of adaptation caused by an inability to cope with
Study subjects:
new computer technologies in a healthy manner" (2).
The selected population was the staff members
Over more than 30 years, more technologies
of Zagazig University's Faculty of Medicine. From each
were invented, the dependence on ICT (information and
chosen department, a contact list of staff members was
communication technology) increased dramatically,
obtained.
continuous updates of hardware and software were
introduced, skills of using complex ICT differed greatly
The EPI 7 TM info program was used to calculate the
between workers, and eventually work environment
sample size according to the following:
became essentially dependent on modern ICT (3). So,
There were 2570 working faculty members in the
technostress remained a big challenging problem.
Faculty of Medicine of Zagazig University, with 70%
Tech.S is usually manifested in the individual as
working in clinical departments and 30% in academic
strains: emotional exhaustion (4), work exhaustion (5),
ones. According to Okonoda et al. (14), the Tech.S
and anxiety and frustration (6).
prevalence among university staff members is 54.2%.
Tech.S is caused by five variables named techno-
As a result, the sample size was measured to be 332 with
stressors: techno-overload (too much), techno
an effect size of 1 and 80% power. It was divided by
complexity (difficult), techno-invasion (always
proportionate allocation as the following: 232 clinical
connected), techno-insecurity (uncomfortable), and
staff members and 100 academic staff members.
techno-uncertainty (unfamiliar) (7).
We used a multistage random sampling
On the other hand, there are some variables that
technique for sample selection. The faculty of medicine
could inhibit or decrease Tech.S (Tech.S inhibitors) as
has 36 departments, including 25 clinical departments
technical support (8), and training (9).
and 11 academic departments. Using a simple random
Some studies found that Tech.S has a negative
sampling technique, we chose the departments in the
impact on the individual's work life, it leads to
first phase by proportional allocation (clinical
1801
Received: 19/08/2022
Accepted: 20/10/2022
c:\work\Jor\vol901_271
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1809-1813
Correlation between High-Sensitive Troponin Level, Neutrophil
Lymphocyte Ratio and SYNTAX score in Acute Myocardial Infarction
Patients Undergoing Coronary Angiography
Ibrahim AbdelHamid*1, Youssef Mohamed Amin2, Ahmed Fathy Tamara2
1Department of Cardiology, Misr University for Science and Technology, Giza, Egypt
2Department of Cardiology Faculty of Medicine, Ain Shams University, Cairo, Egypt
*Corresponding author: Ibrahim AbdelHamid, Mobile: (+20)01222380246,
E-Mail: ibrahimomar9999@yahoo.com
ABSTRACT
Background: One of the main causes of death in the developed world is acute myocardial infarction. Non-ST-segment
elevation myocardial infarction (NSTEMI) and ST-segment elevation myocardial infarction (STEMI) are two types of
acute myocardial infarction (AMI).
Objective: To assess the value of using highly sensitive troponin and the neutrophil-lymphocyte ratio (NLR as marker
to predict the complexity of angiographic coronary anatomy in AMI patients assessed by SYNTAX score.
Patients and Methods: In this study, 100 cases with AMI who had coronary angiography with or without stent
implantation between November 2021 and May 2022 were included. These patients came to the Emergency
Departments of Ain Shams University Hospitals and Misr University for Science and Technology (MUST) Hospitals.
A serum sample was acquired for differential CBC counts in order to assess neutrophil-to-lymphocyte ratio (NLR) and
zero-point high sensitive troponin to be correlated by SYNTAX score.
Results: The study reported that there was a marked correlation between the NLR and the coronary lesions complexity
evaluated by SYNTAX score, but the study couldn't found any correlation between the high sensitive troponin level
and coronary lesions complexity.
Conclusion: An increased in NLR on admission is a potential and independent predictor of the complexity of the
coronary lesions, but there is no significant correlation between high sensitive troponin level and the complexity of
coronary lesion.
Keywords: Ischemic heart disease, NLR, Myocardial infarction.
INTRODUCTION
The SYNTAX score, which is used to measure the
The leading cause of death worldwide is ischemic
severity of CAD, depends on coronary angiograms for
heart disease (IHD (1). In patients with STEMI within 12
visual evaluation of coronary lesions. Additionally, it
hours of the start of symptoms, primary PCI is the
offers details on the prognosis and the proper
preferable reperfusion technique, if it can be completed
revascularization. Therefore, the SYNTAX score is
quickly (i.e., within 120 minutes of the diagnosis of
established to judge and help in the decision-making
STEMI) by a skilled team (2). According to
during management of patient with multi- vessel
recommendations from the European Society of
disease (12). The current study aimed to evaluate the
Cardiology (ESC), invasive approach became prevalent
correlation between high-sensitive troponin level, NLR
for treating NSTEMI patients (< 2 hour in very high-
and the coronary anatomy complexity assessed by
risk patient, < 24 hour in high risk patient or < 72 hour
SYNTAX score in cases with AMI.
in intermediate risk patient) (3).
Cardiac troponins (troponin I and T) are markers
PATIENTS AND METHODS
with high sensitivity and specificity of myocardial
This prospective interventional study performed in the
injury (4). Guidelines recommended troponin as
Cardiology Department, Ain Shams University
potential diagnostic marker for acute myocardial
Hospitals and Misr University for Science and
infarction (5). Atherogenesis and atherosclerosis
Technology (MUST) Hospital, between November
progression have been found to be significantly
2021 and May 2022.
influenced by inflammatory indicators (6). In several
The study included 100 patients (above the age of 18)
cardiovascular disorders, NLR considered systemic
presenting with acute myocardial infarction (STEMI-
inflammatory marker and related with cardiac events
NSTEMI) and proceeding to coronary angiography
and mortality (7, 8, 9).
according to the ESC guidelines.
Several investigations were conducted to determine
the connection between inflammatory indicators,
Exclusion criteria: Patients with typical angina pain
particularly neutrophils, and the complexity of coronary
but without acute myocardial infarction according to
artery disease (CAD) besides the short- and long-term
ESC guidelines, patients with chronic lung diseases,
prognosis in cases with AMI. Additionally, current
patients with cardiac inflammatory or infectious
research indicates a relationship between high sensitive
diseases, patients unfit for coronary angiography and
troponin (Hs-Tn) levels and coronary artery
patients with hyper dynamic circulation (sepsis, anemia,
atherosclerotic burden and extent (10, 11).
liver cirrhosis etc.).
1809
Received: 10/08/2022
Accepted: 13/10/2022
c:\work\Jor\vol901_272
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1814-1819
Laparoscopic Versus Open Suturing and Omental Patch Repair of
Perforated Peptic Ulcer: A Randomized Controlled Clinical Trial
Sherief M. Mohsen, Hossam Attia AboElazm, Mohamed El Azazy*
Department of General Surgery, Faculty of Medicine, Ain Shams University, Egypt
*Corresponding author: Mohamed El Azazy, Mobile: (+20) 01207473007, E-Mail: mohamedelazazy1984@gmail.com
ABSTRACT
Background: The conventional open omental patch repair is the gold standard treatment for peptic ulcer perforation
(PUP). Laparoscopic management has been advocated for the treatment of perforated peptic ulcers since 1990, but many
concerns still exist about the technique's viability and safety.
Objective: The aim of the current study is to compare the results and outcome of open versus laparoscopic repair
technique for perforated peptic ulcers.
Patients and methods: A total of 73 cases with a preoperative clinically diagnosed with peptic ulcer perforation were
distributed randomly into two groups to perform either open or laparoscopic repair with an omental patch comparing
their operative and postoperative results.
Results: In comparison to open surgery, laparoscopic PUP repair led to quicker oral eating and bowel movements, less
postoperative discomfort, less superficial wound infections, fewer pulmonary and overall problems, secondary
intervention, and a shorter hospital stay. Its sole drawback was a longer operating time.
Conclusions: Laparoscopic technique is a safe and feasible treatment modality for PUP with superior outcome when
compared to open surgery.
Keywords: Laparoscopy, Peptic ulcer perforation, Omental repair.
INTRODUCTION
A major complication of peptic ulcer disease
repair with an omental patch in Ain Shams University
(PUD), peptic ulcer perforation (PUP), necessitates
Hospitals.
rapid surgical care (1).
Patients included in the study were 18 years old
Although the prevalence of PUD has decreased,
or older. Exclusion criteria included patients who had
the proportional percentage of ulcer perforations has
previous history of upper gastrointestinal surgery
remained largely same (2).
(anticipated to have intraabdominal adhesions better
About 2-10% of PUD patients with a high
avoided in initial experience implementation) and
mortality risk, particularly the elderly, experience
associated bleeding ulcer (additional steps are needed to
perforation (3,4).
control bleeding). Cases with poor surgical risk were
The most frequent and appropriate emergency
also excluded in the study (ASA IV). Patients with
technique is simple closure with or without an omental
systolic blood pressure less than 90 mmHg were
patch (4,5). Laparoscopic surgery for peptic ulcer
considered in a state of shock and were excluded.
perforation has been promoted at various institutions
During operation, patients diagnosed with pathology
during the past 20 years, with positive outcomes (1,4,6).
other than a PUP were excluded from the study. The
In 1990, the first perforated peptic ulcer sutured
delayed presentation was considered in patients with
laparoscopic repair was carried out (7).
acute abdomen lasting >24 hours before presentation.
A simple, effective, and preferred technique is to
Those patients were, also, excluded; they would mostly
simply repair the perforation with an omental patch (8-
have intraperitoneal adhesions, so better excluded in
10). Less discomfort, a shorter hospital stay, better
initial experience.
cosmetic results, faster wound healing, and a decreased
Randomization was undertaken by a consecutive
incidence of delayed wound complications, such as
number of closed envelopes each containing one of the
incisional hernias and scar-related issues make
two treatment techniques. No definitive ulcer surgery
laparoscopic surgery of perforated duodenal ulcers
was done for any patient in the study (i.e., only ulcer
superior to open repair (6,11).
was dealt with and no case of gastrectomy or drainage
Though laparoscopic repair has been used for a
procedure). Conversion from laparoscopic to open
long time many questions still need answers for the best
technique occurs in case of technical difficulty, non-
practice. The aim of the current study is to compare the
juxtapyloric gastric ulcers (possibility of malignancy),
results and outcome of open versus laparoscopic repair
or size of perforations greater than 1 cm; ulcers are
technique for PUP in emergency settings.
usually less than 1 cm unless secondary to other
pathology (12).
PATIENTS AND METHODS
From June 2018 till January 2022, 73 patients
Surgical Procedures: Intravenous fluids, nasogastric
clinically diagnosed with PUP were prospectively
tube decompression, intravenous analgesics, and
randomized into two groups to perform either open or
intravenous empirical broad-spectrum antibiotics were
laparoscopic
received by all patients prior to surgery. The open repair
1814
Received: 23/08/2022
Accepted: 26/10/2022
c:\work\Jor\vol901_273
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1820-1825
Molecular Study of Antimicrobial Effect of Bacteriocin Isolated from
Lactobacillus on Candida albicans
Noor Ali Faleh*, Abbas Muhei Muzher
Biology Department, College of Science, Diyala University, Iraq
Corresponding Author: Noor Ali Faleh, Phone: +96 407732430481, Email: noornoor19481948@gmail.com
ABSTRACT
Background: It is generally known that several lactic acid bacteria (LAB) species have antibacterial properties. Different
Lactobacillus species have been shown to have anticandidal effects by numerous researchers. This genus's members benefit
the vagina and gastrointestinal systems' health. Additionally, they create a variety of bacteriocins with a wide spectrum of
actions against bacteria or fungi.
Objective: The aim of the current study was to examine the antifungal effects of bacteriocin produced by Lactobacillus spp.
isolates against Candida spp. with the ultimate goal of gene expression on C. albicans biofilm genes before and after
bacteriocin treatments.
Material and methods: To test the antifungal activity of lactobacilli that make bacteriocin against the yeast Candida, 50
yogurt and vaginal samples were gathered. Testing on the isolated Lactobacilli included microscopic, macroscopic, and
biochemical examinations. Additionally, a screening was done to find the best producer isolation. A total of 100 urine
samples from females of various ages were obtained for the isolation of Candida spp. All of the isolated C. albicans were
examined under a microscope, on a larger scale, and using biochemistry. Primary and secondary screening methods were
used to look into the detection of bacteriocin formation from Lactobacillus. The expression of the agglutinin-like sequence
1 (ALS1) gene before and after treatment with bacteriocin was compared using reverse transcription quantitative polymerase
chain reaction (RT-qPCR).
Results: The agar wells diffusion technique was the most effective, according to the results. The results show that folding
of this gene was reduced after bacteriocin treatment which means that bacteriocin inhibits the gene expression of biofilm
formation of C. albicans.
Conclusions: Our findings suggest that bacteriocin treatments may offer an effective substitute for antifungal medications.
To verify these results, additional in vivo research is required.
Keywords: Antifungal, Bacteriocin, Candida, C. albicans, Lactobacillus, Experimental Study, Diyala University.
INTRODUCTION
non-toxic to people, and protease-resistant. In general, it
Fungal illnesses, which have a death rate of 45%, are
is generally recognized that LAB species have
among the hardest diseases to treat in humans (1). Despite
antibacterial properties. Different Lactobacillus species
the availability of numerous potent antifungal
have been shown to have anticandidal effects by
medications, mortality rates remain high. Invasive
numerous researchers. This genus's members benefit the
candidiasis can be caused by a variety of Candida species,
vagina and gastrointestinal systems' health. Additionally,
the most significant of which is C. albicans (2).
they create a variety of bacteriocins with a wide spectrum
Like many other microorganisms, C. albicans'
of actions against bacteria or fungi (7).
ability to develop into a biofilm, a densely packed
The purpose of this study is to identify bacteriocin
community of cells, determines how harmful it is to
production by Lactobacillus spp. isolates and assess its
humans (3). The creation of a biofilm is thought to start
antifungal activity against Candida spp. The gene
with microbial adhesion. This building serves as a barrier
expression of the C. albicans biofilm before and after
between environmental pressures and the host's defenses
bacteriocin treatments will then be examined.
(4). Adhesins are specialized proteins that C. albicans uses
to mediate adhesion to host cells, other microorganisms,
MATERIALS AND METHODS
abiotic surfaces, and other C. albicans cells (5). The
Samples collection and isolation: A total of 50 samples
agglutinin-like sequence (ALS) proteins, a family of
were collected from Yogurt and vaginal swabs (25 from
eight, are what make up C. albicans adhesions (ALS17
each) for isolation of Lactobacillus sp. Also, 100 samples
and ALS9). Biofilm formation is frequently linked to C.
were collected from urine for isolation of C. albicans
albicans infections.
during the period from November 2021 to February 2022.
Previous studies showed that biofilm development
All samples were collected from females of different ages
on mucosal surfaces is correlated with the expression of
who attended Al-Batool Teaching Hospital. The clinical
ALS1, a member of the ALS (agglutinin-like sequence)
diagnosis was done by Consultant Obstetrician. The
gene families (6). Lactic acid bacteria's (LAB)
samples were cultured immediately after sampling for
bacteriocins are easy to make, stable at low pH levels,
diagnostic purposes.
1820
Received: 15/09/2022
Accepted: 27/12/2022
c:\work\Jor\vol901_274
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1826-1830
Percutaneous Coronary Intervention in Patients with Left Main Coronary
Artery Disease and Cardiogenic Shock
Ahmed Galal Fattah Fahmy1*, Khaled S. Ahmed1, Yosry M Thakeb2, Hatem Khairy1
1 Department of Cardiology, National Heart Institute, Cairo, Egypt
2 Cardiac Surgery Department, National Heart Institute, Cairo, Egypt
*Corresponding Author: Ahmed Galal, E-Mail: dr_ahmedgalal@hotmail.com,mobile:00201002414234
ABSTRACT
Introduction: Cardiogenic shock of patients with myocardial infarction still affects between 3-10% of patients, and the
in-hospital death rate is <30%. One of the challenges is the left main (LM) coronary intervention.
Objective: The aim of the current study is to investigate the short-term outcome of emergency LM coronary
intervention.
Patients and methods: A total of 80 patients who underwent percutaneous coronary intervention (PCI) of LM in the
setting of cardiogenic shock in our hospital were retrospectively studied. Short-term clinical outcomes and PCI
characteristics were evaluated.
Results: LM was the culprit artery in ]about 62.8% of the patients. The remaining cases were treated due to persistence
of cardiogenic shock after successful PCI of the culprit vessel. About 43.6% of the patients had Syntax scores more than
32, and the majority of them had complicated coronary stenosis. Second stent method at the LM bifurcation was
employed in 12.8% of cases, complete revascularization in 34.6%, and intra-aortic balloon pump (IABP) in 13.1%.
Mortality in hospitals was 48.7%. Half of the patients had no differences between 1 or 2 stent LM bifurcation procedures
at 90 days' follow-up. Patients with incomplete revascularization with a residual Syntax score of 15 or more and those
with thrombolysis in myocardial infarction (TIMI) flow.
Conclusion: Neither the use of IABP nor the 2-stent approach in the LM showed a decreased short-term mortality in
patients who first presented with cardiogenic shock and LM illness. However, in our study, patients with ultimate TIMI
flow <III showed greater short-term mortality.
Keywords: Cardiogenic shock, Myocardial infarction, Coronary artery, Descriptive study, National Heart Institute.
INTRODUCTION
Acute myocardial infarction may lead to one of the
electrocardiogram (ECG) and the results of the
major complication which is cardiogenic shock, which
angiography in cases of ST-elevation myocardial
may lead to death with a rate of about 60% (1).
infarction (STEMI). The culprit artery in the case of
In patients with acute coronary syndrome (ACS)
non-ST-elevation myocardial infarction (NSTEMI) was
accompanied by cardiogenic shock, the presence of left
determined to be LM illness based on clinical criteria
main (LM) disease is an important consideration when
and ECG changes employed by the treating physicians.
determining the revascularization method.
As the index clinical manifestation, myocardial
A small number of patients with percutaneous
infarction (MI) following cardiac surgery is referred to
coronary intervention (PCI) of the LM were included in
as perioperative MI.
large trials of cardiogenic shock like Culprit shock or
Patients with protected LM or death prior to
intra-aortic balloon pump (IABP) Shock II (2).
stenting were excluded from the study.
As a result, there is currently a shortage of
The percutaneous treatment of all major arteries
information about the most effective treatment plans
with significant stenosis determined by angiography by
and clinical results for individuals with LM illness in
visual examination (70%) at any time during the
the setting of cardiogenic shock. The PCI approach and
hospital stay was referred to as complete
short-term clinical outcomes of patients who had LM
revascularization.
According
to
ESC
2015's
PCI in the setting of ACS complicated by cardiogenic
recommendations, ACS is defined (3). Patients with
shock are analyzed in the current study.
symptoms of poor peripheral perfusion and systolic
blood pressure less than 90 mmHg are said to be in
PATIENTS AND METHODS
cardiogenic shock and may need inotropic or vasoactive
We performed a retrospective analysis of patients
medication assistance.
who underwent LM stenting at the National Heart
Institute of Egypt, between April 2018 and April 2022
Ethical Consideration:
for the treatment of ACS exacerbated with cardiogenic
This study was ethically approved by the
shock.
Institutional Review Board of the National Heart
ACS and coronary syndrome (CS) patients who
Institute. The participants were given an
underwent LM PCI due to persistent cardiogenic shock
explanation of all the study's processes, along with
following treatment of the offending vascular were also
any potential difficulties, while being emphasized the
included, regardless of whether the LM was the culprit
value of the data they would provide.
artery. The culprit artery was found using the
1826
Received: 24/08/2022
Accepted: 27/10/2022
c:\work\Jor\vol901_275
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1831-1837
The Predictive Value of Estimation of N Terminal - Pro B- Type Natriuretic
Peptide in Patients with ST Elevation Myocardial Infarction Undergoing
Primary Percutaneous Intervention for the Outcome of Myocardial Reperfusion
Ahmed Fathy Tamara1, Sherif Altoukhy1, Ibrahim AbdelHamid*2
1Department Cardiology, Faculty of Medicine, Ain Shams University, Cairo, Egypt
2Department Cardiology, Misr University for Science and Technology, Giza, Egypt
*Corresponding author: Ibrahim AbdelHamid, Mobile: (+20)01222380246, E-Mail: ibrahimomar9999@yahoo.com
ABSTRACT
Background: Primary percutaneous intervention (PCI) is the favored reperfusion strategy to achieve normal cardiac
blood flow.
Objective: To study if the level of NT-pro BNP before primary PCI can be used as an independent predictor for
successful reperfusion in cases presented with STEMI after primary PCI.
Patients and Methods: This study included 40 cases subjected to Emergency Departments of Ain Shams University
and Misr University for Sciences and Technology (MUST) Hospitals from September 2021 to June 2022, diagnosed
with STEMI and had been revascularized by primary PCI. Serum samples for NT-pro BNP were collected before
primary PCI and correlated with the TIMI flow, MBG grades, and ST resolution post primary PCI.
Results: Our study demonstrated a higher baseline NT-pro BNP level that was significantly correlated with increased
risk of poor myocardial reperfusion following primary PCI expressed by ST resolution less than 50%, TIMI flow grade
< 3 as well as MBG < 3 and was also associated with increased incidence of No Reflow.
Conclusion: Initial NT-pro BNP level in STEMI cases correlates with myocardial reperfusion following primary PCI
besides its early marker for risk stratification of STEMI patients. High-risk patients are in need of more aggressive
complementary treatment strategies to improve microvascular perfusion and optimization of medical treatment.
Keywords: N terminal - pro B- type natriuretic peptide, ST elevation, Myocardial infarction, Primary percutaneous
intervention, Myocardial reperfusion.
INTRODUCTION
This study was conducted on 40 cases who
Primary PCI is the optimal reperfusion
were diagnosed with STEMI and received primary PCI.
technique in cases with STEMI within 12 hours of the
beginning of symptoms, by a skilled team (1).
Inclusion Criteria:
Fibrinolytic treatment is advised in patients without
Patients aged >18, who were presented with chest
contraindications within 12 hours of symptom onset if
pain associated with ECG changes fulfilling criteria for
prompt primary PCI is not possible following ST
diagnosis of STEMI within 48 hours of symptom onset
segment elevation myocardial infarction (STEMI)
or after 48 hours if they had persistent symptoms
diagnosis (2,3).
suggestive of ongoing myocardial ischemia or
Creatinine Kinase (CK), cardiac troponin, and
hemodynamic instability.
CK-Myocardial Band (CK-MB) levels rise when
STEMI occurs. N-Terminal-Pro-B-Type Natriuretic
Exclusion Criteria:
Peptide (BNP) is one of the cardiac biomarkers (4, 5). The
Patients who presented after 48 h from the onset of
stretch of cardiac myocytes is the primary stimulation
chest pain and with STEMI without evidence of
for pro BNP release in the heart (6). In addition to
ongoing ischemia, patients underwent thrombolytic
myocardial strain and hormones, hypoxia and NT-pro
reperfusion therapy, patients resuscitated from cardiac
BNP are other factors that may contribute to the
arrest, patients known to have heart failure with
monitored alterations in peptide plasma concentration
decreased ejection fraction (EF), patients with
in acute coronary syndrome (7).
congenital or valvular heart diseases, patients with
The present study aimed to study if the level of
pulmonary embolism, pulmonary hypertension or
NT-pro BNP before primary PCI can be used as an
chronic lung diseases, patients with cardiac infiltrative,
independent predictor for successful reperfusion in
inflammatory or infectious diseases, patients with hyper
cases presented with STEMI after primary PCI.
dynamic circulation (sepsis, anemia, liver cirrhosis
etc.), patients with severe renal impairment and patients
PATIENTS AND METHODS
with intracranial pathologies.
This is a prospective interventional study that
was performed in Coronary Care Unit and
Diagnosis:
Catheterization Lab Units of the Cardiology
The patients were diagnosed as ST segment
Department at Ain Shams University and MUST
elevation according to the 2017 European Society of
Hospitals, between September 2021 and June 2022.
Cardiology guidelines.
1831
Received: 10/08/2022
Accepted: 13/10/2022
c:\work\Jor\vol901_276
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1838-1843
Cleavage of Mucin by Partial Purified Protease Produced from
Gastrointestinal Escherichia Coli A29 Isolated from Iraqi Patients
Ataa R. Khayoon*, Ali J.R. AL-Sa'ady
Department of Biotechnology, College of Science, University of Baghdad, Baghdad, Iraq
*Corresponding author: Ataa R. Khayoon, Mobile: +9647739988271,
ORCID: 0000-0002-6699-4103, E-mail: ataa.raghad1206a@sc.uobaghdad.edu.iq
hABSTRACT
Background: Escherichia coli is one of the significant bacteria that belongs to Enterobacteriaceae bacteria family,
which found in human intestinal tracts. Several Escherichia coli clone have been known to be extremely virulent and
multidrug resistant. Escherichia coli poses a significant public health challenge for Iraq.
Objectives: The current study aimed to cleavage the mucin protein by partial purified protease enzyme produced by
pathogenic Escherichia coli bacteria. Materials and methods: This study was conducted on isolates of Escherichia coli
bacteria that isolated from stool of people with gastroenteritis and diarrhoea. These isolates were examined on skim
milk agar medium in order to screening of protease enzyme. Escherichia coli A29 was efficient isolate for protease
production. The protease enzyme was purified by ion exchange (CM-Cellulose column) and gel filtration
chromatography (Sephacryl S-300) after precipitated by ammonium sulphite saturation of 80%. Characterization for
protease enzyme was done for effect of pH and temperature on activity and stability. The next step was treatment of
protease (19250 U/mg) with mucin (0.11 mg/ml) and passed across the Sephacryl S-300 column.
Results: The results showed that the purification of protease by these chromatography techniques was given specific
activity of 19250 U/mg, purification fold 4.94 and yield 49. The maximum activity for purified protease was at pH 6.0
(77.527 U/ml) and pH stability for enzyme activity was between 5.5 and 9, while the optimum temperature was 37°C
(77.7 U/ml) and the stability for activity was kept between 15 and 50°C.
Conclusion: The protease was cleavage of mucin for 3 peaks which represent fragments of mucin.
Keywords: Purification, Characterization, Temperature, Stability, Biodegradation, Experimental Study, University of
Baghdad.
INTRODUCTION
Escherichia coli is One of the significant bacteria
MATERIALS AND METHODS
that belongs to Enterobacteriaceae bacteria family (1),
Some of material that used in this research was Skim
which found in human intestinal tracts. It was first
milk agar (Hi-media_ India), Trichloroacetic acid
known as "Bacterium coli commune" because Theodor
(TCA) (Alpha- chemika-India), Coomassie Brilliant
Escherichia found it in the colon of an infant's feces in
Blue G-250 (BDH-England), Carboxyme-thyl cellulose
1885. Depend on their shape and motility; these bacteria
(CMC), Sephacryl S-300.
were categorized as prokaryotes in the beginnings under
Protease production: A 147 bacterial isolates were
the name "Monera" (2).
obtained from hospitals in the city of Maysan which
In addition to E. coli strains that are harmless
were cultured on MacConkey agar plates and nutrient
commensals found in human gastrointestinal system,
agar (9). These isolates were tested for their ability to the
there are other strains which are pathogenic E. coli of
protease production, and these experiments were
humans and animals (30), which classified as those that
performed via primary and secondary screening on skim
cause disease inside the gastrointestinal tract and those
milk agar and brain heart infusion broth, respectively.
that can infect outside the gastrointestinal tract (3). The
The isolate of E. coli A29 which produced the largest
path type of E. coli has unique pathogenic mechanisms
protease, were cultured (75 ml) in Brain Heart Infusion
and unique virulence factors that are encoded by
Broth (flask of 250 ml) and incubated for 24 hours at 37
particular gene clusters (4), one of the most important
°C. After that, the culture was filtered through filter
virulence factors is protease activity (5). Proteases are
paper and centrifuged at 10000 rpm for 30 minutes. The
degradative enzymes that act as a catalyst for protein
supernatant was used to measure protease activity and
hydrolysis, have a molecular weight ranging from 18 to
protein concentration (10).
90 KDA. These enzymes can be created by animals,
plants, and microorganisms; however, they are typically
Protease activity assay: Protease activity was
formed by bacteria and fungi (6). Mucins are proteins
estimated according to method as describes in (11) by
have high-molecular weight which synthesized and
using (1%) casein as substrate.
secreted in many organs (7). They considered a highly
Protein concentration assay: Protein concentration
glycosylated proteins family, that make up the majority
was calculated according to Bradford (1976) (12).
of the organic parts of the mucus layer, which protects
Protease precipitation by ammonium sulfate: The
the epithelial cells in various organs of both humans and
supernatant of crude enzyme was fractionated at 4°C
animals, including the gastrointestinal tract (8).
with ammonium sulfate (0-80% saturation), ammonium
The current study aimed to cleavage the mucin
sulfate was gradually mixed with the enzyme solution
protein by partial purified protease enzyme produced by
for 2 hours on an ice bath with gentle stirring. After that
pathogenic Escherichia coli bacteria.
the enzyme solution was centrifuged for 20 minutes at
1838
Received: 03/12/2022
Accepted: 03/02/2023
c:\work\Jor\vol901_277
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1844-1856
Assessment of Nutritional Habits of Type-2- Diabetic Patients
Saad Abdul-Ridh Jissir *, Raheem Atiyah Badr, * *, Shakir Mahdi Salih***
* * College of Nursing. Al-Bayan University.
*** Al-Bayan University, College of Nursing
*Corresponding author: Saad Abdul-Ridh Jissir
E-mail: saad.a@Albayan.edu.iq, Mobile phone: +9647724516119, ORCID iD 0000-0002-1681-6560
ABSTRACT
Background: Diabetes mellitus is a disease characterized by hyperglycaemia resulting from defects in insulin
secretion, efficacy, or both. Improving glycaemic control among patients with type 2 diabetes is vital in preventing
micro- and macrovascular complications. Type 2 diabetes has become a serious threat to global health with an
increase in its incidence in Asian countries.
Objectives: The study aimed to assess the nutritional habits of type-2- diabetic patients, and to find out the
relationship between nutritional habits of type-2- diabetic patients with their demographic characteristics that include
age, gender, level of Educational, and duration of disease.
Subjects and methods: A quantitative descriptive design was accomplished in order to inspect nutritional habits of
type-2- diabetic patients. The study was carried out during the period from 30th December 2021 to 30th August 2022.
A purposive sample of 100 patients were selected. The sample consisted of 50 patients from Baghdad Al-Rusafa
Health Directorate/Al-Kindy Teaching Hospital and 50 patients from Baghdad AL-Karkh Health Directorate /Al-
Yarmouk Teaching Hospital.
Results: The study findings showed that the majority of the sample were of the age group (2130) years old, most
sample were males, quarter of them were Intermediate school graduate, 51% of patients, their HbA1c was between
8-9, which mean that more than half of patients were not controlling their blood sugar.
Conclusion: Related to patient's feeding pattern the results identified that there was deficit knowledge in patients
toward nutritional habits. Males were more than females regarding to use bad feeding pattern.
Key words: Assessment, Nutritional Habits, Type-2- diabetic mellitus.
INTRODUCTION
of the study instruments is established through a panel
Diabetes mellitus (DM) is the world's third-
of 10 experts; 4 from medical ward at Al-Kindy
largest, chronic, noninfectious disease after
Teaching Hospital, and 6 from College of Nursing,
cardiovascular diseases and cancer (1).
University of Al-Bayan. Test-retest has been obtained
Type 2 diabetes is caused by the lifestyle change
throughout evaluating 10 patients selected from Al-
of habits of most of the population such as poor diet
Yarmouk Teaching Hospital and Al-Kindy Teaching
and nutrition, obesity, physical inactivity, and stress
Hospital.
(2). Dietary habits and sedentary lifestyle are the major
factors for rapidly rising incidence of DM (3). Best
Ethical Clearance: All experimental protocols
management practices are to encourage patients to
were approved from Al-Bayan University. The
measure their blood glucose, take medications, and
research was carried out in accordance with
adjust their dietary habits to maintain health with the
approved guidelines.
disease (2). Dietary management is considered as a
major step in assessing a patient's knowledge (4).
Statistical analysis:
Poorly con-trolled DM can pose a considerable
According to the knowledge test questionnaire,
economic burden not only to patients but also to the
Pearson correlation coefficient was used, which was
society (5). The challenge for the patients is how to
0.84. Data has been analyzed throughout the use of
maintain the effective dietary pattern to manage their
simple statistical analysis and the inferential analysis
diabetes (4).
that included analysis of variance and the researcher
used the SPSS version 24.0 for analysis of data.
SUBJECTS AND METHODS
A descriptive design was accomplished in order to
RESULTS
assess the nutritional habits of type-2- diabetic
This table showed that the majority of the sample
patients. A purposive (non-probability) sample of 100
(36.0 %) were at the age group 2130 years old, (64%)
patients visited Outpatient Clinic in AL Kindy
were males, quarter of them (25%) were intermediate
Teaching Hospital and Al- Yarmouk Teaching
school graduate. 65 % had BMI of 2025, which
Hospital in Baghdad city. The sample consisted of 50
means healthy weight, while 40% of patients were
patients
from
Baghdad
Al-Rusafa
Health
diagnosed as diabetic in 2016 -2021 and 40% had
Directorate/Al-Kindy Teaching Hospital and 50
good control of blood sugar (HbA1c) as shown in
patients from Baghdad Al-Karkh Health Directorate
table (1) and figures (1, 2 and 3).
/Al-Yarmouk Teaching Hospital. The content validity
1844
Received: 08/08/2022
Accepted: 11/10/2023
c:\work\Jor\vol901_278
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1857-1861
Repair of Central and Marginal Perforations with Endoscopic Notched
Thinned Tragal Chondroperichondrial Graft Myringoplasty in Adults
Hoda Ismail Abdelhamid, Khaled Abdalshakour
Department of Otorhinolaryngology, Faculty of Medicine, Zagazig University, Egypt
Corresponding author: Hoda Ismail Abdelhamid, Mobile: (+20) 01279340645, Email: hodaismail200@gmail.com
ABSTRACT
Background: Tympanic membrane perforation repair methods are available in a variety of types and can typically be
categorised as underlay or overlay grafting methods. Each approach has a specific use, benefits, and challenges.
Objective: Evaluation of hearing level and closure of the tympanic membrane by the graft after endoscopic notched
thinned tragal chondroperichondrial graft myringoplasty with no need to elevate the tympanomeatal flap for repair of
central and marginal perforations.
Patients and Methods: A total of 30 participants with medium-sized central or marginal posterior perforations were
included. done for them endoscopically assisted with notched thinned tragal chondroperichondrial myringoplasty was
done for them. Measurements of hearing level and attachment rate of the graft after six months from the surgery, then
again nine months later on.
Results: At six months, the take rate of the graft together with complete closure of the perforation was 96.7% (29/30),
but after nine months, it was 93.3% (28/30). One patient experienced anterior annulus lateralization in addition to
extrusion, and there was still evidence of perforation. 2 patients had acute otitis media at the same side of surgery
resulting in a perforation. The mean preoperative gap between air and bone conduction (27.62 ± 3.15 dB) was more
significant than the mean air-bone gap postoperatively (12.16 ± 3.01 dB; P < 0 .05) at six months. However, there was
no statistically significant difference in the functional success rate (P 14.472), air-bone gap (ABG) levels (P 14.877), or
ABG gain (P 14 0.748) between the post-6 months or post-9 months.
Conclusion: Endoscopic notched thinned chondroperichondrial graft myringoplasty with no need to elevate the
myringomeatal flap is ideal for repairing central perforations. With minimally invasive technology. The long-term
success rate of the graft is as high as the short-term success rate, and the hearing results are promising.
Keywords: Endoscopy, Myringoplasty, Central perforation, Chondroperichondrial graft.
INTRODUCTION
tympanomeatal flap is not required because the
Overlay or underlay myringoplasty is required to
perichondrium graft is positioned to the lateral side of
treat perforations relating to the mucosal type of chronic
the bone annulus, and the posterior wall of the external
otitis media with intact ossicles. Generally speaking, the
auditory canal (EAC). We discussed our preliminary
underlay approach carries a higher likelihood of graft
findings regarding hearing improvement and grafting
failure. This is because marginal perforations cannot be
success rate.
supported by the residual natural tympanic membrane
(TM) (1,2). The graft lateralization, with anterior blunting
PATIENTS AND METHODS
of the overlay technique, makes it technically more
A total of 30 participants with medium-sized central
challenging and occasionally more time-consuming. To
or marginal posterior perforations were included.
increase the success rate of grafts, other surgical
Endoscopically assisted with notched thinned tragal
procedures have been devised, such as loop underlay
chondroperichondrial myringoplasty was done forthem.
tympanoplasty
and
over-under
tympanoplasty.
Measurements of hearing level and attachment rate of
Mediolateral graft myringoplasty together with the
the graft after six months from the surgery, then again
"window shade" technique are considered as some
nine months later on. The duration of such a prospective
different approaches to increase the success rate in such
case study was January 1, 2020, to December 31, 2021.
cases (3-7).
A medium-sized central or marginal perforation located
To enhance the taking rate of grafts, all of these
posteriorly, an intact ossiclles without atticoantral
procedures call for the elevation and repair of
disease or cholesteatoma, and a requirement for TM
tympanomeatal flaps of various sizes. The operation
closure were among the inclusion criteria. It is
took longer because of the elevation. Although there
necessary to rule out ossicular chain erosion or
may be no need to elevate the tympanomeatal flap in
discontinuity besides secondary cases. To rule out
butterfly cartilage tympanoplasty, it can be challenging
cholesteatoma of the middle ear, computed tomography
to guarantee that the cartilage part of the graft groove
for the temporal bone/magnetic resonance imaging was
closely matches the perforation borders (8-10).
needed. P audiometry of pure tone type was performed
In this study, central perforations together with marginal
prior to operation, as well as 6 and 9 months later, at 0.5,
posterior ones are repaired using notched thinned
1, 2, and 3 kHz standard frequencies. The average
cartilage-perichondrium graft myringoplasty. Elevated
difference in conduction between air and bone at 0.5, 1,
1857
Received: 08/08/2022
Accepted: 13/10/2022
c:\work\Jor\vol901_279
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1862-1868
Transforming Growth Factor- Beta1 in Relation to Glomerular
Filtration Rate in Healthy Elderly Egyptians
Mohammed Esmat1, Noha Mohamed Hosny Shahein2, Sahier Omar EL-Khashab 1 ,Ahmed Yamany Ali1
1Internal Medicine department, 2Clinical pathology department, Faculty of Medicine, Cairo University, Cairo, Egypt
Corresponding author: Ahmed Yamany Ali, E-mail: themythaysa@kasralainy.edu.eg,
Tel number: +0201110006233,ORCID 0000-0002-6383-9466
ABSTRACT
Background: Owing to high burdens of chronic kidney disease (CKD) worldwide, research targeting early detection
of impaired kidney function merits attention. Transforming growth factor-1 levels (TGF- 1) regulates renal fibrosis
and rises in different kidney diseases.
Objectives: The present study aimed at evaluating the serum level of TGF- 1 in relation to estimated glomerular
filtration rate (eGFR) in elderly healthy individuals.
Methods: This cross-sectional study included 55 individuals, aged above 60 years. Serum level of TGF- 1,
microalbuminuria and eGFR were estimated. Systolic and diastolic blood pressure were measured.
Results: There was a significant negative correlation between GFR and TGF-1 values (r value= -0.731, P = 0.001).
Twenty-four hours urinary proteins and TGF-1 levels showed a positive significant correlation (r-value = 0.713,
p<0.001). There was no statistically significant difference in TGF- 1 values between males and females (P = 0.832).
TGF-B showed good sensitivity: 90.7%; poor specificity: 41.7% at a cut-off of 41.5 with AUC: 0.85; p value < 0.001
to be an indicator for reduced e GFR.
Conclusions: TGF- 1 levels could be a potential marker for early detection of renal diseases in elderly individuals.
Keywords: Chronic kidney disease, Transforming growth factor, fibrosis, elderly, glomerular filtration rate
INTRODUCTION
fibrogenesis (9). Moreover, it is potentially associated
Chronic kidney disease (CKD) is frequent in the
with the fibrogenic response that disturbs the layers of
older people, presenting mainly with decline in
glomerular filtration membrane barrier and causes
estimated GFR rather than proteinuria (1). One of the
functional loss with proteinuria (10)
attributable factors to occurrence of CKD among the
TGF-1 has significant growth inhibitory
elderly people is the mounting prevalence of traditional
actions in a variety of cell types including renal cells in
risks like diabetes mellitus, (2) hypertension and
normal elderly population (11), and earlier research has
arteriosclerosis disorder (3) . Moreover, the range of the
related TGF-1 to cellular senescence and ageing (12).
estimated glomerular filtration rate (eGFR) for CKD
Accordingly, the present study aims at
has been broadened by new definitions (4).
evaluating the serum level of Transforming growth
Aging itself seems to be associated with a higher
factor-1 in relation to eGFR as a early predictor for
incidence of nephrosclerosis and recurrent tissue
CKD in elderly apparently healthy individuals
inflammation (5). Better understanding of the
morphological, physiological, and functional changes
SUBJECTS AND METHODS
in aging kidneys draws up the attention to the geriatric
Study setting and sampling:
nephrology care (6).
This cross-sectional study was conducted on 55
For high burden of CKD associated with rising
Egyptian apparently healthy individuals aged over 60
morbidities, early detection, and management of
years. A convenient sample of patients was recruited
potential factors of developing CKD are mandated. The
from outpatient clinic of nephrology at Cairo
end-tributary for CKD regardless the causes is
University. While patients with hypertension, diabetes
increased intraglomerular hypertension produced by
mellitus, liver diseases or chronic kidney diseases were
hormones and cytokines milieu as Angiotensin II
ruled out from the study.
resulting for arteriolar vasoconstriction, whereas
transforming growth factor- 1 (TGF-1) causes
Methodology
fibrosis (7,8)
All patients underwent a thoroughgoing medical
TGF-1 is a multifaceted protein family. Its
history, and clinical examination.
production is adjusted by gene polymorphism of TGF-
beta gene. TGF-1 plays a role in controlling cell
Laboratory investigations
proliferation & differentiation, and particularly it
All laboratory workup was performed within one
modulates
fibroblast
action
thus
stimulating
hour after the collection of samples. Complete blood
1862
Received: 05/10/2022
Accepted: 31/12/2022
c:\work\Jor\vol901_280
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1869-1876
Comparison of Plaque Retention in Different Commercially Available
Clear Aligners Using An ATP Bio-Luminometer
Shubhita Sethi 1, Shailesh Deshmukh2, Veera Bhosale2, Priya Deo3, Siddharth Shinde2 ,Simran Sharma1
1 - Post Graduate, Department of Orthodontics and Dentofacial Orthopedics, Bharati Vidyapeeth
Dental College & Hospital, Pune, Maharashtra, India.
2 Faculty, Department of Orthodontics and Dentofacial Orthopedics, Bharati Vidyapeeth Dental
College & Hospital, Pune, Maharashtra, India.
3 Faculty, Department of Oral and Maxillofacial Pathology and Oral Microbiology, Bharati
Vidyapeeth Dental College & Hospital, Pune, Maharashtra, India.
Corresponding Author: Dr Siddharth Shinde, Assistant Professor, Department of Orthodontics, Bharati Vidyapeeth (Deemed to be
University) Dental College & Hospital, Pune, Maharashtra, India. Phone no: +91 9766000500, Email: siddharth8785@gmail.com
ABSTRACT
Objective : The study was designed to compare 4 different commercially available brands of clear aligners based on
their plaque retention properties after 14 days of wear.
Methods: 26 aligners were evaluated under each brand, making it a total of 104 aligners. ATP Bio-luminescence was
used to quantify the microbial plaque adherent to the inner surface of aligners after being thoroughly rinsed, dried and
cleaned. The patients were also asked to fill out an oral hygiene proforma, to eliminate the subjective factors. to remove
any patient subjectivity (rewrite).
Results: The plaque retention on different brands of clear aligners after 14 days of wear showed no statistically
significant difference. However, a positive correlation was observed between oral hygiene habits such as frequency of
brushing and mouthwash, habits's remove) frequency of consumption of sugar added drinks and plaque retention on the
aligner surface.
Conclusion: The 4 brands of commercially available clear aligners studied were highly comparable with no significant
difference in terms of plaque retention.
Keywords: Plaque retention, Clear Aligners, Aligners, ATP Bio-Luminometer.
INTRODUCTION
restorations. The location of plaque in the oral cavity is
In an attempt to find a more hygienic and
significantly associated with diseases of the
aesthetic alternative to orthodontic bands and brackets,
periodontium. While marginal plaque, is seen to have a
clear aligners have revolutionized the field of
high significance in the initiation and development of
orthodontics. They have not only offered an advantage
gingivitis, supragingival plaque and tooth-related
on the aesthetic front but have also proven to facilitate
subgingival plaque are considered vital in calculus
good oral hygiene (1,2) . With the advantage of being able
formation and root caries. Similarly, tissue-related
to remove the aligner and clean the tooth surface
subgingival plaque plays an important role in tissue
appropriately, clear aligners have tremendously
destruction that is visualised as different forms of
improved oral hygiene conditions with orthodontic
periodontitis.5 Plaque with orthodontics has resulted in
treatment (3). However, despite these advantages,
various instances of enamel demineralization and white
various case reports have described instances of enamel
spot lesions (6,7) .
demineralization, decalcification, and increased
ATP (Adenosine Triphosphate) is a chemical
instances of dental caries in patients undergoing
substance acting as an energy source for all living
orthodontic treatment with clear aligners (4) .
organisms. The presence of ATP is considered as proof
Clear aligners cover the overall surfaces of teeth
of the presence of a living organism or a substance
and gingiva, i.e., the palatal, lingual, labial, buccal,
produced by the organism. ATP measurement was
occlusal, and incisal surfaces. This is seen to have a
developed to estimate bacterial cell numbers in
direct influence on the oral microbial flora and plaque
biological samples to ensure the microbiological
retention as they prevent the natural cleansing of teeth
quality. ATP bioluminescence reaction is one in which
by obstructing the flushing, buffering, and
ATP is enzymatically consumed to produce light.
remineralizing effect of saliva and mucous tissues.
Specifically, in the presence of the substrate luciferin,
Moreover, by interrupting the usual cleansing action of
the enzyme luciferase uses the energy from ATP to
the tongue, lips, and cheeks they allow increased
oxidise luciferin and release photons (light at a
entrapment of food and dental plaque under the aligner
wavelength of 562 nanometres). These released photons
surface leading to increased demineralization and
are then detected and measured by a luminometer, that
decalcification (4).
is equipped with a photomultiplier tube, accurately
Dental plaque which is primarily composed of
quantifying the ATP present (8). ATP bioluminescence
bacteria in a matrix of salivary glycoproteins and
being a highly rapid, accurate and non-invasive
extracellular polysaccharides adheres tenaciously to the
technique has slowly been gaining immense popularity
intraoral hard surfaces, including removable and fixed
1869
Received: 08/08/2022
Accepted: 13/10/2022
c:\work\Jor\vol901_281
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1877-1885
The Effects of Air Pollution Exposure on The Different Serum and Saliva Proteins
Levels: A Pilot Study on The Workers at HFO Combustion Unit in
AL- Dora Electricity Station/ Baghdad, Iraq
Aisha Majeed Ahmed1* and Hathama Razooki Hasan2
1,2Department of Chemistry, College of Science, University of Baghdad, Iraq
*Corresponding author: Aisha Majeed Ahmed, Mobile: 009647506016934,
E-mail: hathama.r@sc.uobaghdad.edu.iq , hathama2012@gmail.com
ABSTRACT
Background: Many studies reported that exposure to hazardous air conditions such as chemicals, fumes, diesel exhaust
affects human health and become a major concern globally. Body proteins play central roles in cell structure and
functions. Aim: Although exposure to such exposure at the workplace has negative effects on health. This pilot study
aimed to follow the changes in the total protein [T], albumin [A], globulin [G], and [A/ G] ratio in the sera and saliva
samples of workers who are exposed to the fume emitted from heavy fuel oil (HFO) combustion unit.
Participants and Methods: Workers (N=59) at the heavy fuel oil combustion unit in electricity station of Al- Dora
station/ Baghdad/ Iraq and 53 unexposed age and gender matched healthy individuals were the participants of this study.
The levels of serum and salivary total proteins and albumin were measured, and the level of globulins and albumin /
globulin ratio were calculated.
Results: There were variations in both serum and salivary total protein [TP], albumin [A], globulin [G] and [A]/ [G]
ratio between that of the workers group and the control healthy group. The impact of the fume combustion on the studied
biochemical parameters were further analyzed based on the workers age, period of their service, smoking habit and
using of safety equipment.
Conclusion: The results of this pilot study showed that the impact of the air pollution resulted from the HFO combustion
on salivary [TP], [A], [G] and [A]/ [G] ratio was more than that on the serum of the workers' group.
Keywords: total protein, albumin, globulin, albumin/globulin ratio.
most of these constituents which are not part of normal
INTRODUCTION
salivary components can reach saliva via intracellular (
Occupational
exposure
to
harsh
work
by passive transfer) and extracellular (by ultra-
environment such as dusty, noisy, extreme climate, and
filtration) routes (8).
that pollutant with different chemicals in the workplace
Since there has a need for clearly elucidated the
influence human health. And this becomes one of the
underlying mechanism inducing the harmful effect of
major public health concern worldwide resulting in
air pollution on human health and to evaluate the
multiple chronic disease which associate air pollution (1,
outcome of chronic exposure as early as possible,
2). Heavy fuel oil (HFO), which is referred to as bunker
therefore this pilot study aimed to look for the alteration
fuel, or residual fuel oil, consists of remnants of
in the concentrations of total proteins (TP), albumin (A),
petroleum sources which is produced upon the
globulins (G) and the A / G ratio in serum and saliva of
extraction of higher hydrocarbons quality using thermal
individuals who are exposed to the fume emitted from
and catalytic cracking (3). Thus, HFO composition is
HFO combustion. Meantime looked for the possibility
highly variable, since it is often blended, or mixed
of using saliva instead of blood serum to check up such
streams including carbon numbers ranges from 20-
alteration, since saliva, is easier and doesn't need
more than 50. As such this type of fuel is usually
special care and experience to be collected.
contaminated with different types of particles and
compounds such as aromatic, asphaltenes and olefins,
PARTICIPANTS AND METHODS
in addition to particulates that contain S, N, and metallic
Study participants:
molecules and compounds (4, 5).
This study participants were males (N= 59) who are
Proteins are the major components of all cells
working at the HFO combustion unit in the electricity
and play a central role in cell structure and functions,
Dora station/ Baghdad/ Iraq ,as well as age, gender and
they are present in all body fluids and serum contains a
body mass index (BMI) matched apparently control
mixture of proteins that differ in origin and function.
healthy individuals (N=53). Biological samples were
The amount of protein in the vascular compartment
collected during the period of December 2021 to
depends on the balance between the rate of its synthesis
February 2202.
and the rate of its catabolism, or loss (6). Li et al. reported
that the alteration in serum protein may be used as a
Ethical approval
biomarker to predict the occupational hazard risk (7).
The ethics Committee of the College of Science/
In recent years, attempts have been made to
University of Baghdad had approved this study
replace blood test by other body fluids. Serum
protocol.
constituents are reported to be found in whole saliva, as
Exclusion criteria
a result of gingival crevicular fluid (GCF) outflow and
1877
Received: 07/10/2022
Accepted: 10/12/2022
ABSTRACT
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1886-1894
Short-Term Evaluation of Immediate Breast Reconstruction with
Latissmus Dorsi Flap after Mastectomy
Ashraf Farok Abader, Gamal Fawzy Samaan*, Ahmed Adel Ain Shoka, Yasmine Hany El-Zoheiry
Department of General Surgery, Faculty of Medicine Ain Shams University, Egypt
*Corresponding author: Gamal Fawzy, Mobile: (+20) 01220495554, E-Mail: dr.gamalfawzy@yahoo.com
ABSTRACT
Background: The patient will have psychological benefits with immediate breast reconstruction, including reduced
emotions of physical mutilation and impaired femininity, shorter surgical times, and lower costs. It simplifies the
rebuilding process for the surgeon and enhances cosmetic outcomes.
Objective: This result was conducted to do short-term evaluation for breast reconstruction in breast cancer patients.
Patients and Methods: Our study was conducted on 40 patients diagnosed with breast cancer who underwent
mastectomy followed by immediate breast reconstruction with latissimus dorsi (LT) myocutaneous flap.
Results: According to the information that is now available, immediate breast reconstruction is both oncologically
safe and had no detrimental effects on the recurrence rate or the ability to identify and treat recurrences after a precise
surgical dissection. Therefore, in virtually all situations when breast reconstruction is intended, using quick rebuilding
of the breast is seen to be the best course of action. The most successful and efficient way of reconstruction was found
to be LD flap surgery. Despite the significant skin pockets, the LD flap produced extremely good aesthetic results and
symmetry in our patients in the shortest amount of time.
Conclusion: It was found that the use of LD flap is reliable and versatile method of breast reconstruction. It gives adequate
tissues that obviates the use of prosthesis, and gives excellent satisfactory aesthetic results, with good matching and better
quality of life.
Keywords: Latissimus dorsi, Modified radical mastectomy, Nipple areolar complex, Nipple sparing mastectomy.
INTRODUCTION
operating room time and inpatient hospital days, which
The most prevalent type of cancer, breast
contributed to the rapid reconstruction's overall
cancer is also the second most common reason for
cheaper cost. Immediate breast reconstruction has been
death from cancer. The loss of a breast may
proven to be oncologically safe in terms of local
significantly harm a woman's perception of her body
recurrence and survival. It doesn't affect adjuvant
and sense of beauty because a woman's breasts are the
therapy and doesn't raise the likelihood of local or
primary emblem of her femininity (1).
regional recurrence (4).
Despite developments in conservative surgery,
Skin sparing mastectomy, Nipple areola
mastectomy is frequently the suggested surgical course
sparing mastectomy, and skin sparing mastectomy
of action. These include patients refusing breast
include breast tissue removal techniques for quick
conservative surgeries (BCS), recurrence after BCS,
breast
reconstruction.
The
latissimus
dorsi
inadequate safety margin in breast conservative
myocutaneous flap reconstruction produces in a breast
procedures, multifocal, multicentric tumours, centrally
with ptosis and projection while retaining the natural
placed or locally progressed tumours, and multifocal,
consistency and feel of normal tissue. Keeping the
multicentric tumours (2).
natural skin envelope helps with breast shaping during
Breast renovation after mastectomy has grown
reconstruction. Due to the enormous surface area of
in importance as a component of breast cancer patients'
the muscle, this flap offers sufficient mass for
care throughout the past century. Breast reconstruction
rebuilding (5).
was first developed to lessen chest wall abnormalities
Seroma, hematoma, infection, hypertrophic
and mastectomy-related problems. However, it is now
scarring, partial flap necrosis, skin loss, locoregional
understood that rebuilding can also enhance patients'
recurrence, and dissatisfaction are among the
psycho-social wellbeing and quality of life. Breast
complications of breast reconstruction (6).
reconstruction's main objective is to restore shape and
Through a multidisciplinary team approach,
symmetry by addressing the anatomical defect while
this study intended to prospectively measure general
maintaining the patient's safety and health (3).
and aesthetic satisfaction, evaluate the influence on
Breast reconstruction that is performed
quality of life, and investigate the oncologic safety,
immediately after a mastectomy is known as
cosmetic result, and technical viability of rapid breast
"immediate
reconstruction,"
whereas
delayed
reconstruction.
reconstruction is performed months or years
afterwards. With quick repair, the aesthetic outcome,
PATIENTS AND METHODS
psychological impact, and cost of breast reconstruction
Patients
are all improved. The fact that the mastectomy and
Our study was conducted on 40 patients
reconstruction were performed together as opposed to
diagnosed with breast cancer who underwent mastectomy
as two separate procedures resulted in a reduction in
followed by immediate breast reconstruction with
1886
Received: 10/08/2022
Accepted: 13/10/2022
c:\work\Jor\vol901_283
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1895-1902
Pressure/Volume Ratio as a Simple Parameter for Assessment of
left Ventricular Contractile Reserve during Stress Echocardiography
Mohamed Mohsen Mohamed, Zeinab Hassan El-Sayed, Magdy Mohamed Abdel El-Samei,
Ghada Ibrahim Mohamed
Department of Cardiology, Faculty of Medicine- Zagazig University, Egypt
Corresponding author: Zeinab Hassan El-Sayed, Email: Zeinab.badr49@gmail.com Mobile: 01021231189
ABSTRACT
Background: In patients with heart failure, the presence of left ventricular contractile reserve (LVCR) during stress echo
(SE) may result in a good response to cardiac resynchronization therapy (CRT).
Aim: To assess the feasibility and accuracy of LVCR by Peak Rest (Systolic Blood Pressure End Systolic Volume)
(SPBESV). One can calculate the left ventricular contractile reserve by dobutamine stress echocardiography and assess the
correlation of this method to EF related LVCR.
Patients and methods: On 71 patients, this cross-sectional investigation was carried out. They were recommended to
perform dobutamine echocardiography either to assess ischemia in those with intermediate pretest probability or to assess
viability in those with a kinetic wall motion and with those with low ejection fraction. Every patient underwent a thorough
history review, general examination, and local examination. ECG, resting and stress transthoracic echocardiography.
Results: CR Simpson showed a moderate positive significant correlation with the peak-rest EF Simpson in the viability
group and moderate positive significant correlation in the ischemic group. While CR m-mode and peak-rest EF m-mode
had a significant correlation in the ischemic group and a non-significant one in the viability.
Conclusion: With the two techniques for obtaining the raw ESV values required to calculate Force, LVCR can be estimated
with accuracy. While the Simpson approach is more accurate in calculating absolute ESV values, m-mode may also
accurately analyse relative (rest-stress) changes. There was no discernible difference between the viable and non-viable
groups in terms of LVCR by peak-to-rest ratio in the ischemic and non-ischemic people.
Keywords: Contractile reserve, Stress echo, Heart failure.
INTRODUCTION
(normal LVCR values) have a better prognosis than
The main cause of death worldwide is coronary
patients with a "weak" heart (reduced LVCR values), and
artery disease (CAD), which continues to claim millions
that force-based contractile reserve has a better prognostic
of lives each year despite recent declines in mortality rates
value than ejection fraction-based contractile reserve, or
in several nations. Therefore, having accurate methods for
RWMA (6). The calculation of force, also known as
diagnosis and risk classification is crucial of it (1).
elastance expressed by the ESP/ESV ratio, is an alternate
The cornerstone of stress echocardiography (SE)
method. Suga and Sagawa (7) employed this method in
for the evaluation of patients with coronary artery disease
their groundbreaking experimental work. Nowadays, the
(CAD) and/or heart failure is the detection of regional
word force is preferred. Due to its sensitivity to inotropic
wall motion abnormalities (RWMA) (HF) (2).
changes and comparatively high degree of independence
The primary cardiac imaging method for
from ventricular load, it has been taken into consideration
determining the diagnosis and risk of heart disease is
for the evaluation of contractile function (8).
stress echocardiography (SE), which is based on the
Force is expressed as the ratio of peak systolic
identification of regional wall motion abnormalities
blood pressure by cuff sphygmomanometer and end-
(RWMA), stratification of CAD recommended by
systolic volume (ESV) by 2-D echocardiography (5).
guidelines (3) and also it has a role for determining the
Because force does not require the measurement of EDV
myocardial viability and determining whether the
in addition to ESV, EF is simpler than force (9). Force is
myocardium dysfunction would be improved by
more reproducible because EF calls for manually tracing
revascularization (4). The evaluation during times of
the endocardial contours in two projections at the end of
stress, of the global left ventricular (LV) contractile
diastole and systole. Any measurement inaccuracy is
reserve (LVCR). A load-independent indicator of left
exacerbated as these values are added together and
ventricular contractile reserve (LVCR) with stress echo is
multiplied to determine the EF. Additionally, it is easier
the peak stress/rest ratio of the left ventricle (LV) (SE). (5).
to see the specular endocardial borders at end-systole
For milder inotropic stimuli like dobutamine or
because myocardial backscatter reflectors lose intensity at
exercise stress, the cut-off values for a preserved LVCR
end-systole compared to end-diastole. Endocardial
are 2.0 and 1.1, respectively. The prognostic "bright side
borders are more clearly defined towards the conclusion
of the force" states that patients with a "strong" heart
of systole than the end of diastole because of the
1895
Received: 17/08/2022
Accepted: 20/10/2022
c:\work\Jor\vol901_284
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1903-1909
Vitamin B12 and Brain-Derived Neurotrophic Factor in Diabetic
Patients with Chronic Generalized Pruritus
Nancy Wadie Mikhael1, Asmaa A. Elfallah2, Alzahraa Mosa Ahmed1, Karem Taha Khalil*1
Departments of 1Dermatology, Venereology and Andrology and
2Clinical Pathology, Faculty of Medicine Benha University, Egypt
*Corresponding author: Karem Taha Khalil, Mobile: (+20) 01282559828, E-Mail: karem.nawar_76@yahoo.com
ABSTRACT
Background: A common and bothersome condition with a complicated pathophysiology, including neuropathy, is
diabetes-related pruritus. The growth factor known as "brain-derived neurotrophic factor" (BDNF) affects how nerve
cells survive, differentiate, and are maintained.
Objectives: To measure the serum levels of BDNF and vitamin B12 (vitB12) in diabetic patients with generalized
Pruritus.
Patients and Methods: One hundred fifty participants were included in this case-control research. They were split
into three equal groups: diabetes patients with chronic generalized pruritus (n=50), diabetic patients with no pruritus
(n=50), and normal age-sex matched control subjects (n=50). Complete clinical information, including the duration of
diabetes, the duration of pruritus, and a history of drugs, was gathered. Using the 12-Item Pruritus Severity Scale (12-
PSS), the severity of the pruritus was evaluated. A thorough general and dermatological evaluation was performed.
Lab tests included FBS, PPBS, and HbAIC. Additionally, ELISA was used to measure the serum levels of BDNF and
vitB12.
Results: Serum vitB12 and BDNF levels were significantly different among the study groups (P=0.000, P=0.000,
respectively) with higher levels in diabetics compared to controls. Diabetics with pruritus exhibited higher vitB12,
BDNF levels than diabetic non-pruritic group (P1=0.005, P1=0.000, respectively). Both vitB12 and BDNF showed
significant positive correlation with 12-PSS (r=0.499, P=0.000; r=0.513, P=0.000, respectively). BDNF was positively
correlated with vitB12 (r=0.518, P=0.000). There was a significant positive correlation between BDNF and the
duration of diabetes and FBS, PPBS, HbA1C (P=0.000).
Conclusion: Increased serum levels vitB12 and BDNF levels might explain the cause of chronic generalized pruritus
in diabetic patients.
Keywords: Brain-derived neurotrophic factor, Diabetes mellitus, Pruritus, Vitamin B12.
INTRODUCTION
barrier (12), and its serum concentration can reflect the
Among diabetes patients, pruritus is a typical
nervous system concentration (13).
symptom (1). If the itching continues for more than six
Vitamin B12 (vitB12) is a vitamin that is
weeks, it is considered chronic. Diabetes mellitus
required for proper hematopoietic and neurocognitive
(DM) is one of the systemic diseases that is frequently
processes. Biochemical and clinical vitB12 deficiency
connected to pruritus (2). Patients with type 2 diabetes
has been shown to be extremely common in people
(T2DM) may develop pruritus in the range of 18.4% to
with type 1 and type 2 diabetes mellitus (14).
27.5% (3).
The aim of the work was to measure the serum
The pathophysiology of itching in diabetic
levels of (BDNF) and vitamin B12 (vitB12) in diabetic
people is unclear, and antihistamine therapy has failed
patients with generalized Pruritus.
in many patients. Skin disorders, neuropathy, end-
stage kidney disease, and subsequent to hypoglycemic
PATIENTS AND METHODS
medications are all linked to the onset of pruritus in
Study population and design
diabetic patients (4). Diabetic patients can sometimes
The current study is a case-control study.
feel pruritus for no obvious reason (5).
Participants were recruited from the Dermatology &
Neurotrophins are chemicals that enhance
Andrology Department, Faculty of Medicine, Benha
neuronal development, health, and survival (6). Among
University Hospitals, between October 2021 and July
them, brain-derived neurotrophic factor (BDNF) has
2022. Three study groups were composed of: fifty
emerged as an important regulator of synaptic
diabetic patients with chronic generalized pruritus
plasticity, neuronal survival, and differentiation (7), as
(group A), fifty diabetic patients with no pruritus
well as systemic or peripheral inflammatory diseases
(group B), and fifty age- and sex-matched healthy
such T2DM (8). BDNF maintains high levels of
volunteers served as a control group (group C).
expression in the adult brain and modulates both
excitatory and inhibitory synaptic transmission (9, 10).
Inclusion criteria:
BDNF is expressed in a variety of non-neuronal
Diabetic patients older than 18 years complaining of
organs, with platelets being the primary source of
chronic generalized itching with no primary skin
peripheral BDNF (11). BDNF can pass the blood-brain
1903
Received: 28/08/2022
Accepted: 01/11/2022
c:\work\Jor\vol901_285
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1910-1914
Healthcare Effect and Safety of Patients with Persistent Non-Valvular
Atrial Fibrillation Using NOAC and Warfarin
Ali Abd El-fatah Morsi Atwa*, Mohamed Abd Elkawy Eid, Ekhlas Mohamed Hussein
Department of Cardiology, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Ali Abd El-fatah Morsi Atwa, Mobile: (+20)01007169349, Email: ali_atwa@ymail.com
ABSTRACT
Background: For patients with persistent non-valvular atrial fibrillation (NVAF), chronic anticoagulation has
traditionally been the mainstay of therapy. Warfarin and other vitamin K antagonists were the sole choices up until
recently.
Objective: To evaluate the healthcare effect and safety of patients with persistent with NVAF using Novel oral
anticoagulant (NOAC) and those using warfarin group.
Patients and Methods: The study consisted of 124 patients with non-rheumatic atrial fibrillation on their
anticoagulation drug. Patients were classified into two main groups according to the drug used as an anticoagulant:
Group I: 62 patients with non-valvular atrial fibrillation take warfarin drug 39 men and 21 women ranging in age from
40 to 75 years old. Group II: 62 patients with nonvalvular atrial fibrillation take NOAC drugs, 36 men and 25 women
of varying ages 40 to 75 years.
Results: Thrombotic complications: In NOAC group I: there were 5 cases of thrombotic complications per year. In
Marivan group II: there were 15 cases of thrombotic complications per year. The net result showed that the incidence
rate of occurrence of thrombosis among the marivan group was 25% per year compared to 8.2% in the NOAC group.
There was a statistically significant difference between both groups regarding thrombotic complications. The net result
showed that the incidence rate of occurrence of thrombosis among the marivan group was 20% per 6 months compared
to 8.2% in the Noac group. There was a statistically significant difference between both groups regarding thrombotic
complications.
Conclusion: Overall evidence indicates that NOACs can be considered a safe and effective alternative to warfarin in
these subgroups of patients.
Keywords: Conventional anticoagulant therapies, Recent anticoagulant therapies, Atrial fibrillation.
INTRODUCTION
PATIENTS AND METHODS
The most prevalent persistent arrhythmia in clinical
The work was carried out during the years 2015 and
practice is atrial fibrillation (AF), which has a
2016 in the cardiology department, faculty of medicine,
significant excess of cardiovascular morbidity and
Zagazig University and Civil Aviation Cardiology
death (1).
Clinics.
For patients with persistent nonvalvular atrial
fibrillation (NVAF), chronic anticoagulation has always
Patient population:
been the mainstay of therapy, and up until recently, the
The study consisted of 124 patients with nonrheumatic
only accessible alternatives have been warfarin and
atrial fibrillation on their anticoagulation drug. Patients
other vitamin K antagonists (2).
were classified into two main groups according to the
Patients with AF and VTE are being treated with
drug used as an anticoagulant:
new oral anticoagulants more often. Continued safe
Group I: 62 patients with nonvalvular atrial
usage should result from a complete grasp of their
fibrillation take warfarin drug 39 males and 21
pharmacology and practical advice on how to utilize
females ranging in age from 40 to 75 years of age.
them (3).
Group II: 62 patients with nonvalvular atrial
For fifty years, oral anticoagulant treatment has
fibrillation take NOAC drugs 36 men and 25 women
been mostly based on coumarins or vitamin K
of varying age from 40 to 75 years.
antagonists (VKAs). Their efficacy has been
demonstrated in carefully planned clinical trials for the
Exclusion criteria:
primary and secondary prevention of venous
Pregnancy.
thromboembolism, the primary prevention of acute
Rheumatic heart disease.
myocardial infarction in high-risk men, the primary
Prosthetic valves.
prevention of stroke, recurrent infarction, or death in
High Has-Bled score value.
patients with acute myocardial infarction, and the
Congenital heart disease.
prevention of systemic embolism in patients with
prosthetic heart valves or atrial fibrillation (4).
Methods:
The aim of this study was to evaluate the healthcare
All patients studied were subjected to the following:
effect and safety of patients with persistent NVAF using
1. History taking: Age, sex, and risk factors such as
NOAC and patients using warfarin groups.
diabetes, hypertension, in addition to congestive
1910
Received: 09/09/2022
Accepted: 12/11/2022
c:\work\Jor\vol901_286
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1915-1922
Total Neoadjuvant Therapy Using Short Course Radiotherapy Followed by
Chemotherapy in Locally Advanced Rectal Cancer
Sara Mahmoud Elzayata, Fatma M. F. Akla, Saleh Mansour Taemaa,
Osama Mohammed Eldamshetya, Dalia Hatem Zayeda*
Clinical Oncology and Nuclear medicine Department, Faculty of Medicine, Mansoura University, Egypt
*Corresponding author: Dalia Haten Zayed, (+2)01008641044; e-mail: dhmzayed@gmail.com
ABSTRACT
Background: The most common neoadjuvant therapy for locally advanced rectal cancer is fluoropyrimidine-based
chemotherapy combined with radiation (45-50.4 Gy) (LARC). Recently many studies focusing on shifting systemic
chemotherapy to preoperative setting to increase pathological complete response rate (pCR).
Patients & Methods: This is a randomized controlled trial (RCT) of stage II-III rectal cancer patients treated from October
2020 to April 2022. They were randomized into: Experimental group: Total neoadjuvant therapy (TNT) with short course
radiotherapy (25 Gy) then chemotherapy (Capecitabine and Oxaliplatin) for 6 cycles followed by total mesorectal excision
(TME). Control group: Standard long course concurrent chemo radiotherapy (LC-CCRT, 45-50.4Gy) with Capecitabine
followed by TME and adjuvant chemotherapy. Primary end points were pathological complete response (pCR) and disease
related treatment failure (DrTF). Secondary end points were restricted mean survival time at 12 months (RMST), toxicity
and surgical complications. Results: High risk criteria as N2 and infiltrated mesorectal fascia (MRF) were statistically
higher in TNT group (p=0.005, p= 0.04 respectively). Complete response was achieved radiologically in 11.5% and
pathologically in 33.3 % exclusively in TNT group. Restricted mean survival time (RMST) at 12 months was 11.6 months
in TNT group and 11.1 months in control group. Pathological complete response was statistically correlated to improvement
in DrTF and RMST at 12 months (p =0.01). Conclusion: Short course radiotherapy with neoadjuvant chemotherapy is a
good alternative to the standard LC-CCRT with less hospital treatment days and cost especially after COVID 19 pandemic.
Keywords: Locally advanced rectal cancer, Total neoadjuvant therapy, Short course radiotherapy.
INTRODUCTION
cancer demonstrates high response rate and radical
According to cancer registry report in Egypt,
resection in Dutch phase II trial (9).This study aimed to
rectal cancer constituted 13% of patients who were
compare between total neoadjuvant therapy (TNT) with
experiencing colonoscopy and represent 40% of all
short course RT followed by preoperative chemotherapy
colorectal cancer (1). Multimodality treatment including
(experimental group) and the long course concurrent
high quality total mesorectal excision (TME) and chemo
chemo radiotherapy (LC-CCRT) (control group) in
radiotherapy is the standard of treatment of locally
treatment of non-metastatic stage II-III rectal carcinoma.
advanced rectal cancer (LARC) and development of
The primary outcome is to estimate the rate of
neoadjuvant therapy improved the outcomes as regards
pathological complete response, disease related treatment
local and distant failure rate (2).
failure (DrTF), which was defined as locoregional
The Swedish Rectal Cancer Trial, showed
recurrence, distant metastasis or death. Secondary
improved local and survival benefit when used short
objectives are restricted mean survival time at 12 months
course radiotherapy (SCRT) (25Gy) (3). While in The
(RMST), toxicity and surgical complications.
Dutch TME trial which used SCRT demonstrate
improvement of local control due to high quality TME
PATIENTS AND METHODS
without survival benefit (4). Expert discussions at the
This is a randomized controlled trial that was
European Organization for Research and Treatment of
conducted at Department of Clinical Oncology & Nuclear
Cancer (EORTC) St. Gallen conference showed that short
medicine, Mansoura University Hospitals. It included
course radiotherapy has less short term toxicity with
patients with non-metastatic stage II-III rectal carcinoma.
similar late toxicity as long course radiotherapy and no
They were randomly assigned to experimental and control
difference in oncological outcomes (5).
groups. The treatment algorithm is presented in
Systematic review did not show survival benefit
CONSORT flow diagram (figure 1).
of adjuvant fluoropyrimidinebased chemotherapy in
adjuvant setting due to poor compliance (6). Shifting of
Randomization and stratification were performed using
chemotherapy to neoadjuvant setting and hence total
computer generated random tables using stratified
neoadjuvant therapy leads to improvement of compliance
blocked randomization in 1:1 ratio. Participants were
and decrease distant relapse rate for intermediate and high
withdrawn from the Outpatient Clinic until fulfillment of
risk patients defined by MRI features in the MERCURY-
needed sample size (n=26 patient in each arm). The
trial (7, 8). Using short course radiotherapy with
patients were followed for about 2 years post treatment (at
neoadjuvant chemotherapy in resectable metastatic rectal
least 6 months after enrollment of the last patient).
1915
Received: 04/09/2022
Accepted: 07/11/2022
c:\work\Jor\vol901_287
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1923-1927
Comparison between the Impact of Pfizer Vaccination and Covid-19
Infection on Human Creatine Kinase Activity and its Isoenzymes
Abdulla A. Al-dulaimi, Yasser A. H. Al-Issa
Department of Chemistry, College of Sciences, University of Baghdad, Iraq.
Corresponding Author email: abdullah.ahmed1205m@sc.uobaghdad.edu.iq
Phone Number: +96407816700812
ABSTRACT
Background: One of the zoonotic illnesses, COVID-19, is spreading from person to person by a variety of methods,
including coughing, sneezing, or speaking, which spreads tiny droplets from the infected person's lips or nose . Corona
virus vaccination generally causes modest side effects that become more noticeable after the second dosage. Creatine
kinase (CK) is a protein that catalyzes the transfer of a phosphate group from creatine phosphate to adenosine
diphosphate.
Aim: This study aimed to compare between the impact of Pfizer vaccination and covid-19 infection on human creatine
kinase activity and its isoenzymes.
Patients and methods: (150) blood samples; one hundred blood specimens were collected from Covid-19 patients who
attended to Al- Fallujah Teaching Hospital and Al-Razzi private hospital and, fifty Blood samples were collected from
volunteers who attended to the vaccination outlets to be vaccinated with the Pfizer vaccine in Al- Fallujah Teaching
Hospital. The study was conducted through the period from September 2021 to December 2021.
Results: In the COVID-19 group of patients, there was a statistically significant difference (P < 0.05) in the mean levels
of basal Total CK, basal CK-MB, and CK-MM in comparison with the vaccinated group. There was no statistically
significant difference in mean of total CK after second dose between the two groups. There was a statistically significant
decrease in mean of CK-mb and CK-mm in vaccinated group in comparison with COVID-19 group.
Conclusion: Covid-19 infection had more impact on CK-MB and CK-MM than the Pfizer vaccination. The activity of
CK-MB and CK-MM after covid-19 infection were higher than activity after Pfizer vaccination and before vaccination
Keyword: mRNA vaccine, CK, CK-MB, CK-MM, Corona vaccination, Coronavirus, COVID-19.
INTRODUCTION
effects,
such
as
vaccine-induced
immune
Coronaviruses are RNA viruses that actually cause
thrombocytopenia, have been reported (14).
illness in humans and animals. In 1962, human corona
The Pfizer-BioNTech corona virus vaccine,
viruses (HCoVs) were identified. as causes of, acute
known as BNT162b2, is mRNA vaccine developed by
upper, respiratory infection, (URI ) (1). The family
BioNTech and Pfizer to prevent coronavirus disease, the
Coronaviridae and order Nidovirales contain the largest
causative agent of which is SARS-CoV-2. (SARS-CoV-
group of viruses collectively known as the "corona virus"
2). Responsive genetic platforms have helped develop
(2, 3). They have a diameter of 125 nm and are polymorphic
vaccines (15).
or spherical in shape (4). It is a significant pathogen in both
Gene-based vaccinations (which also include
humans and vertebrates. They can harm the central
DNA and mRNA vaccines) include the genetic
nervous system, liver, gastrointestinal tract, and
instructions for the vaccine recipient's cells to create an
respiratory system of humans (5, 6) . Corona virus is a
antigen. The surface spike protein, which the virus uses
zoonotic infection. It spreads from person to person in a
to connect and fuse with host cells, is the target antigen
variety of ways, including small droplets from infected
for coronavirus vaccines (16).
people's noses or mouths when they cough, sneeze, or talk.
Pfizer corona virus vaccine (BNT162b2) is given
Real-time PCR allows for early detection (7). Wuhan
intramuscularly as a series of two doses of 30
became the first pandemic epicenter (8, 10).
micrograms of the diluted vaccination solution (0.3 ml
The corona virus family is divided into four classes,
each), as follows: one dosage is given first, and the
all of which have a positive-sense RNA genome with a
second dose is given 21 days later. The trial's time
single strand. The term "coronavirus" refers to the club-
between the two dosages ranged from 19 to 45 days (17).
shaped protein spikes that can be seen on the surface when
There are several hazards associated with
observed through transient electron microscope. The
vaccination, despite its long history in public health and
factor responsible for the corona virus pandemic belongs
preventative medicine. The COVID-19 vaccine
to the beta class (11). The first signs of a covid-19 infection
frequently results in minor side effects, including
are fatigue, fever, difficulty breathing and a dry cough (12).
swelling, soreness and redness at the injection site as
Corona virus is a systemic infection that affects
well as more widespread symptoms of headache,
hemostasis and the hematopoietic system significantly (13).
fatigue, muscle pain, fever and chills. Side effects after
With the long-awaited arrival of COVID-19
the 2nd dose may be more severe than those after the 1st
vaccines, the side effects of vaccination are once again in
dose (18). More serious side effects, such as myocarditis,
the spotlight. While injection site pain, fever, malaise, and
have been observed with the mRNA vaccination Pfizer-
headache are common reactions, other, more serious side
BioNTech and Moderna (18).
1923
Received: 17/9/2022
Accepted: 20/11/2022
c:\work\Jor\vol901_288
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1928-1933
Evaluation of Serum COVID-19 IgG and IgM Antibodies Level in
Pediatric Type 1 Diabetes Mellitus
Ehab Abdel-Hameed Abd El Salam1, Noha Abdelhalim Mohammed2, Safaa Ragab Elwany Saleh1,
Ahmed Hosny Abdel Fatah1
Departments of 1Pediatrics and 2Medical Biochemistry, Faculty of Medicine, Zagazig University, Egypt
*Corresponding author: Safaa Ragab Elwany Saleh, Mobile: (+20) 01101291102, E-Mail: safaaelwany87@gmail.com
ABSTRACT
Background: As a result of the COVID-19 pandemic, healthcare providers are rethinking how they deliver care,
interact with patients, and handle cases of diabetes in children in unprecedented ways. Family behavior may have
increased diabetic ketoacidosis (DKA) due to the COVID-19 pandemic.
Objective: The purpose of the current study was to evaluate serum COVID-19 IgG and IgM antibodies level in
pediatric type 1 diabetes mellitus (T1DM).
Patients and methods: A cross-sectional study was conducted on 36 patients newly diagnosed T1DM children
presented by DKA or known diabetic exposed to DKA. The study was carried out between June and December of
2021/22 at Zagazig University's Paediatric Intensive Care Unit (PICU). COVID-19 IgG and IgM Antibodies were
assessed among all patients.
Results: Antibodies differed significantly as regard DKA severity, Serum ferritin, D-dimer and CRP. Antibodies
differed significantly as regard white blood cells and lymphocytes. The mean HbA1c was 8.99 (SD 0.97) with range
from 7.2 to 11. There were 58.3% were newly diagnosed T1DM and 41.7% were known diabetic.
Conclusion: Evidence linked SARS-CoV-2 infection with T1DM. SARS COVID-19 IgG and IgM were detected in
36% of our studied group while the rest were negative for IgG and IgM.
Keywords: COVID-19, IgG, IgM, Antibody, Diabetes Mellitus.
INTRODUCTION
Health care providers are implementing
The coronavirus family is broad and diverse,
significant changes to health care systems, social
causing conditions as diverse as the common cold and
services, and attitude and management of children
encephalitis. The 2019 COVID epidemic was triggered
living with diabetes in response to the COVID-19
by a novel coronavirus named severe acute respiratory
pandemic, which has triggered profound shifts in the
syndrome coronavirus 2 (SARSCoV2). Fever,
healthcare delivery environment (9).
coughing, shortness of breath, and muscle soreness are
The purpose of the current study was to evaluate
some of the common signs of COVID19 (1). Over the
serum COVID-19 IgG and IgM antibodies level in
course of the study period, a large cohort of Chinese
pediatric type 1 diabetes mellitus (T1DM).
patients with COVID19 demonstrated that illness
PATIENTS AND METHODS
severity can range from mild (81% of the time) to
A cross-sectional study was conducted on 36 patients
severe (14% of the time) to critical (5% of the time)
newly diagnosed diabetic children presented by DKA
(5%). Patients with critical illnesses accounted for all
or known diabetic exposed to DKA. The study was
of the fatalities, and the case fatality rate was 2.3%
carried out between June and December of 2021/22 at
overall (2).
Zagazig University's Paediatric Intensive Care Unit
Furthermore, another comprehensive review and
(PICU).
meta-analysis found pooled rates of 11.9% for ICU
admission, 18.4% for acute respiratory distress
Inclusion Criteria:
syndrome, and 4.3% for mortality (3). The most
· Newly diagnosed diabetic children presented by
common comorbidities associated with COVID-19 are
DKA
diabetes, cardiovascular disease, and hypertension,
· Known diabetic children presented by DKA
according to several reports (4). A statewide study in
· Age from 1 year-18 years old.
England found that people with any form of diabetes
· Both sexes were included.
had a much higher risk of dying while receiving care at
Exclusion Criteria:
a hospital (5).
· Refusal of the parents.
Still, it's encouraging to learn that young people,
· Age more than 18.
both those with and without diabetes, appear to be
Methodology:
doing well in the face of COVID-19 infection (6). No
At the time of study enrollment, all patients had a
occurrences of type 1 or type 2 diabetes were found
comprehensive clinical evaluation (history and
among the 2572 laboratory-confirmed cases in children
physical examination.
and young adults under the age of 18 in the United
States; instead, conditions like chronic lung disease
Full History
and cardiovascular disease were more common (7), or
· Name, Age, Sex, Date of admission.
absolutely no chronic illnesses at all (8).
· Chronology of symptoms.
· Regular Insulin doses.
8291
Received: 28/08/2022
Accepted: 01/11/2022
c:\work\Jor\vol901_289
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1934-1939
Vitamin D Status in Inflammatory Bowel disease
Muhammad Abbas Said El-Masry, Nabila Faiek Amin,
Eman Nasr El Din Mohamed, Mohammed Ragab Osman*
Department of Internal Medicine of Assiut University Hospitals,
Faculty of Medicine, Assiut University, Assiut, Egypt
*Corresponding author: Mohammed Ragab Osman, Mobile: (+20) 01061192576;
Email: mohamed.abdelalp3@med.aun.edu.eg
ABSTRACT
Background: There were many studies reported deficient vitamin D in patients with inflammatory bowel disease.
Objective: Our study aimed to examine the relationship between vitamin D levels and clinical disease activity in patients
with inflammatory bowel disease (IBD).
Patients and Methods: A prospective study was conducted at IBD Outpatient Clinic of Al-Rajhi University Hospital
of Assiut University Hospitals in period from May 2018 to May 2019. The study enrolled 54 patients with known IBD.
In addition to reviewing the demographic and clinical data, serum vitamin D was measured in all patients.
Results: Mean age of enrolled patients was 34.24 ± 11.71 years with range between (14 - 67) years. Females were more
than half of participants (51%). Mean serum vitamin D level was 43.45 ± 33.91 ng/ml. 20 IBD patients (37%) were
deficient in vitamin D, 4 (7.4%) patients had insufficient level and 30 (55.6%) patients had normal level. Patients with
deficient vitamin D had significantly higher C-reactive protein in comparison with those with insufficient level and
those with normal level. Patients on conventional therapy or biological therapy had insignificant differences as regard
level of vitamin D and its status (P> 0.05). There is a non-significant differences as regard level of vitamin D and disease
activity, but the level of vitamin D were lower in active patient than non-active one.
Conclusion: Vitamin D insufficiency was uncommon among IBD patients, especially in those with Crohn's disease,
and was linked to a stronger inflammatory response as well as more active illness.
Keywords: IBD, C-reactive protein, vitamin D.
INTRODUCTION
D status among patients with IBD including UC or
The incidence of inflammatory bowel disease
Crohn's disease (CD) patients. It included 54 patients
(IBD) is on the rise. 1.5 million Americans, 3 million
presented and diagnosed with IBD.
individuals in Europe, and the Asia-Pacific region are
all impacted. The primary pathogenic mechanism for
Selection criteria: Any patient with IBD was eligible
both illnesses is a dysregulated host immune response
for the study. Cancer patients or those with therapy that
to commensal gut flora in genetically susceptible people
affect the blood level of vitamin D weren't eligible to be
(1, 2). In addition to encouraging the development of Th2
recruited.
immune responses and the shift to antimicrobial peptide
synthesis, vitamin D also controls autophagy and the
Methods:
epithelial barrier's integrity.
Thorough history taking and full evaluation
In IBD patients, vitamin D insufficiency has
including systemic examination for presence of signs of
been estimated to be as high as 60% (3). Low blood
anemia, systemic toxicity or weight loss, abdominal
ionised calcium levels as a result of insufficient vitamin
examination for any abdominal tenderness, distension
D
leads
to
secondary
hyperparathyroidism,
and any abnormal sign. Baseline laboratory data was
osteoclastogenesis, abnormally rapid bone resorption,
done for all patients.
osteopenia, and osteoporosis. Metabolic bone disease
According to The entire Mayo Clinic Score
occurs significantly more frequently in IBD patients (4).
(MCS), the four criteria of stool frequency, rectal
In this study, we looked at the association
bleeding, endoscopic examination, and physician's
between vitamin D levels and the severity of the disease
overall assessment are used to measure the stage of the
in people with IBD (Crohn's disease or ulcerative
UC (5, 6).
colitis).
To evaluate the severity of the condition, the
Crohn's Disease Activity Index, or CDAI, is widely
PATIENTS AND METHOD
utilised (7). ELISA was used to do a quantitative
This prospective study was conducted at IBD
analysis of blood total 25-OH vitamin D levels (Vitamin
Outpatient Clinic and Inpatient Department of Internal
D2 and Vitamin D3) and to subclassify the results into
Medicine of Al-Rajhi University Hospital of Assiut
deficient, inadequate, and normal groups (8, 9).
University Hospitals. It was performed in period
between May 2018 and May 2019 to assess the vitamin
1934
Received: 16/08/2022
Accepted: 19/10/2022
c:\work\Jor\vol901_290
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1940-1949
Gene Expression of Effect of Combination Cassia Fistula Extract and
Cisplatin on Inhibition of Human Colon Cancer SW480 Cell Line
Rana Talib Al-Muswie1, Sabah Hussain Enayah2 and Rana A. Ghaleb3
1 Department of Basic Science, College of Dentistry, University of Thi-Qar, Iraq
2 Department of Biology, Collage of Science, University of Thi-Qar, Iraq
3 Department of Anatomy and Histology, Collage of Medicine, University of Babylon, Iraq
Corresponding Author: Rana Talib Al-Muswie, Mobile: +96 47811684467, E-mail: rana-almusawie@utq.edu.iq
ABSTRACT
Background: There is a significant rise in the prevalence of colon cancer worldwide. A variety of therapeutic approaches
have been tried, but none have been successful due to the aggressive spread of the tumor. Natural products derived from
plants have traditionally been used in the medical field. Objective: The aim of the current study was to investigate the
effect of Cassia Fistula cytotoxicity on a colon cancer cell line and the synergy between Cassia fistulae extract and cisplatin
significantly to induce apoptosis through upregulation of p53 and Msh2.
Material and methods: Real-Time polymerase chain reaction indicated that gene expression proteins were likely involved
in the pathway when the cytotoxicity potential of the plant extract on colon cancer cells was assessed using the (MTT) test.
The database search techniques used with colon cancer cells identified the p53 gene and Msh2 gene's apoptotic function.
Results: Aqueous extract of the plant was most toxic to cancer cells. Further, p53 gene expression and Msh2 were observed
to be high in cells treated with the plant extracts of C. fistula and IC50of cisplatin (CDDP) +Cassia Fistula suggesting an
involvement of mitochondrial proteins in the colon cancer cell apoptosis.
Conclusion: The results of the present study indicate that Cassia fistula extracts significantly regulate p53 and Msh2
expression to induce apoptosis. According to its cytotoxic and apoptotic action, Cassia fistula can be considered as a new
discovery for the treatment of colon cancer.
Keywords: Colon cancer, Cell line SW480, Cassia Fistula, P53, Msh2, Experimental study, University of Thi-Qar.
INTRODUCTION
The Centers for Disease Control and Prevention
The presence of an MSI-H tumorigenic phenotype
(CDC) report that colorectal cancer (CRC) is one of the
and loss of MLHl and MSH2 protein expression are
leading cancer-related deaths worldwide (1). There is a
strongly compatible with each other (5). Apoptosis is a
possibility that colorectal cancer may be sporadic, but
critical cell death mechanism that can effectively inhibit
there are a number of internal factors (such as age, obesity,
the development and growth of tumors; As a result, it is
and inflammatory bowel disease) and external factors
often dysregulated in a variety of malignancies (6).
(such as smoking, inadequate fiber intake, exces/sive
Epigenetic and epigenetic modifications in apoptotic
drinking, and eating a high-fat diet) that are associated
pathways enable the increased proliferation brought on by
with an increased risk of colorectal cancer (CC); colon and
genetic abnormalities, which ultimately permits
rectum (2).
uncontrollable tumor growth. The equilibrium between
It is believed that CC develops gradually due to
proliferation and apoptosis strictly regulates colonic
various genetic and epigenetic changes accumulating over
homeostasis. The growth and advancement of CRC
time. Chromosomal instability (CIN) linked to high-
depend on upsetting this balance. Additionally, CRC
frequency aneuploidies and allele imbalances, is the
tumors usually exhibit an increased apoptotic threshold,
primary cause of cancers (approximately 85% of them).
which adds to treatment resistance (7).
The remaining 15% of individuals have faulty DNA
p53 mutations often occur in more than 50% of all
mismatch repair (dMMR), frequently detected by
tumors, making it the most frequently altered gene in
microsatellite instability survey (MSI) or by testing for
human tumors. Tumor formation and progression
protein loss caused by DNA mismatch repair genesis
typically involve disruption of p53 function (8).
detected by microsatellite instability survey (MSI) or by
In 50% of human cancers, the p53 gene is altered.
testing for protein loss caused by DNA mismatch repair
When some types of DNA damage occur, it is likely that
genes, frequently MLHI, MSH2, MSH6, and PMS2.
their main natural function is to direct cell cycle arrest in
Sporadic CCs with dMMR have a better prognosis than
the G1 or G2 phase of the cell cycle and, when the damage
non-dMMR CCs because they exhibit certain clinical and
is very high, to induce apoptosis (9). Recent research has
pathological characteristics, such as proximal colon
confirmed the anti-cancer properties of substances of
predominance,
poor
mucosal
histology
and/or
natural origin (10). Because of the expected chemotherapy
differentiation, infiltration of intraperitoneal and
benefits of natural products, their use has expanded. As
peritoneal lymphocytes, diploid DNA content (3,4).
sources of novel trace elements and anti-inflammatory and
1940
Received: 25/08/2022
Accepted: 28/10/2022
c:\work\Jor\vol901_291
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1950-1952
The Role of the Trans-theoretical Model for Change in Enhancing
Glucose level Controlling Behaviour for Clients with Diabetes Mellitus
Ali Mohammed Abbood1*, Arkan Bahlol Naji2
1 Community Health Nursing Department, College of Nursing, University of Baghdad, Baghdad, Iraq
2 Chairman of Community Health Nursing Department, College of Nursing, University of Baghdad, Baghdad, Iraq.
*Corresponding Author: Ali Mohammed Abbood, Phone: 0096 47709828439, E-mail: ali_iq193@yahoo.com
ABSTRACT
Background: Diabetes mellitus (DM) is a chronic progressive metabolic disorder characterized by hyperglycemia
mainly due to absolute (Type 1 DM) or relative (Type 2 DM) deficiency of insulin hormone. Diabetes Mellitus is a
complex chronic disease, requiring continuous medical care with multi factorial risk reduction strategies beyond
glycemic control.
Objective: The present study aims to determine the role of the Trans-theoretical Model in enhancing glucose level -
controlling behavior for clients with DM.
Patients and methods: Simple random sample of 60 diabetic clients who are attending Primary Healthcare Centers at
Al-Karkh District of Baghdad were included in the present study. The participants were divided into experimental group
(N=30) and control group (N=30), matched for age and gender.
Results: The mean of age of participants was 55.7-year-old, and the majority was males. First degree relatives with
Type 2 DM were within positive bio-social aspect. Laboratory screening had a direct impact on the incidence of Type
2 DM. There was highly significant comparative difference between the pretest and posttest I of the experimental group
relative to glucose level controlling behavior. Also, there is highly significant comparative difference between the
posttest I and posttest II of the experimental group relative to glucose level controlling behavior. In addition, there was
highly significant difference between pretest, posttest I and posttest II of the experimental group relative to glucose level
controlling behavior.
Conclusion: Trans-theoretical Model for Change is effective in enhancing glucose level controlling behavior for clients
with DM.
Keywords: Trans-theoretical Model for Change, Glucose Level, Controlling Behavior, Diabetes Mellitus, University
of Baghdad.
INTRODUCTION
In order to effectively manage diabetes, both the
People who have diabetes who practice the seven
patient and the health care professional need to be
fundamental aspects of self-care are more likely to have
motivated. It might be difficult to get patients to adhere
positive outcomes. These include having a nutritious
to the recommendations for diabetes control. It is
diet, being physically active, keeping a close eye on
possible that the trans-theoretical paradigm will prove
blood sugar levels, taking prescribed medications as
useful in the process of successfully managing diabetes.
directed, having strong problem-solving skills, having
It is possible that health care clinicians who are
healthy coping skills, and engaging in risk-reducing
knowledgeable about the process of behavior change,
behaviors (1).
and stage-specific interventions will be in a better
The ailment known as diabetes mellitus is one that
position to assist good and long-lasting changes in
can ultimately be fatal. There is a worrying indication
behavior (5).
and a major threat to global health posed by the rapid
rise in the prevalence of diabetes mellitus around the
METHODOLOGY
world, which will continue to be the case unless
Experimental design, using experimental-control
effective interventions are developed through increased
groups approach, is carried throughout the present study
community awareness and knowledge of the many
to for the period of November 25th 2021 to November
facets of DM (2).
20th 2023.
It has been observed that each of these seven habits
Simple random sample of 60 diabetic clients who are
has a favorable correlation with good glucose control, a
attending Primary Healthcare Centers at Al-Karkh
reduction in complications, and an improvement in
District of Baghdad were included in the present study.
quality of life (3).
The participants were divided into experimental group
The research tools consisted of two primary
(N=30) and control group (N=30), matched for age and
sections:
the
first
portion
connected
to
gender.
sociodemographic characteristics, and the second part
linked to diabetic foot self-efficacy. Both parts were
administered to participants (4).
1950
Received: 10/10/2022
Accepted: 24/12/2022
c:\work\Jor\vol901_292
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1953-1959
Surgical Outcome and Prognostic factors for Posterior Decompression of
Calcified Herniated Thoracic Disc
Ahmed M. Deabes*, Mohammed Ahmed Mourad, and Ramy Toema
Department of Neurosurgery, Benha University, Faculty of Medicine
Corresponding author: Ahmed M. Deabes, MD, Mobile: +201025001475, E-mail: ahmed.elsayed@fmed.bu.edu.eg
ABSTRACT
Background: Thoracic disc herniation accounts for only 0.15 to 1.8% of all spinal herniated discs. Usually present
between the third and sixth decades with a female predilection. Objectives: To describe the surgical outcome and
prognostic factors of post-decompression without fixation in CTDs. Patient and methods: from October 2016 to July
2019, a series of 9 patients with a CTD with demographic data, presentation, imaging findings, operative details, degree
of
spinal
stenosis,
duration
of
symptoms
`and
outcomes
using
ASIA
scale
or
mFAC.
Results: All patients presented with at least one sign of myelopathy. Simple laminectomy was performed, and follow-
up was in 1st week and 6th month. In 1st week, according to ASIA grade improved in 4 (44, 4%), stationary in 3 (33.3%),
deteriorated in 2 (22.2%) patients. According to ambulation, non-ambulatory in 3 (33.3%) and independent in 5 (66.6%)
patients. In 6th month, according to ASIA grade improved in 5 (62.5%), stationary in 2 (25%), deteriorated in1 (12.5%)
patient. According to ambulation, non-ambulatory in 1 (12.5%), independent in 3 (37.5%) and walker in 4 (50%)
patients, one patient is missed in the 6th-month follow-up. Prognostic factors affected the surgical outcome, including
the degree of spinal canal stenosis and duration of symptoms.
Conclusions: Posterior decompression without instrumentation allowed us to decompress the compromised spinal cord.
Results overall are good with the majority of patients improving at least 1 ASIA scale or mFAC. Better outcomes were
affected with less degree of spinal stenosis and less duration of symptoms
Keywords: Giant calcified thoracic disc herniation, Myelopathy, Simple posterior decompression.
INTRODUCTION
contribute significantly to the degree of surgical
Only around 0.151.8% of all intervertebral disc
difficulties. Since these people often arrive with
diseases are treated surgically, and of those, only about
myelopathy after their spinal cord has already been
1% are herniated thoracic discs (HTDs) that cause
damaged.
symptoms (1). It has been estimated that between 7 and
15% of cases are subclinical (2). The primary site is
PATIENTS AND METHODS
between the thoracic T8 and the lumbar spine's L1 (2, 3).
In this retrospective analysis, we analyzed data
In patients above the age of 17, a calcified disc
from all patients who had excision of a calcified thoracic
herniation occurs in over 40% of instances. If the
disc at the Neurosurgery Department, Benha University
herniated disc takes up more than 40% of the spinal
Hospitals between October 2016 and July 2019. Table
canal, it is considered to be a large herniation (4, 5). Acute
(1) showed the patient's clinical presentation, including
traumatic non-calcified disc prolapse is the most
their pre- and post-operative American Spinal Injury
prevalent kind of thoracic disc herniation in younger
Association Impairment Scale (ASIA) score, and Table
patients, but calcification of the herniated disc is
(2) showed their ambulation status according to the
common in older patients with a gradual degenerative
modified Functional Ambulatory Category (mFAC)
process (6). Calcified thoracic discs (CTDs) provide
score, as well as the surgical procedure, recovery time,
difficulties for neurosurgeons due to their size,
and any complications that may have arisen. Clinical
consistency, and degree of cord compression, even
outcomes after surgery were documented, collected, and
though spontaneous regression has been reported in
statistically
assessed,
including
postoperative
certain cases (4, 5). The literature documents a variety of
ambulation and ASIA at one week and six months, as
methods for dealing with thoracic disc herniation. There
well as death.
is no one best method since every strategy has pros and
Inclusion criteria: Patients were considered for
downsides. Trans-pedicular, trans-facet pedicle-
inclusion if they met all three of the following criteria:
sparing, costo-transversectomy, trans-thoracic trans-
(a) clinical and/or radiographic evidence of myelopathy,
pleural, and thoracoscopic techniques are described (7, 8).
(b) a calcified herniation of the thoracic spine and (c)
In terms of surgical methods, laminectomy was
therapy with a simple laminectomy. Exclusion criteria:
advocated by Brauge et al. (9) because it may stabilize
(a) Patients with a non-calcified thoracic disc and (b)
the patient's neurologic condition in very uncommon
patients who had procedures other than a simple
instances of acute myelopathy caused by TDH. Hernia
laminectomy. Patient's demographic information,
excision with an anterior technique is the last resort.
medical history, and how long they suffered from their
The purpose of this study was to analyze the
symptoms before surgery were all acquired from their
effectiveness of simple posterior decompression for our
medical records, and the extent to which their canals
patients with herniated thoracic disc that had calcified.
were encroached upon was determined using pre-
The size and calcification of the herniated disc
operative magnetic resonance imaging (MRI).
1953
Received: 05/08/2022
Accepted: 07/10/2022
c:\work\Jor\vol901_293
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1960-1967
Comparing the efficacy of Micro-needling Alone versus Micro-needling with
Topical 5-Fluorouracil in Treating Stable Non-Segmental Vitiligo
Naziha Khafagy1, Samah Hassen1, Fedaa Ezat1, Ahmed Elhawatky2
1Dermatology, Venereology, Andrology, Faculty of Medicine; Ain shams University, Cairo, Egypt
2Dermatology, Venereology and Andrology, National Research Center, Cairo, Egypt
*Corresponding author: Ahmed F. Elhawatky, Mobile: (+20) 01065226628, E-Mail: dramfat@yahoo.com
ABSTRACT
Background: Vitiligo is a commonly acquired, idiopathic, heritable white macule which increases in diameter with
time due to melanocytes loss. Several treatment modalities, ranging from medical to surgical interference, are available.
Many studies stated that inducing injury combined with topical 5Fluoro-uracil (5-FU) induces skin re-pigmentation in
vitiligo lesions. Microneedling is a reasonably, inexpensive, easy and fast evaluating tool present in outpatient clinics
as a trans-dermal drug delivery device for high molecular-weight drugs to enhance their absorption and effect.
Objectives: Evaluation of the efficacy of micro-needling plus topical 5-FU in treating stable non-segmental vitiligo and
comparing its results with micro-needling alone. Patients and Methods: Fifty patients complaining of stable, non
segmental vitiligo were recruited for our study, where we picked two patches; one patch was treated with micro-needling
without adding any medicine, while we treated the other with micro-needling with 5FU added. The sessions were every
2 weeks, and each patient received 6 sessions in 3 months.
Results: On the micro-needling alone side, none (0%) of studied participants showed repigmentation, while in micro-
needling with 5FU side, 38 (76%) of patients showed repigmentation response, out of which 23 cases (46.0%) had mild
repigmentation (<25%) whereas the remaining 15 cases (30.0%) had moderate repigmentation (25-50%).
Conclusion: Micro-needling with 5-FU is considered a safe, easy, and tolerable procedure for vitiligo treatment.
Significance: Micro-needling and 5 Fluorouracil are well known treatments, used frequently in aesthetic and skin
malignancy fields; can be helpful also in pigmentary problems by delivering the drug and creating an inflammatory
environment also helping the transportation of melanocytes to the vitiliginous area.
Keywords: Vitiligo, Micro-needling, and 5 Fluorouracil.
INTRODUCTION
happened during its systemic usage; in treating various
Vitiligo is one of the most common acquired skin
malignancies. Usually, these hyper-pigmented patches
diseases that happens to 1-2 % of the people of the
appear on the customarily pigmented extremities (upper
world [1]. Pathogenesis of vitiligo is unknown, but the
and lower limbs) and the tongue. These hyper-
auto-immune theory is supported by several factors:
pigmentations may be explained as post-inflammatory
Many auto-immune disorders may present incoherence
hyperpigmentation in friction-related areas [7].
with it, and antibodies against melano-cytes were found
Aim of the work was to evaluate the efficacy of
in 10 % of cases with vitiligo. Also, inflammatory
micro-needling plus topical 5-FU. in treating stable
infiltrates were observed in the margins of the active
non-segmental vitiligo and comparing its results with
lesion. In the bio-chemical hypothesis, the destruction
micro-needling alone.
of melano-cytes is contributed to changes in oxidative
stress. The increase of hydrogen peroxide molecules
PATIENTS AND METHODS
with higher superoxide dismutase activity in vitiligo
Fifty cases with stable, Non segmental vitiligo
cases, re-inforces this hypothesis [2].
participated in the research, and Wood's lamp assessed
Another theory is the melano-cytorrhagy
them.
hypothesis, where the defect in melanocyte adhesions
Ethical consent:
leads to trans-epidermal detachment and loss, leading
The study followed the ethics approval of the
their exposure to auto-antigens and immune system
Research Ethical Committee of the Faculty of
activation with subsequent melanocytic damage [3].
Medicine, Ain Shams University (FMASU MS
Re-pigmentation patterns for vitiliginous patches
20/2019). Also, an acquired approval consent from
are: a) Peri-follicular; when the re-pigmentation is
every patient interested in being included in the
mainly follicular; b) Marginal; re-pigmentation is from
study after clarification of strategy. The Declaration
the patches margins, and c) diffuse; re-pigmentation
of Helsinki for human beings, which is the
occurs diffusely across the whole patch [4]. The re-
international medical association's code of ethics,
pigmentation response of patients with vitiligo to
was followed during the conduct of this study.
NUVB phototherapy happens by activating the dormant
melano-cytes in the epidermis and hair follicles [5]. 5-
Inclusion criteria:
fluorouracil (5-FU) is a pyrimidine analog that exerts
1. Patients with non-segmental vitiligo.
potent anti-mitotic activity against skin tumors such as
2. Lesions were steady (no appearance of new
solar keratosis and some basal and squamous cell skin
lesions, change in the size of existing patches,
tumors [6]. Clinically, localized hyper-pigmentations
or Koebner phenomena for one year).
1960
Received: 12/09/2022
Accepted: 14/11/2022
c:\work\Jor\vol901_294
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1968-1975
Assessment of Thyroid Dysfunction in Patients with Type 2
Diabetes Mellitus: A Cross-Sectional Prevalence Study
Mona Sayed Ahmed El-Tantawy*, Mohamed Yakout Abdelaziz, Mohamed Mosad Abo Elnaga,
Hanan Abdelhay Elsherbiny, Ahmed Abd El- Hakim Arafat
Department of Internal Medicine (Endocrinology and Diabetes), Faculty of Medicine, Mansoura University, Egypt
*Corresponding author: Mona Sayed Ahmed El-tantawy, Mobile: (+20)1090775505, Email: monatantawy93@yahoo.com
ABSTRACT
Background: Hyperglycemia is the hallmark of the metabolic abnormalities in diabetes mellitus (DM) because of
dysfunctional pancreatic beta cells. After diabetes, thyroid dysfunction (TD) is the second most common endocrine
disorder. DM and thyroid dysfunction can interact with each other in many ways. Several authors studied the association
between T2DM and thyroid dysfunction, hence it is of great importance to evaluate the prevalence of thyroid dysfunction
among T2DM patients to help better control and reduce complications of diabetes.
Objective: The current study was done to detect the prevalence of thyroid dysfunction among patients with T2DM
recently diagnosed within 5 years duration or less attending the Endocrinology and Diabetes Unit at Mansoura
Specialized Medical Hospital.
Patients and Methods: This was a Cross-Sectional study conducted on a total of 106 patients with T2DM recently
diagnosed within 5 years duration or less. The study included male and female adult Egyptian patients aged 30-60 years
within the period from July 2021 to March 2022, their diagnosis of DM was based on the American Diabetes Association
criteria for T2DM.
Results: Out of 106 recently diagnosed T2DM patients, the prevalence of thyroid dysfunction was 6.6%.
Hypothyroidism (4.7%) was more common in the study subjects in comparison with hyperthyroidism (1.9%).
Subclinical hypothyroidism was the commonest type of thyroid dysfunction among the studied subjects. Thyroid
dysfunction was significantly more prevalent among female patients (p = 0.01). There was no significant association
between thyroid dysfunction and HbA1c, age, BMI, duration, or complications of diabetes.
Conclusion: TD frequently develops among recently diagnosed patients with T2DM, with hypothyroidism more
frequent than hyperthyroidism and subclinical hypothyroidism being the commonest type. The female gender could be
considered a predictor and risk factor for thyroid dysfunction.
Keywords: Type 2 diabetes, Thyroid dysfunction, Hypothyroidism, Hyperthyroidism, Poorly controlled diabetes, TSH.
INTRODUCTION
hyperinsulinemia/IR, in thyroid cell proliferation,
DM and TD are the most common
which manifested as increased thyroid size and nodules
endocrinopathies, which usually co-exist and mutually
has been also reported (6). Detecting TD in T2DM cases
affect each other. Several studies revealed an
will guide the clinician to provide the proper treatment
association between DM and TD. TD, which is often
for metabolic abnormalities as thyroid disorders like
defined as an abnormal thyroid test result, is more
hypothyroidism will delicately affect the achievement
common in T2DM individuals compared to non-
of the glycaemic target and other comorbidities (7).
diabetics and can adversely affect metabolic control (1).
The relationship between TD and T2DM has also been
AIM OF THE STUDY
recommended, however the potential causative
In our current study, we aimed to explore the
mechanisms are intricate and have not been fully
prevalence and possible impact of thyroid dysfunction
illustrated (2). Confirmed correlations including
among recently diagnosed T2DM patients within 5
abnormal biochemical pathways, abnormal genetic
years duration or less attending the Endocrinology and
expressions, and hormonal imbalances, can explain
Diabetes Unit at Mansoura Specialized Medical
their pathophysiological correlation (3).
Hospital, Mansoura University, Egypt.
Hypothyroidism, as the main form of TD in
diabetics, could result in a reduction in insulin
PATIENTS AND METHODS
synthesis.
Hyperthyroidism
enhances
the
Study design
responsiveness of beta-cells to catecholamines or
This was a cross-sectional study included 106
glucose because of increased their mass and increased
T2DM patients diagnosed within 5 years duration or
insulin
clearance
(4). Moreover,
hypo-
and
less within the period between July 2021 and March
hyperthyroidism can affect insulin metabolism resulting
2022. Both males and females adult patients aged 30-60
in insulin resistance (IR) (5).
years were included and recruited from patients
On the other hand, DM can impair TD by
attending the Endocrinology and Diabetes Unit at
altering
thyroid
stimulating
hormone
(TSH)
Mansoura Specialized Medical Hospital, Mansoura
concentrations at the hypothalamic level and by
University, Egypt.
inhibiting thyroxin (T4) conversion to tri-iodothyronine
The diagnosis of DM was based on the American
(T3) in peripheral tissues (1). The consequence of
Diabetes Association criteria for T2DM (8).
1968
Received: 16/08/2022
Accepted: 19/10/2022
c:\work\Jor\vol901_295
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1976-1982
Evaluation of Glycogen Phosphorylase Activity in A Sample of
Iraqi Patients with Myocardial Infarction
Mena Safaa aldeen jafar*1, Mohammed I. Hamzah2, Muayed B. Hamed 3
1,3Department of Chemistry and Biochemistry, College of Medicine, Al-Nahrain University, Baghdad, Iraq.
2College of Medicine/Al-Nahrain University/Iraq
*Corresponding author: Mena Safaa Aldeen Jafar, email:mena.safaa.1992@gmail.com, Tel.: 009647822001017
ABSTRACT
Background: Myocardial ischemia, the most common kind of cardiovascular disease, and the leading cause of mortality
worldwide. It is caused mostly by cardiac muscle necrosis caused by an abrupt coronary artery occlusion. Smoking and
obesity are two major risk factors for myocardial infarction. Chest pain and dyspnea are common symptoms caused by a
reduction in blood flow to the myocardium.
Objective: glycogen (GP) modulates glucose metabolism by mobilizing intracellular glycogen. Heart and brain tissues
express it, which generates energy during muscle contraction. Myocardial ischemia activates Glycogen phosphorylase BB,
which promotes glycogen breakdown.
Subjects and Methods: A case-control study was used in this investigation. These investigations comprise 160 Iraqi
volunteers ranging in age from 25 to 75 years (50 with ST- elevation, 50 without ST- elevation, and 60 in the normal healthy
control group).
Results: Glycogen phosphorylase BB (GPBB) Activity by spectrophotometer technique. There were significant differences
in GPBB activity among the groups the mean of GPBB for Control (3.25± 0.97) was significantly smaller than for both
STEMI (12.54± 2.85), p < .001 and non ST-elevation myocardial infarction (NSTEMI) (6.51± 0.73), p < .001. The mean
of GPBB for ST-elevation myocardial infarction (STEMI) (12.54± 2.88) was significantly larger than for NSTEMI (6.51±
0.73), p < .001. A significant negative correlation was observed between GPBB and high sensitive troponin I (hs-troponin
I) and a negative correlation was observed between GPBB and TC in the NSTEMI group.
Conclusion: higher serum glycogen phosphorylase levels with higher troponin I levels were both observed in myocardial
infarction patients and there was a significant correlation between them.
Keywords: glycogen phosphorylase BB, myocardial infarction.
INTRODUCTION
infarction (AMI) (2). Patients who have acute myocardial
When the heart is in a state of unstable ischemia, a
infarction may present with symptoms such as typical
condition known as myocardial necrosis or acute
ischemic-type chest pain, dyspnea, nausea, unexplained
myocardial infarction can take place. In clinical settings,
weakness, or a combination of these symptoms. If AMI is
diagnosis and evaluation might involve a number of
suspected, the patient should be referred immediately to
different approaches, such as a clinical exam,
an emergency room, where an electrocardiogram (ECG)
electrocardiogram (ECG), biochemical tests, invasive and
will be obtained and evaluated for ischemic changes
noninvasive imaging, and pathological evaluation. ST-
within ten minutes of the patient's arrival, and blood will
segment elevation on the electrocardiogram is used to
be sent for cardiac troponin testing and another cardiac
classify acute myocardial infarction into six subtypes,
marker (1).
including infarction caused by coronary atherothrombosis
The epidemiological parameters of acute
(type 1), infarction caused by a supply-demand mismatch
myocardial infarction have undergone significant change
other than acute atherothrombosis (type 2), infarction
over the past three to four decades. Since 1987, the
leading to sudden death without the opportunity for
number of persons who have had to be hospitalized to
biomarker or ECG confirmation (type 3), and infarction
hospitals in the United States because of acute MI has
related to percutaneous coronary artery bypass surgery
decreased by between four and five percent each year. The
(type 5) (1).
American Heart Association estimates that around
Historically, patients diagnosed with coronary
550,000 new cases of AMI and 200,000 recurrent
artery disease (CAD) have been "risk categorized" based
episodes of AMI are diagnosed each year (3).
on factors including blood pressure, cholesterol levels,
There are several different things that can put
and smoking behaviors. A comprehensive analysis of
someone at risk for AMI. While some cannot be changed
these factors is required in order to make an accurate
or treated in any way, some can be (cannot be changed).
forecast regarding the incidence of cardiovascular events
AMI is more likely to occur in those who have sedentary
in the future. A cardiovascular event that is known as an
lifestyles and who have a number of cardiac risk factors.
acute myocardial infarction is the cause of sudden cardiac
This highlights the importance of regular physical
death in the vast majority of cases Acute myocardial
activity. It has been estimated that regular exercise can cut
1976
Received: 20/08/2022
Accepted: 23/10/2022
c:\work\Jor\vol901_296
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1983-1987
Renal Resistive Index as a Promising Tool in Early Identification of
Diabetic Nephropathy
Marwa K. Khairallah1, Mohamed Abbas Sobh1, Ehab Mansour2,
Radwa Ibrahim*1, Mohamed Hassan Mostafa1
Departments of 1Internal Medicine and 2Radiodiagnosis, Assiut University,
Faculty of Medicine, Assiut University, Assiut, Egypt
*Corresponding author: Radwa Ibrahim, Mobile: (+20) 01003797448; Email: radwaawad@aun.edu.eg
ABSTRACT
Background: Diabetes mellitus (DM) is a common chronic illness that affects many persons all over the world.
Diabetic nephropathy (DN) is a common serious problem that occurs in a considerable percentage of diabetic patients.
Renal resistive index (RI) reflects hemodynamics of intrarenal arteries.
Objective: Here, we aimed to determine efficacy of RI in prediction of DN.
Patients and methods: A cross-sectional study was conducted over one year duration in Nephrology Unit of Internal
Medicine Department, Assiut University Hospital. A total of 91 patients with DM were recruited. All patients were
evaluated based on history taking, clinical evaluation, laboratory data and renal RI and subdivided into DN group and
non-DN group.
Results: Out of those patients; 40 (43.9%) patients had DN (DN group) and 51 (56.1%) patients hadn't DN (No-DN
group). Patients with DN had significantly longer duration of DM (10.45 ± 1.11 vs. 4.09 ± 0.56 (years); p< 0.001) and
higher RI (0.89 ± 0.11 vs. 0.49 ± 0.18; p< 0.001). Duration of DM (> 5 years), impaired glycemic control and resistive
index were predictors for DN among patients with DM. At cutoff point > 0.73, resistive index had 82.5% overall
accuracy with area under curve was 0.837 for prediction of diabetic nephropathy.
Conclusion: Renal RI reflects hemodynamics of intrarenal arteries in patients with DM and could be used as a
promising tool in early identification of DN. Multiple future studies at multiple centers with long term duration of
assessment are warranted.
Keywords: Resistive index, Diabetic nephropathy, Diabetes mellitus, Accuracy.
INTRODUCTION
RI in early detection of those patients with DN and so,
Diabetes mellitus (DM) is an important global
this work aimed to evaluate such point.
public health concern, and type 2 diabetes mellitus
PATIENTS AND METHODS
(T2DM) in combination with renal dysfunction is
Study setting and design
linked to higher rates of cardiovascular and all-cause
A cross sectional study was conducted in the
death. One of the most common and serious
period between January 2021 to December 2021 in the
consequences of diabetes today is diabetic
Nephrology Unit of Internal Medicine department,
nephropathy (DN), which also continues to be the
Assiut University Hospital. A total of 91 diabetic
main cause of end-stage kidney disease (ESKD)
patients were enrolled in the study. Out of those
globally (1).
patients; 40 (43.9%) patients had DN (DN group) and
51 (56.1%) patients hadn't DN (No-DN group).
Patients without DN often have a better prognosis
and various therapeutic approaches. Because the
Inclusion criteria: All patients with DM were eligible
pathological alterations of DN are thought to be
for the study with age above 18 years old.
difficult to reverse, it is considered that the patients'
kidney results with DN are considerably poorer than
Exclusion criteria: Patients with known CKD,
those of their counterparts with biopsy-proven non-DN
peripheral artery disease and/or severe comorbidities.
(2).
All patients were subjected to:
Renal Atrial Resistance Index (RI), which has
1- Though history taking and clinical evaluation (age,
been widely used to quantify Renal Blood Flow as a
sex, duration of DM and type of therapy).
Semi-Quantitative
Parameter,
is
easily
and
2- Complete blood picture, liver function panel,
inexpensively
measured
using
Doppler
serum creatinine, blood urea nitrogen, urine
ultrasonography. Previous studies found a link
analysis, and lipid profile were among the
between RI and the onset of a severe form of chronic
laboratory tests ordered.
kidney disease (CKD) with interstitial fibrosis (3).
3- Using the equation developed by the Chronic
In our locality we have a high prevalence of
Kidney Disease Epidemiology Collaboration
patients with DM with subsequent high percentage of
(CKD-EPI), the estimated glomerular filtration
those patients who are at risk to have CKD secondary
rate (eGFR) was calculated (4).
to DN. But, there were insufficient data about role of
1983
Received: 16/08/2022
Accepted: 19/10/2022
c:\work\Jor\vol901_297
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1988-1995
Value of Auditory Perception of Alphabet Letters Test
(Arabic Standardized Version) in Evaluation of Arabic Speaking Bimodal Children
Soha Abdelraouf Mekki 1, Elham Magdy Hassan2,
Shymaa abd elhameed Mohamed Zahran3, Nadia Mohamed Elnabtity1.
1 Audio-Vestibular Medical Unit, 2 Phoniatric Medical Unit, ENT Department,
Faculty of Medicine, Zagazig University, Sharkia, Egypt;
3 Audio-Vestibular Medical Unit, ENT department, Al Ahrar Teaching Hospital, Zagazig, Sharkia, Egypt.
Corresponding author: Shymaa Abd Elhameed Mohamed Zahran,
Email: Shymaa93zahran@gmail.com, Mobile: 01063966197
ABSTRACT
Background: For unilateral cochlear implant (CI) candidates, benefit can be enriched by adding a hearing aid to the opposite
ear, termed bimodal hearing. The best results are obtained when their hearing, speech, and language abilities are properly
verified. The Arabic version of auditory perception of alphabet letters (APAL) is a reliable test of speech perception
appropriate for use with kids who speak Arabic but have hearing impairment and a limited vocabulary.
Aim: Children who use linked hearing aids and cochlear implants were evaluated to test the correlation between the (APAL)
test and auditory abilities, language acquirement and speech parameters.
Design: Eleven children were studied twice first 3 months after unilateral CI turn on and second 3 months after fitting linked
hearing aid (HA) in non-implanted ear (6 months after CI turn on). Assessment of APAL test was performed in the audio-
vestibular medicine department and the evaluation of speech characteristics, language, and auditory skills in the ENT
department's Phoniatric Unit. Zagazig University. The findings were compiled and statistically evaluated.
Results: A statistically significant increase in correct scores of APAL test as well as language and auditory assessment after
bimodal stimulation. There was a statistically significant +ve correlation (r=0.70 & p=0.02) between APAL and CAP among
the studied cases.
Conclusion: APAL can be regarded as a reliable speech discrimination test that predicts the progress of a number of pre-
lingual bimodal children's skills.
Keywords: auditory perception, bimodal system, APAL, Arabic speaking.
INTRODUCTION
a dedicated bimodal solution designed to further increase
Cochlear implants(CIs) which are designed to
performance in bimodal listeners. All of the functionality
successfully regain hearing, can help those with severe to
and signal processing on both devices are perfectly
profound hearing loss. Indication criteria for CI eligibility
matched, making them ideal for use together (3).
have changed in recent years, enabling patients to pursue
A speech test called the (APAL) was translated and
cochlear implantation if they have significant aidable
standardized to evaluate children who lacked the
hearing in the opposite ear. Bimodal hearing occurs when
vocabularies necessary for assessments like the WIPI
such patients continue to use a hearing aid (HA) in the
(Word Intelligibility by Picture Identification) or the
non-implanted ear. Unilateral CI recipients benefit greatly
phonetically balanced kindergarten tests (PBKG) (4).
from the ability to access low-frequency hearing through
This investigation was carried out to assess the
a hearing aid because it enhances their ability to
correlation between the Arabic version of the APAL and
understand speech in noisy environments, sharpens their
the auditory language development in Arabic speaking
ability to detect differences in pitch, music and voices,
bimodal children.
and provide enriched sound quality. Binaural summation,
the binaural squelch effect, redundancy effects, with a
SUBJECTS AND METHODS
head shadow effect all contribute to a higher subjective
This study was given the go light by the Research Ethics
sense of well-being (1).
Committee of the Zagazig University Hospitals' School of
Bilateral CI is expensive and invasive, but there is a
Medicine. After thoroughly explaining the testing
nonsurgical option which is the bimodal hearing.
procedures for all participants, signed informed consent
Amplification in the unimplanted ear is a potential option
was acquired. Human subjects' research was carried out
for people who still have some low-frequency hearing (2).
in compliance with the World Medical Association's
It was found recently that bimodal listeners judged
(WMA) Manifesto of Helsinki.
the sound quality of matched linked devices in a study
higher and had greater gains in speech comprehension.
Study design: Children aged 3 to 6 (n = 11) who received
The Phonak Naida Link and Naida CI hearing aids (Q70
cochlear implant (CI) surgery followed by the linked
or Q90) sound processor from Advanced Bionics make up
fitting of a hearing aid (HA) in the other ear were analyzed
1988
Received: 14/09/2022
Accepted: 17/11/2022
c:\work\Jor\vol901_298
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 1996-2000
Value of Mean Platelet Volume in Diagnosis of Neonatal Sepsis
Ahmed Salah Abdelhalim Metwally*1, Mohamed Ahmed Arafa2,
Hadeel Mohamed Abd Elmonem1, Amr I. Risha1
1Department of Pediatrics, Faculty of Medicine Zagazig University, Egypt
2Department of Medical Microbiology and Immunology, Al-Ahrar Teaching Hospital, Zagazig, Egypt
*Corresponding author: Ahmed Salah Abdelhalim Metwally, Mobile: (+20) 01111543427, E-Mail: salahabo89@gmail.com
ABSTRACT
Background: Early management is necessary for neonatal sepsis (NS), a clinical disease that may be life-threatening.
Initial symptoms are frequently vague and might resemble a number of other medical disorders. In newborn populations,
NS is a significant cause of death and morbidity.
Objective: The objective of this study was to study Mean Platelet Volume (MPV) in diagnosis and of neonatal sepsis.
Patients and Methods: This study was a case control study which conducted at Neonatology unit, Pediatrics
department, Zagazig University Hospitals. Mean Platelet Volume were measured for all neonates.
Results: There was no statistically significant difference between cases group and controls group regarding
demographic data. There was statistically positive correlation between MPV and WBCs and negative correlation
between MPV and (Apgar score). MPV showed a significant negative correlation with gestational age, birth weight,
platelet count, whereas it showed statistically significant positive correlation with CRP and the I/T ratio. In this study,
regarding Diagnostic accuracy of MPV, Sensitivity was 96.7%, Specificity was 93.3%, PPV was 67.4%, NPV was 50%
and accuracy was 66.7%.
Conclusion: MPV increases significantly in neonates with sepsis. MPV could be a useful as early diagnostic marker in
neonatal sepsis.
Keywords: Mean Platelet Volume, Diagnosis, Neonatal Sepsis.
INTRODUCTION
detected in blood is gauged by mean platelet volume.
Due to its high morbidity and mortality, neonatal
The development of a more invasive infection or the
sepsis has become a challenge for world health (1).
existence of an infection that is resistant to antibiotic
Sepsis kills almost 0.6 million infants annually, or 22%
treatment might both be indicated by a rise in MPV (6).
of all neonatal fatalities, in the world. Clinicians face a
The present work aimed to study MPV in diagnosis
severe difficulty with this (2). Blood culture is the
of neonatal sepsis.
diagnostic standard for sepsis, although it has a limited
sensitivity and often takes 4272 hours to get a
PATIENTS AND METHODS
response. These flaws frequently cause delayed and
Technical design:
missing diagnosis (3).
A. Study setting: Neonatology unit, Pediatrics
A perfect sepsis biomarker with high sensitivity,
department, Zagazig University Hospitals.
specificity, positive predictive value (PPV), and
B. Sample size: Sample size is 45 divided into 2 groups.
negative predictive value (NPV) has been continuously
Case group: 30 neonates diagnosed NS.
sought after in order to diagnose and rule out neonatal
Control group: 15 neonates were apparently healthy
sepsis as early as possible and begin giving the newborn
control.
the proper medications. When not to administer
Inclusion criteria: Full term neonates and preterm
antibiotics when sepsis is suspected and how long to
neonates.
administer antibiotics for when sepsis is confirmed will
Exclusion criteria: Dysmorphic features suggestive of
be determined by the ideal sepsis biomarker (4).
chromosomal anomalies. Perinatal asphyxia, and
Newborn referral to a hospital should be prompted
neonates under course of antibiotics prior to appropriate
by the following common clinical indications of
blood sampling.
neonatal sepsis: difficulties feeding, seizures,
movement only when encouraged, respiration rate >60
Operational design:
per min, severe chest in drawn, and axillary temperature
Study design: This a case control study that approved
>37.5°C or <35.5°C (2).
by from institutional review board (IRB).
Finding indicators for newborn sepsis that
accurately pinpoint patients who are at risk of infection
All neonates were subjected to the following:
has long been a goal of research (5).
1- Complete history:
The platelet histogram on automated Coulter
2- Clinical examination including assessment of:
counters yields the Mean Platelet Volume (MPV),
Gestational age.
which is the arithmetic mean volume of the platelets. In
Birth weight.
femtoliters (fL), it is measured. Megakaryocyte ploidy
Clinical signs of sepsis: poor suckling, lethargy,
and platelet number, which are cytokine dependent,
poor Moro reflex, RD, Jaundice...etc
control platelet volume. The average size of platelets
1996
Received: 12/09/2022
Accepted: 14/11/2022
c:\work\Jor\vol901_299
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 2001-2005
Fetal-Maternal Morbidity and Mortality as Outcome of
Premature Rupture of Membrane (PROM)
Yousef Mohamed El-Mazzally*1, Saged Mohamed El-Mazzally2
Department of 1Community and Industrial Medicine and
2Obstetrics and Gynecology, Faculty of Medicine, Al-Azhar University, Egypt
*Corresponding author: Yousef Mohamed El-Mazzally, Mobile: (+20) 01227298616, E-Mail: yousefmetwaly11@yahoo.com
ABSTRACT
Background: The risk of prenatal morbidity and death associated with PPROM is more than 20%, and the outcome is
significantly impacted by the gestational age at delivery.
Objectives: The goal of the study was to determine the fetal/maternal outcomes for pregnant patients at Al-Azhar
University Hospitals in Cairo who had PPROM as well as any possible risk factors for adverse fetal/neonatal outcomes.
Patients and Method: At the Al-Azhar University Hospitals in Cairo, cross-sectional research including 48 women
with PROM was done. The trial was from February 2022 to August 2022. All patients were received a thorough history,
a general examination, and laboratory tests.
Results: In terms of fetal result, 56.3% of infants experienced poor outcomes, such as fetal death and ICU admission,
compared to 43.7% of infants who experienced positive outcomes (alive & well).The multivariate analysis revealed that
later gestational age at PPROM (OR 0.7 CI 0.22 - 0.91) and gush type of PPROM (OR 1.6 CI 1.2 - 3.2), history of
chorioamnionitis (OR 17.5 CI 13.9 - 129.7), delivery by CS (OR 3 CI 2.45 - 4.6), and women employment (OR 1.7 CI
1.3 - 3.3) were significant independent.
Conclusion: PPROM necessitates adequate prenatal care and therapy since it is linked to fetal/maternal morbidity and
death.
Keywords: PPROM, Fetal outcome, Maternal Outcome.
INTRODUCTION
maternal weight increase, invasive procedures
Fetal chorioamniotic membranes prematurely
including cervical cerclage and amniocentesis, and
rupture before labor even begins (1). Three percent of
pregnancy problems like gestational diabetes or
pregnancies result in premature rupture of the
already-existing diabetes (4).
membranes (PROM), which causes around one-third of
Premature membrane rupture is a significant
all preterm deliveries. Premature membrane rupture is a
contributor to perinatal morbidity and death. It is
significant contributor to perinatal morbidity and death.
specifically linked to quick turnaround periods between
It is specifically linked to quick turnaround periods
membrane rupture and birth, perinatal infections, and
between membrane rupture and birth, perinatal
umbilical cord compression brought on by
infections, and umbilical cord compression brought on
oligohydramnios. 5060% of women with early PROM
by oligohydramnios. 5060% of women with early
will give birth within a week of their membranes
PROM will give birth within a week of their membranes
rupturing, even with conservative care. Early PROM is
rupturing, even with conservative care. Early PROM is
frequently accompanied by amnionitis (1360%) and
frequently accompanied by amnionitis (1360%) and
clinical placental abruption (412%). When the
clinical placental abruption (412%). When the
membranes rupture, the risk of severe problems rises
membranes rupture, the risk of severe problems rises
with a shorter gestational age (2).
with a shorter gestational age (2).
This study's objective was to identify the fetal and
Genital tract infections and their function as
maternal outcomes of pregnant patients with PPROM
PPROM pathogens have received a lot of attention in
who presented to the Al-Azhar University Hospital in
recent PPROM literature. There were many different
Cairo, as well as any possible risk factors for adverse
species participating in the quest. The majority of the
fetal and neonatal outcomes.
bacteria recovered from women's amniotic fluid and
linked to PROM, according to a study of microbial
PATIENTS AND METHODS
invasion of the amniotic cavity, resembled those
This cross-sectional study was conducted in the
typically present in the lower genital tract (3).
Emergency Department of Al-Azhar University
Among the risk factors for PROM are maternal
Hospital, Cairo, in 48 women with premature rupture of
history of the condition, including previous pregnancies
membranes undergoing vaginal delivery between
(risk of recurrence 16% to 32% compared with 4% in
February 2022 and August 2022.
an uncomplicated term pregnancy), vaginal bleeding
prior to delivery, long-term steroid use, collagen
Sample size: Forty eight (48) women were included in
vascular diseases like Ehlers-Danlos syndrome and
the sample because there were a total of 7800 women
systemic lupus erythematosus, abdominal trauma,
who visited Al-Azhar University Hospitals in Cairo
previous preterm births, smoking, substance abuse,
between February 2022 and August 2022 (population
anemia, low BMI Other risk factors in this group were
size) and early rupture of membranes was 4.7% of the
2001
Received: 11/09/2022
Accepted: 13/11/2022
c:\work\Jor\vol901_300
The Egyptian Journal of Hospital Medicine (January 2023) Vol. 90, Page 2006-2013
Cognitive Impairment, Extrapyramidal Manifestations, and their impact on
Quality of Life in Patients with HCV-Related Chronic Liver Diseases
Salwa M. Rabie*1, Enas M. Hassan1, Hana K. Fathelbab2,
Wael M. Abd El Ghani2, Shimaa Hassanen2, Nermin A. Hamdy1, Rasha N. Saleh1
Departments of 1Neurology and Psychiatry and
2Tropical Medicine and Gastroenterology, Faculty of Medicine, Minia University, Egypt
*Corresponding author: Salwa M. Rabie, Mobile: (+20) 01142741126, E-Mail: znaty2018@yahoo.com
ABSTRACT
Background: Hepatitis C virus (HCV) infection is one of the main causes of chronic liver disease worldwide. It has
been shown that up to 50% of patients with chronic HCV infection experience neuropsychiatric issues.
Objective: This study aimed to evaluate the cognitive impairment, extrapyramidal signs and their effects on patients'
quality of life.
Patients and Methods: The study included 60 untreated patients (20 chronic hepatitis, 40 patients with liver cirrhosis)
and 20 healthy controls matched for age, sex, and educational level. Cirrhotic patients were graded according to the
Child-Pugh classification. Patients underwent a thorough clinical and neurological evaluation, liver function tests,
hepatitis markers, abdominal ultrasonography, psychometric tests and auditory p300 evoked potentials. Unified
Parkinson's Disease Rating Scale (UPDRS) and chronic liver disease questionnaire (CLDQ) were used.
Results: Patients had significant cognitive impairment that became greater with increased severity of liver disease. The
extrapyramidal manifestations were absent in chronic hepatitis while present in cirrhotics and their frequencies were
increased with cirrhotic severity (P~0.001). P300 latency was delayed in patients with and without extrapyramidal signs.
Quality of life measured by CLDQ was significantly lower in all patients than controls (P~ 0.001), and became worse
with increased severity of liver disease except worry increased in chronic hepatitis.
Conclusion: Patients with HCV infection had cognitive impairment, which increased with chronic liver disease (CLD)
severity. Extrapyramidal signs were absent in chronic hepatitis patients, while, present in cirrhotics and increased with
increasing severity of cirrhosis. Cognitive impairment was not attributed to the extrapyramidal affection. The CLD and
cognitive impairment had negative impact on the quality of life.
Keywords: HCV, CLD, Cognitive impairment, Health related quality of life (HLQOL).
INTRODUCTION
self-rating in psychometric testing are eliminated by
A severe global health issue that affects 200
ERPs, an objective and objectively independent
million individuals globally is the hepatitis C virus
assessment of brain information processing. P300
(HCV) infection. Hepatocellular carcinoma and
amplitude displays the synchronisation and activation of
irreversible liver damage are potential outcomes of both
the cortical regions in charge of carrying out the task,
acute and chronic hepatitis. Up to 50% of people with
whereas P300 delay illustrates the processing time
chronic HCV infection have been observed to have
required to classify the stimuli (7).
neuropsychiatric problems. Even before hepatic
This study aimed to evaluate the cognitive
cirrhosis manifests, hepatitis C virus (HCV) patients
impairment, extrapyramidal signs and their effects on
report cognitive decline, which they have referred to as
patients' quality of life.
"brain fog" (1). Growing data suggests that chronic
hepatitis C virus infection affects cognitive function,
PATIENTS AND METHODS
with viremic people specifically showing worse focus
This study included 60 untreated patients with
and working memory speed (2).
chronic HCV related liver disease without overt hepatic
Two forms of dysfunctions in hepatic patients
encephalopathy (20 with chronic hepatitis and 40 with
without acute hepatic encephalopathy and without
liver cirrhosis) and 20 age- and sex- matched apparently
evident neurological damage can be identified. These
healthy persons as a control. Patients were registered for
cognitive impairments, also known as mild hepatic
follow-up in the outpatient department, no intervention
encephalopathy (mHE), are typically accompanied by
or blood samples or extra-ordinary investigations were
attentional problems and atypical extrapyramidal motor
requested.
behavior (3-4). Both abnormalities might be caused by
From the inpatient and outpatient clinics of the
basal ganglia lesions that result in subcortical cognitive
Tropical Medicine department at Minia University
impairment, which could also account for the motor and
Hospital, patients with chronic liver disease were
cognitive changes seen in cirrhotic patients (5-6).
chosen. The relatives of the patients were used to
When it comes to spotting early alterations in
randomly choose the controls.
cirrhotic patients' brain function, event-related
Exclusion criteria: Patients with hepatocellular
potentials (ERPs) appear to be a more sensitive
carcinoma or other malignancies, chronic medical
instrument than psychometric assessments. The
diseases, psychiatric or neurological diseases or patients
potential biases of fatigue, latent depression, or poor
2006
Received: 16/08/2022
Accepted: 19/10/2022
/center>